Dernières modifications :

Merge branch 'master' of ssh://charles-plessy-org.branchable.com
Café
diff --git a/biblio/18622036.mdwn b/biblio/18622036.mdwn
new file mode 100644
index 00000000..c27891eb
--- /dev/null
+++ b/biblio/18622036.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Chromosomal rearrangement inferred from comparisons of 12 Drosophila genomes."]]
+[[!tag Drosophila synteny]]
+
+Bhutkar A, Schaeffer SW, Russo SM, Xu M, Smith TF, Gelbart WM.
+
+Genetics. 2008 Jul;179(3):1657-80. doi:10.1534/genetics.107.086108
+
+Chromosomal rearrangement inferred from comparisons of 12 Drosophila genomes.
+
+[[!pmid 18622036 desc="“This analysis reveals between 42 (D. sechellia) and 1430 (D. willistoni) syntenic blocks across various species on the basis of the D. melanogaster gene order.”  “Comparison of syntenic blocks across this large genomic data set confirms that genetic elements are largely (95%) localized to the same Muller element across genus Drosophila species and paracentric inversions serve as the dominant mechanism for shuffling the order of genes along a chromosome.”  “When we infer that a breakpoint is reused we mean that two or more breakage events occurred within the nucleotide interval between blocks, but the events are not necessarily coincident within the breakpoint”"]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 4c67537f..150cfa8c 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -1,8 +1,11 @@
 [[!meta title="pages tagged synteny"]]
 
-[[Drosophila 12 Genomes Consortium (2007)|biblio/17994087]] sequenced
-across the _Drosophila_ genus and showed synteny conservation ranging
-between few large blocks with many genes to many small blocks with few genes.
+[[Drosophila 12 Genomes Consortium (2007)|biblio/17994087]] sequenced across
+the _Drosophila_ genus and showed synteny conservation ranging between few
+large blocks with many genes to many small blocks with few genes.  [[Bhuktar
+and coll. (2008)|biblio/18622036]] counted “between 42 (D. sechellia) and 1430
+(D. willistoni) syntenic blocks across various species on the basis of the D.
+melanogaster gene order”.
 
 [[Carbone and coll. (2014)|biblio/25209798]] found 96 gibbon–human synteny
 breakpoints (~30 per Gb), associated with segmental duplication or Alu element

Café
diff --git a/biblio/34934012.mdwn b/biblio/34934012.mdwn
new file mode 100644
index 00000000..cdbb799c
--- /dev/null
+++ b/biblio/34934012.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="AnchorWave: Sensitive alignment of genomes with high sequence diversity, extensive structural polymorphism, and whole-genome duplication."]]
+[[!tag genome alignment software]]
+
+Song B, Marco-Sola S, Moreto M, Johnson L, Buckler ES, Stitzer MC.
+
+Proc Natl Acad Sci U S A. 2022 Jan 4;119(1):e2113075119. doi:10.1073/pnas.2113075119
+
+AnchorWave: Sensitive alignment of genomes with high sequence diversity, extensive structural polymorphism, and whole-genome duplication. 
+
+[[!pmid desc=""1) Maps a transcriptome to its reference genome.  2) Extracts "anchor" coding sequences.  3) Searches for homologous sequences in the query genome.  4) Realigns the sequences between homologous anchors.  The so-called comparison to LAST is actually a comparison with LAST + AxtChain, that is: it does not use last-split.]]

Café
diff --git a/biblio/34755656.mdwn b/biblio/34755656.mdwn
new file mode 100644
index 00000000..ff545856
--- /dev/null
+++ b/biblio/34755656.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Germline development during embryogenesis of the larvacean, Oikopleura dioica."]]
+[[!tag Oikopleura H3S28p]]
+
+Dev Biol. 2022 Jan;481:188-200. doi:10.1016/j.ydbio.2021.10.009
+
+Nishida H, Matsuo M, Konishi S, Ohno N, Manni L, Onuma TA.
+
+Germline development during embryogenesis of the larvacean, _Oikopleura dioica_.
+
+[[!pmid 34755656 desc="Identified a CAB (centrosome-attracting body) “for the following reasons. (1) There was a clear boundary between the CAB-like region and the general cytoplasm, but the membrane structure did not surround the CAB. (2) It contained an electron-dense matrix that resembled a germplasm. (3) The region was devoid of mitochondria but contained ER. (4) It was present beneath the cell membrane, and the cell surface exhibited microvilli. (5) It was present in the germline lineage cells.”  ”The longest diameter of the CAB was approximately 10 ​μm.“  It was observed between the late 8-cell stage and some 1.5-h embryos, but not after 2h.  It was stained by the H3S28p rat monoclonal antibody (Abcam ab10543) but not by DAPI.  The _snail_ mRNA also colocalises with the CAB's H3S28p staining.  A germ body (GB) “appeared [in PGCs] 13 ​min after the 5th cleavage [and] disappeared 1.5 ​h after fertilization at 20 ​°C.  It is discussed whether the GB and the CAB are or are not the same structure."]]
diff --git a/tags/H3S28p.mdwn b/tags/H3S28p.mdwn
index 7d6c92a2..f906bf6c 100644
--- a/tags/H3S28p.mdwn
+++ b/tags/H3S28p.mdwn
@@ -40,4 +40,8 @@ punctate centromere staining at ”late prophase“, a stronger signal (but hard
 to resolve) at metaphase, a weaker signal at anaphase and a weaker or no signal
 at telophase.  Table S1, listing the antibodies used, is missing.
 
