Ganot P, Kallesøe T, Reinhardt R, Chourrout D, Thompson EM.
Mol Cell Biol. 2004 Sep;24(17):7795-805. doi:10.1128/MCB.24.17.7795-7805.2004
Spliced-Leader RNA trans Splicing in a Chordate, Oikopleura dioica, with a Compact Genome.
5′ splice leader (SL) found in 90/158 ESTs containing a start codon. The SL RNA is found downstream of the 5S RNA in at least 40 occurences, and aproximately 2/3 of all the 5S rRNA genes. Its sequence is ACTCATCCCATTTTTGAGTCCGATTTCGATTGTCTAACAG
. O. doica is the first chordate where gene operons have been described. Intercistronic regions are very short (<30 nt). “In comparing 52 distinct trans-splice acceptor sites to 605 cis-splice acceptor sites, the same consensus sequence, `TTT(C/T/A)AG`, was observed at both intron and intercistronic region 3′ ends. A notable difference from cis splicing was that most exons trans spliced to the leader (133 of 145) started with an adenosine, whereas the start of cis-spliced exons did not show any nucleotide preference.” In the cycD operon, only the last gene (cycD) has a `AAUAAA` polyadenylation signal.