+The rat monoclonal antibody (Abcam ab10543) stains the centromere-attracting
+body in _O. dioica_, Osaka lab. strain. ([[Nishida and coll.,
+2021|biblio/34755656]]), probably by cross-reactivity.
+
 [[!inline pages="tagged(H3S28p)" limit=0]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index e4e9fcb0..a05e4d9f 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -397,6 +397,9 @@ Development
    hindbrain, and spinal cord, but not the midbrain.  No expression of
    _pax2/5/8_ is detected between the _otxa_ + _otxb_ and the _hox1_ territories.
    ([[Cañestro et al., 2005|biblio/16111672]]).
+ - A centromere-attracting body is resoponsible for asymetric cell division in
+   primordial germ cells ([[Nishida and coll., 2021|biblio/34755656]]).  The
+   _snail_ mRNA co-localises with it.
  - The _pum1_ and _vas4_ RNAs show localised expression during development. Prior
    hatching, _pum1_ is found outside the embryo ([[Olsen et al., 2018|biblio/29486709]]).
  - Duplicated developmental genes were found by [[Denoeud et al., 2010|biblio/21097902]],

Papa in the air, wohohowoooowooo
diff --git a/biblio/14500911.mdwn b/biblio/14500911.mdwn
new file mode 100644
index 00000000..b0985a4d
--- /dev/null
+++ b/biblio/14500911.mdwn
@@ -0,0 +1,18 @@
+[[!meta title="Evolution's cauldron: duplication, deletion, and rearrangement in the mouse and human genomes."]]
+[[!tag software method synteny genome alignment variants]]
+
+Kent WJ, Baertsch R, Hinrichs A, Miller W, Haussler D.
+
+Proc Natl Acad Sci U S A. 2003 Sep 30;100(20):11484-9. doi:10.1073/pnas.1932072100
+
+Evolution's cauldron: duplication, deletion, and rearrangement in the mouse and human genomes.
+
+[[!pmid 14500911 desc="Primary paper for chains and nets, built with the BLASTZ and AXTCHAIN programs.  Chains are one-to-many alignments and allow skipping over local inversions.  In human/mouse comparisons, 2.0 inversion per Mbp, median length 814.  Double gaps ≥ 100 per Mbp: 398.6, median length 411.  Chains are called “short” when their span is <100,000 bases (span distribution of short chains apparently bimodal).  579 “long” chains (average length 983 kb) cover 32.9% of the bases in the human genome.  Collectively all chains span 96.3% of the human genome and align to 34.6% of it.  The authors note that the observed distribution of gap lengths violate the usual affine model of aligners."]]
+
+“A chained alignment [is] an ordered sequence of traditional pairwise nucleotide alignments (“blocks”) separated by larger gaps, some of which may be simultaneous gaps in both species. [...] intervening DNA in one species that does not align with the other because it is locally inverted or has been inserted in by lineage-specific translocation or duplication is skipped”
+
+“The chains are then put into a list sorted with the highest-scoring chain first. [...] each iteration taking the next chain off of the list, throwing out the parts of the chain that intersect with bases already covered by previously taken chains, and then marking the bases that are left in the chain as covered. [...] If a chain covers bases that are in a gap in a previously taken chain, it is marked as a child of the previous chain. In this way, a hierarchy of chains is formed that we call a net.”
+
+“To be considered syntenic, a chain has to either have a very high score itself or be embedded in a larger chain, on the same chromosome, and come from the same region as the larger chain. Thus, inversions and tandem duplications are considered syntenic.”
+
+“We define the (human) span of a chain to be the distance in bases in the human genome from the first to the last human base in the chain, including gaps, and we define the size of the chain as the number of aligning bases in it, not including gaps.”
diff --git a/tags/assembly.mdwn b/tags/assembly.mdwn
index 24b4f29f..bafbfec1 100644
--- a/tags/assembly.mdwn
+++ b/tags/assembly.mdwn
@@ -92,4 +92,7 @@ by [[Hoff and Stanke, 2018|biblio/30466165]].
 A reference assembly can be used to search for structural variants in a different
 individual, for instance with NanoSV ([[Cretu Stancu and coll., 2017|biblio/29109544]]).
 
+In [[2003, Kent and coll.|biblio/14500911]] aligned the human and mouse genome
+together using the BLASTZ and AXTCHAIN software.
+
 [[!inline pages="tagged(assembly)" actions="no" limit=0]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index bc987514..a44e3cd9 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -69,4 +69,7 @@ phenomenon “mesosynteny”.
    orthologue co-occurs close by in the other genome. It varies between 0 (no
    co-occurrence) and 1 (complete gene order conservation)”.
 
+ - “Chains” and “nets” of pairwise alignements between two genomes are described
+   in [[Kent and coll, 2003|biblio/14500911]].
+
 [[!inline pages="tagged(synteny)" limit=0]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 75e312bd..5562a25e 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -38,6 +38,9 @@ supported by [[Steinberg and coll in 2012|biblio/22751100]].
 Ectopic recombination of a Galileo element may have caused a recent large-scale
 inversion in _D. buzzati_ ([[Delprat and coll, 2009|biblio/19936241]]).
 
+[[Kent and coll., 2003|biblio/14500911]] reported 2 inversions per Mbp in
+human/mouse comparisons, median length 814. 
+
 ### Software
 
  - _NanoSV_ ([[Cretu Stancu and coll., 2017|biblio/29109544]]) uses nanopore long

mesosynteny
diff --git a/biblio/21605470.mdwn b/biblio/21605470.mdwn
new file mode 100644
index 00000000..62caf98e
--- /dev/null
+++ b/biblio/21605470.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="A novel mode of chromosomal evolution peculiar to filamentous Ascomycete fungi."]]
+[[!tag yeast synteny]]
+
+Hane JK, Rouxel T, Howlett BJ, Kema GH, Goodwin SB, Oliver RP.
+
+Genome Biol. 2011;12(5):R45. doi:10.1186/gb-2011-12-5-r45
+
+A novel mode of chromosomal evolution peculiar to filamentous Ascomycete fungi.
+
+[[!pmid 21605470 desc="Defines “mesosynteny” as the phenomonon seen when gene order varies at the scale of whole chromosomes, but gene content of homologous chromosomes does not vary much.  Reports that in fungi, mesosynteny is found in filamentous Ascomycetes but not in other clades such as yeast.  Concludes on the possibility that inversions play a role in mesosynteny."]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 4c67537f..bc987514 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -40,6 +40,11 @@ and are estimated to be of 2 rearrangements/Myr”.  They defined synteny as
 “series of neighboring pairs of orthologs separated by less than 5
 nonneighboring reciprocal best-hits”.
 
+[[Hane and coll, 2011|biblio/21605470]] noted that in filamentous Ascomycetes,
+but not other fungi such as yeast, “genes are conserved within homologous
+chromosomes, but with randomized orders and orientations“ and call that
+phenomenon “mesosynteny”.
+
 ### Ancestral karyotpyes
 
  - The ancestral mammalian genome has 30 chromosomes ([[Zhou and coll., 2021|biblio/33408411]]).

yeaset
diff --git a/biblio/21819944.mdwn b/biblio/21819944.mdwn
new file mode 100644
index 00000000..8c5f03b5
--- /dev/null
+++ b/biblio/21819944.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Comparative study on synteny between yeasts and vertebrates."]]
+[[!tag yeast synteny]]
+
+Drillon G, Fischer G.
+
+C R Biol. 2011 Aug-Sep;334(8-9):629-38. doi:10.1016/j.crvi.2011.05.011
+
+Comparative study on synteny between yeasts and vertebrates.
+
+[[!pmid 21819944 desc="“Synteny blocks were defined as series of neighboring pairs of orthologs separated by less than 5 nonneighboring reciprocal best-hits in the two compared genomes.”  “In vertebrates, the number of synteny blocks increases exponentially with increasing divergence time, varying from a very small number of blocks, 43 between human and chimpanzee, to more than 1900 blocks between dog and zebrafish.”    “In yeasts, the number of synteny blocks is more restrained, varying from 26 between Candida albicans and C. dubliniensis up to 744 between Debaryomyces hansenii and Pichia pastoris. The number of blocks also exponentially increases along with protein divergence but only between 8 and 36% of divergence. At increasing phylogenetic distances, the number of synteny blocks decreases.”  “For both yeast and vertebrate, the average number of shared orthologs per synteny block decreases exponentially with increasing evolutionary distance”"]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 5ec7e063..4c67537f 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -33,6 +33,13 @@ the past ~5 My.  The chinese munjak has undergone much less fusions.  In most
 cases, long-range chromosome structure (Hi-C) is not conserved between theses
 two species [[Mudd and coll, 2020|biblio/32873878]].
 
+[[Drillon and Fischer, 2011|biblio/21819944]] “studied synteny conservation
+between 18 yeast species and 13 vertebrate species” and “show that
+rearrangement rates are on average 3-fold higher in vertebrates than in yeasts,
+and are estimated to be of 2 rearrangements/Myr”.  They defined synteny as
+“series of neighboring pairs of orthologs separated by less than 5
+nonneighboring reciprocal best-hits”.
+
 ### Ancestral karyotpyes
 
  - The ancestral mammalian genome has 30 chromosomes ([[Zhou and coll., 2021|biblio/33408411]]).

Café
diff --git a/tags/Drosophila.mdwn b/tags/Drosophila.mdwn
index 3e2143f9..ac722da8 100644
--- a/tags/Drosophila.mdwn
+++ b/tags/Drosophila.mdwn
@@ -46,4 +46,9 @@ to the Arrhenius law in [[Crapse and coll., 2021|biblio/34414660]].
 Ectopic recombination of a Galileo element may have caused a recent large-scale
 inversion in _D. buzzati_ ([[Delprat and coll, 2009|biblio/19936241]]).
 
+_Drosophila_ polytene chromosomes are in Rabl confirmation in interphase:
+chromosome arms form independent topological domains, centromeres cluster on
+the nuclear envelopped, and telomeres tend to be found on the opposite
+direction ([[Mathog and coll., 1984|biblio/6424026]]).
+
 [[!inline pages="tagged(Drosophila)" limit=0]]

Café
diff --git a/biblio/6424026.mdwn b/biblio/6424026.mdwn
new file mode 100644
index 00000000..fbb1dd9f
--- /dev/null
+++ b/biblio/6424026.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Characteristic folding pattern of polytene chromosomes in Drosophila salivary gland nuclei."]]
+[[!tag Drosophila chromosome]]
+
+Mathog D, Hochstrasser M, Gruenbaum Y, Saumweber H, Sedat J.
+
+Nature. 1984 Mar 29-Apr 4;308(5958):414-21. doi:10.1038/308414a0
+
+Characteristic folding pattern of polytene chromosomes in Drosophila salivary gland nuclei. 
+
+[[!pmid 6424026 desc="_Drosophila_ polytene chromosome arms form isolated topoplogical domains in interphase.  Centromeres are clustered near the nuclear enveloppe and telomeres tend to be on the opposite side (the Rabl conformation)."]]

Café
diff --git a/biblio/19936241.mdwn b/biblio/19936241.mdwn
new file mode 100644
index 00000000..4691eb18
--- /dev/null
+++ b/biblio/19936241.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="The transposon Galileo generates natural chromosomal inversions in Drosophila by ectopic recombination."]]
+[[!tag Drosophila repeat variants]]
+
+Delprat A, Negre B, Puig M, Ruiz A.
+
+PLoS One. 2009 Nov 18;4(11):e7883. doi:10.1371/journal.pone.0007883
+
+The transposon Galileo generates natural chromosomal inversions in Drosophila by ectopic recombination.
+
+[[!pmid 19936241 desc="In _D. buzzatii_, the 2z(3) inversion is flanked by several transposable elements, among which two Galileo repeats (cut-and-paste mechanism, members of the P element family), that “(i) are inserted in opposite orientation; (ii) present exchanged target site duplications; and (iii) are both chimeric”, suggesting ectopic recombination."]]
diff --git a/tags/Drosophila.mdwn b/tags/Drosophila.mdwn
index b4ecf0d4..3e2143f9 100644
--- a/tags/Drosophila.mdwn
+++ b/tags/Drosophila.mdwn
@@ -43,4 +43,7 @@ See also [[Muller elements|muller_element]].
 _D. melanogaster_'s development time course at different temperatures was fitted
 to the Arrhenius law in [[Crapse and coll., 2021|biblio/34414660]].
 
+Ectopic recombination of a Galileo element may have caused a recent large-scale
+inversion in _D. buzzati_ ([[Delprat and coll, 2009|biblio/19936241]]).
+
 [[!inline pages="tagged(Drosophila)" limit=0]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 9bc58e57..75e312bd 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -35,6 +35,9 @@ vicinity.  [[Donelly and coll., 2010|biblio/20116045]] gave a radically lower
 time estimate of 13,600 to 108,400 years, but an ancient origin was again
 supported by [[Steinberg and coll in 2012|biblio/22751100]].
 
+Ectopic recombination of a Galileo element may have caused a recent large-scale
+inversion in _D. buzzati_ ([[Delprat and coll, 2009|biblio/19936241]]).
+
 ### Software
 
  - _NanoSV_ ([[Cretu Stancu and coll., 2017|biblio/29109544]]) uses nanopore long

ahem
diff --git a/biblio/22751100.mdwn b/biblio/22751100.mdwn
new file mode 100644
index 00000000..d0af8f66
--- /dev/null
+++ b/biblio/22751100.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Structural diversity and African origin of the 17q21.31 inversion polymorphism."]]
+[[!tag variants]]
+
+Steinberg KM, Antonacci F, Sudmant PH, Kidd JM, Campbell CD, Vives L, Malig M, Scheinfeldt L, Beggs W, Ibrahim M, Lema G, Nyambo TB, Omar SA, Bodo JM, Froment A, Donnelly MP, Kidd KK, Tishkoff SA, Eichler EE.
+
+Nat Genet. 2012 Jul 1;44(8):872-80. doi:10.1038/ng.2335
+
+Structural diversity and African origin of the 17q21.31 inversion polymorphism.
+
+[[!pmid 22751100 desc="“In conclusion, we propose that the ancestral H2′ haplotype arose in eastern or central Africa and spread to southern Africa before the emergence of anatomically modern humans (Fig. 6). Approximately 2.3 million years ago, the inversion rearranged to what we now refer as the direct orientation haplotype (H1′).”"]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 98eb189d..9bc58e57 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -32,7 +32,8 @@ suppress crossovers not only inside the inversion but also close to it (within 1
 genome and calculated that it appeared ~3 million years ago, before the
 speciation of _Homo sapiens_.  Low-copy repeated sequences were found in the
 vicinity.  [[Donelly and coll., 2010|biblio/20116045]] gave a radically lower
-time estimate of 13,600 to 108,400 years.
+time estimate of 13,600 to 108,400 years, but an ancient origin was again
+supported by [[Steinberg and coll in 2012|biblio/22751100]].
 
 ### Software
 

ahem
diff --git a/biblio/20116045.mdwn b/biblio/20116045.mdwn
new file mode 100644
index 00000000..c8987b9c
--- /dev/null
+++ b/biblio/20116045.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="The distribution and most recent common ancestor of the 17q21 inversion in humans."]]
+[[!tag variants]]
+
+Donnelly MP, Paschou P, Grigorenko E, Gurwitz D, Mehdi SQ, Kajuna SL, Barta C, Kungulilo S, Karoma NJ, Lu RB, Zhukova OV, Kim JJ, Comas D, Siniscalco M, New M, Li P, Li H, Manolopoulos VG, Speed WC, Rajeevan H, Pakstis AJ, Kidd JR, Kidd KK.
+
+Am J Hum Genet. 2010 Feb 12;86(2):161-71. doi:10.1016/j.ajhg.2010.01.007
+
+The distribution and most recent common ancestor of the 17q21 inversion in humans.
+
+[[!pmid 20116045 desc="“Short tandem repeat polymorphism data indicate a very recent date for the most recent common ancestor, with dates ranging from 13,600 to 108,400 years, depending on assumptions and estimation methods”"]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index ad55feba..98eb189d 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -31,7 +31,8 @@ suppress crossovers not only inside the inversion but also close to it (within 1
 [[Stefansson and coll, 2005||biblio/15654335]] found an inversion in the human
 genome and calculated that it appeared ~3 million years ago, before the
 speciation of _Homo sapiens_.  Low-copy repeated sequences were found in the
-vicinity.
+vicinity.  [[Donelly and coll., 2010|biblio/20116045]] gave a radically lower
+time estimate of 13,600 to 108,400 years.
 
 ### Software
 

Café
diff --git a/biblio/15654335.mdwn b/biblio/15654335.mdwn
new file mode 100644
index 00000000..e5eaa6cf
--- /dev/null
+++ b/biblio/15654335.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="A common inversion under selection in Europeans."]]
+[[!tag variants]]
+
+Stefansson H, Helgason A, Thorleifsson G, Steinthorsdottir V, Masson G, Barnard J, Baker A, Jonasdottir A, Ingason A, Gudnadottir VG, Desnica N, Hicks A, Gylfason A, Gudbjartsson DF, Jonsdottir GM, Sainz J, Agnarsson K, Birgisdottir B, Ghosh S, Olafsdottir A, Cazier JB, Kristjansson K, Frigge ML, Thorgeirsson TE, Gulcher JR, Kong A, Stefansson K.
+
+Nat Genet. 2005 Feb;37(2):129-37. doi:10.1038/ng1508
+
+A common inversion under selection in Europeans.
+
+[[!pmid 15654335 desc="A 900-kb inversion polymorphism on 17q21.31 that has diverged ~3 million years ago.  One allele is rare exept in Europe, where it is positively selected.  Low-copy repeat sequences were found in the vicinity of the inversion."]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index a89e12e0..ad55feba 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -28,6 +28,11 @@ In the _Drosophila pseudoobscura / persimilis_ species complex, chromosomal inve
 suppress crossovers not only inside the inversion but also close to it (within 1–2 Mb)”
 ([[Machado, Haselkorn and Noor (2007)|biblio/17179068])].
 
+[[Stefansson and coll, 2005||biblio/15654335]] found an inversion in the human
+genome and calculated that it appeared ~3 million years ago, before the
+speciation of _Homo sapiens_.  Low-copy repeated sequences were found in the
+vicinity.
+
 ### Software
 
  - _NanoSV_ ([[Cretu Stancu and coll., 2017|biblio/29109544]]) uses nanopore long

Encore pseudoobscura
diff --git a/biblio/J1A1AAAAMAAJ.mdwn b/biblio/J1A1AAAAMAAJ.mdwn
new file mode 100644
index 00000000..a4dbe07a
--- /dev/null
+++ b/biblio/J1A1AAAAMAAJ.mdwn
@@ -0,0 +1,26 @@
+[[!meta title="Contributions to the Genetics, Taxonomy, and Ecology of Drosophila pseudoobscura and its relatives"]]
+[[!tag Drosophila]]
+
+Theodosius Dobzhansky and Carl Epling
+
+Carnegie Institution of Washington publicatino 554, Washington,	D. C., March 31st, 1944
+
+Contributions to the Genetics, Taxonomy, and Ecology of _Drosophila pseudoobscura_ and its relatives.
+
+“It is certain that if any kind of structural difference had been known between
+_D. pseudoobscura_ and _D. persimilis_, they would have been classed as species
+from the start. Calling them races, and designating them by the letters A and B
+instead of by Latin names, was an attempt to appease conservative taxonomists
+who continue to adhere to the purely morphological concepts of species and
+race. Such a course is neither scientifically consistent nor practically sound.
+The species is the stage in the process of evolutionary divergence at which an
+array of populations once actually interbreeding or capable of interbreeding
+has become split into two or more reproductively isolated arrays. Species exist
+in nature regardless of whether we can or cannot distinguish them by their
+structural characters.  There is no doubt that the great majority of animal and
+plant species differ structurally, and that they can be conveniently, and in
+most cases readily, recognized and delimited by their morphology alone. But it
+does not follow that any and all species are recognizable by their externally
+visible structures.”
+
+<https://books.google.com/books?id=J1A1AAAAMAAJ>
diff --git a/tags/Drosophila.mdwn b/tags/Drosophila.mdwn
index 43bf95af..b4ecf0d4 100644
--- a/tags/Drosophila.mdwn
+++ b/tags/Drosophila.mdwn
@@ -20,9 +20,10 @@ describe them as a network of successive large-scale inversions.  They also
 showed that the gene order of the X2 chromosome of _D. miranda_ is homologoues
 to the one of the hypothetical ancestor of chromosome 3 in _D. Pseudoobscura_.
 
-"Race B" of _D. pseudoobscura_ is now called "D. persimilis".  For some time
-it was thought that there are no morphological differences, but it was
-later found that the size of their penis differs ([[Rizki MT, 1951|biblio/14808171]]).
+"Race B" of _D. pseudoobscura_ is now called "D. persimilis" ([[Dobzhansky and
+Epling, 1944|biblio/J1A1AAAAMAAJ]]).  For some time it was thought that there
+are no morphological differences, but it was later found that the size of their
+penis differs ([[Rizki MT, 1951|biblio/14808171]]).
 
 ### Other
 

oops
diff --git a/biblio/16545148.mdwn b/biblio/16545148.mdwn
deleted file mode 100644
index d2383fc8..00000000
--- a/biblio/16545148.mdwn
+++ /dev/null
@@ -1,10 +0,0 @@
-[[!meta title="A recombinational portrait of the Drosophila pseudoobscura genome."]]
-[[!tag Drosophila variants]]
-
-Ortiz-Barrientos D, Chang AS, Noor MA.
-
-Genet Res. 2006 Feb;87(1):23-31. doi:10.1017/S0016672306007932
-
-A recombinational portrait of the _Drosophila pseudoobscura_ genome.
-
-[[!pmid 16545148 desc="“suppression of crossovers in inversion heterozygotes also extends to loci located outside the inversion but close to it (within 1–2 Mb)”"]]

oops
diff --git a/biblio/17179068.mdwn b/biblio/17179068.mdwn
new file mode 100644
index 00000000..f90cd25a
--- /dev/null
+++ b/biblio/17179068.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Evaluation of the genomic extent of effects of fixed inversion differences on intraspecific variation and interspecific gene flow in Drosophila pseudoobscura and D. persimilis."]]
+[[!tag Drosophila variants]]
+
+Machado CA, Haselkorn TS, Noor MA.
+
+Genetics. 2007 Mar;175(3):1289-306. doi:10.1534/genetics.106.064758
+
+Evaluation of the genomic extent of effects of fixed inversion differences on intraspecific variation and interspecific gene flow in _Drosophila pseudoobscura_ and _D. persimilis_.
+
+[[!pmid 17179068 desc="“suppression of crossovers in inversion heterozygotes also extends to loci located outside the inversion but close to it (within 1–2 Mb)”"]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 9b75127b..a89e12e0 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -26,7 +26,7 @@ Sturtevant|biblio/17246876]] in _D. pseudoobscura_.
 
 In the _Drosophila pseudoobscura / persimilis_ species complex, chromosomal inversions
 suppress crossovers not only inside the inversion but also close to it (within 1–2 Mb)”
-([[Ortiz-Barrientos, Chang and Noor (2006)|biblio/16545148])]
+([[Machado, Haselkorn and Noor (2007)|biblio/17179068])].
 
 ### Software
 

Encore pseudoobscura
diff --git a/biblio/16545148.mdwn b/biblio/16545148.mdwn
new file mode 100644
index 00000000..d2383fc8
--- /dev/null
+++ b/biblio/16545148.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="A recombinational portrait of the Drosophila pseudoobscura genome."]]
+[[!tag Drosophila variants]]
+
+Ortiz-Barrientos D, Chang AS, Noor MA.
+
+Genet Res. 2006 Feb;87(1):23-31. doi:10.1017/S0016672306007932
+
+A recombinational portrait of the _Drosophila pseudoobscura_ genome.
+
+[[!pmid 16545148 desc="“suppression of crossovers in inversion heterozygotes also extends to loci located outside the inversion but close to it (within 1–2 Mb)”"]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 02a2d4fd..9b75127b 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -24,6 +24,9 @@ A collection of gene arrangements where each pair is related is related by a
 single large-scale inversion was found by [[Dobzhansky and
 Sturtevant|biblio/17246876]] in _D. pseudoobscura_.
 
+In the _Drosophila pseudoobscura / persimilis_ species complex, chromosomal inversions
+suppress crossovers not only inside the inversion but also close to it (within 1–2 Mb)”
+([[Ortiz-Barrientos, Chang and Noor (2006)|biblio/16545148])]
 
 ### Software
 

Encore pseudoobscura
diff --git a/biblio/14808171.mdwn b/biblio/14808171.mdwn
new file mode 100644
index 00000000..4e21b8d5
--- /dev/null
+++ b/biblio/14808171.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Morphological differences between two sibling species; Drosophila pseudoobscura and Drosophila persimilis"]]
+[[!tag Drosophila]]
+
+Rizki MT
+
+Proc Natl Acad Sci U S A. 1951 Mar;37(3):156-9. doi:10.1073/pnas.37.3.156
+
+Morphological differences between two sibling species; _Drosophila pseudoobscura_ and _Drosophila persimilis_.
+
+[[!pmid 14808171 desc="The first morphological difference that distinguishes _D. persimilis_ from _D. pseudoobscura_: penis size."]]
diff --git a/tags/Drosophila.mdwn b/tags/Drosophila.mdwn
index 7f1fa583..43bf95af 100644
--- a/tags/Drosophila.mdwn
+++ b/tags/Drosophila.mdwn
@@ -2,6 +2,8 @@
 
 **  Work in progress **
 
+### _pseudoobscura_
+
 Analysis of Cox2 sequences of _Drosophila_ species by [[Beckenbach, Wei and Liu
 (1993)|biblio/8393127]] are most compatible with a speciation of _D.
 melanogaster_ and _D. pseudoobscura_ ~35 My ago.  Sequence divergence between
@@ -18,6 +20,12 @@ describe them as a network of successive large-scale inversions.  They also
 showed that the gene order of the X2 chromosome of _D. miranda_ is homologoues
 to the one of the hypothetical ancestor of chromosome 3 in _D. Pseudoobscura_.
 
+"Race B" of _D. pseudoobscura_ is now called "D. persimilis".  For some time
+it was thought that there are no morphological differences, but it was
+later found that the size of their penis differs ([[Rizki MT, 1951|biblio/14808171]]).
+
+### Other
+
 The ITS2 sequence of Drosophila species diverged at the speed of 1.2 % per million
 year ([[Schlötterer and coll., 1994|biblio/8015444]]).
 

Café
diff --git a/biblio/17246876.mdwn b/biblio/17246876.mdwn
new file mode 100644
index 00000000..d1e9ad3a
--- /dev/null
+++ b/biblio/17246876.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Inversions in the Chromosomes of Drosophila Pseudoobscura."]]
+[[!tag Drosophila variants]]
+
+Dobzhansky T, Sturtevant AH
+
+Genetics. 1938 Jan;23(1):28-64. doi:10.1093/genetics/23.1.28
+
+Inversions in the Chromosomes of Drosophila Pseudoobscura.
+
+[[!pmid 17246876 desc="Observation of polytene chromosomes in salivary glands of hybrid _D. pseudoobscura_ crossed form different populations showed lage-scale inversions in the 3rd chromosome.  The collection of haplotypes can be represented as a graph linking single inversion events.  Multiple haplotypes may coexist in the same geographical region."]]
diff --git a/tags/Drosophila.mdwn b/tags/Drosophila.mdwn
index ca999b86..7f1fa583 100644
--- a/tags/Drosophila.mdwn
+++ b/tags/Drosophila.mdwn
@@ -12,6 +12,12 @@ and Nei  (1995)|biblio/7739381]]) suggests that D. mel and D. pseudoobscura
 diverged 24.9 +/- 2.88 My ago, based on the assumption that D. picticornis and
 D. silvestris diverged 5.1 My ago.
 
+Variations of the gene order in the chromosome 3 of _D. Pseudoobscura_ were
+reported by [[Dobzhansky and Sturtevant|biblio/17246876]] in 1938, who could
+describe them as a network of successive large-scale inversions.  They also
+showed that the gene order of the X2 chromosome of _D. miranda_ is homologoues
+to the one of the hypothetical ancestor of chromosome 3 in _D. Pseudoobscura_.
+
 The ITS2 sequence of Drosophila species diverged at the speed of 1.2 % per million
 year ([[Schlötterer and coll., 1994|biblio/8015444]]).
 
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 3b21c19f..02a2d4fd 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -15,11 +15,16 @@ selection and increased genetic load in inversions and other types of variants
 [[Hämälä and coll., 2021|biblio/34408075]].
 
 ~1100 small-scale inversions are estimated to have happened between _S.
-cerevisiae_ and _C. albicans_ ([[|biblio/11087826]]).  The authors propose that
+cerevisiae_ and _C. albicans_ ([[Seoighe and coll., 2000|biblio/11087826]]).  The authors propose that
 “successive multigene inversions” have “distrupted” the “precise arrangement”
 of “genes that are adjacent in one species are in the same neighborhood”.  A
 “bias toward small inversions” is reported.
 
+A collection of gene arrangements where each pair is related is related by a
+single large-scale inversion was found by [[Dobzhansky and
+Sturtevant|biblio/17246876]] in _D. pseudoobscura_.
+
+
 ### Software
 
  - _NanoSV_ ([[Cretu Stancu and coll., 2017|biblio/29109544]]) uses nanopore long

Kiwi
diff --git a/biblio/34320186.mdwn b/biblio/34320186.mdwn
new file mode 100644
index 00000000..4a4d3a37
--- /dev/null
+++ b/biblio/34320186.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="BUSCO Update: Novel and Streamlined Workflows along with Broader and Deeper Phylogenetic Coverage for Scoring of Eukaryotic, Prokaryotic, and Viral Genomes."]]
+[[!tag annotation software]]
+
+Manni M, Berkeley MR, Seppey M, Simão FA, Zdobnov EM.
+
+Mol Biol Evol. 2021 Sep 27;38(10):4647-4654. doi:10.1093/molbev/msab199
+
+BUSCO Update: Novel and Streamlined Workflows along with Broader and Deeper Phylogenetic Coverage for Scoring of Eukaryotic, Prokaryotic, and Viral Genomes. 
+
+[[!pmid 34320186 desc="Based on OrthoDB v10.  Uses MetaEuk by default on eukaryotes, but AUGUSTUS is still available."]]
diff --git a/tags/assembly.mdwn b/tags/assembly.mdwn
index 0ed2af28..24b4f29f 100644
--- a/tags/assembly.mdwn
+++ b/tags/assembly.mdwn
@@ -80,12 +80,14 @@ interactive browsing with D-GENIES ([[Cabanettes and Klopp
 2018|biblio/29888139]]).
 
 BUSCO ([[Simão and coll., 2015|biblio/26059717]], [[Waterhouse and coll.,
-2017|biblio/29220515]]) assesses the presence of evolutionary conserved single-copy
-genes in the assemblies.  Seppey, Manni and Zdobnov EM ([[2019|biblio/31020564]])
-wrote a good introduction in _Methods Mol Biol_.
-
-BUSCO uses AUGUSTUS, and AUGUSTUS can be trained for a new species with
-transcriptome data, as explained by [[Hoff and Stanke, 2018|biblio/30466165]].
+2017|biblio/29220515]]) assesses the presence of evolutionary conserved
+single-copy genes in the assemblies.  Seppey, Manni and Zdobnov EM
+([[2019|biblio/31020564]]) wrote a good introduction in _Methods Mol Biol_.
+BUSCO v5 is based on OrthoDB v10, and support MetaEuk (default) and AUGUSTUS
+for eukaryotes [[Manni and coll., 2021|biblio/34320186]].
+
+AUGUSTUS can be trained for a new species with transcriptome data, as explained
+by [[Hoff and Stanke, 2018|biblio/30466165]].
 
 A reference assembly can be used to search for structural variants in a different
 individual, for instance with NanoSV ([[Cretu Stancu and coll., 2017|biblio/29109544]]).

Café
diff --git a/tags/Ciona.mdwn b/tags/Ciona.mdwn
index 62966202..2ac8eea9 100644
--- a/tags/Ciona.mdwn
+++ b/tags/Ciona.mdwn
@@ -42,6 +42,15 @@ were F1 and of _C. int_ maternal origin.  [[Ohta and coll,
 (CA) and _C. int_ from Woods Hole (MA), but viability was reduced, especially
 when maternal or grand-maternal origin was _C. int_.
 
+Non-read papers related to the _rob_-_int_ speciation: Primary Genetic Linkage
+Maps of the Ascidian, Ciona intestinalis. Shungo Kano, Nori Satoh, Paolo
+Sordino. Zoological Science, 23(1):31-39 (2006).
+https://doi.org/10.2108/zsj.23.31; Symmetrical Reproductive Compatibility of
+Two Species in the Ciona intestinalis (Ascidiacea) Species Complex, a Model for
+Marine Genomics and Developmental Biology. Atsuko Sato, Sebastian M. Shimeld,
+John D. D. Bishop. Zoological Science, 31(6):369-374 (2014).
+https://doi.org/10.2108/zs130249 
+
 _C. roulei_ can cross-hybridise easily with _C. intestinalis_, suggesting
 that they are the same species ([[Malfant, Darras and Viart, 2018|biblio/29367599]]).
 

Café
diff --git a/biblio/32518083.mdwn b/biblio/32518083.mdwn
new file mode 100644
index 00000000..318d4c32
--- /dev/null
+++ b/biblio/32518083.mdwn
@@ -0,0 +1,25 @@
+[[!meta title="Asymmetric Fitness of Second-Generation Interspecific Hybrids Between _Ciona robusta_ and _Ciona intestinalis_."]]
+[[!tag Ciona speciation]]
+
+Ohta N, Kaplan N, Ng JT, Gravez BJ, Christiaen L.
+
+G3 (Bethesda). 2020 Aug 5;10(8):2697-2711. doi:10.1534/g3.120.401427
+
+Asymmetric Fitness of Second-Generation Interspecific Hybrids Between _Ciona robusta_ and _Ciona intestinalis_.
+
+[[!pmid 32518083 desc="Comprehensive introduction on _intestinalis_-_robusta_ taxonomic situation.  Conclusions weakened by the the absence of homotypic F2 _C. intestinalis animals_ caused by the failure of _C. intestinalis_ to reproduce in the culture system.  The viability and fertility hybrids born from _intestinalis_ oocytes or _robusta_ (sperm) x _intestinalis_ (oocytes) oocytes is reduced."]]
+
+“Wild-type Ciona robusta (C. intestinalis type A) and Ciona intestinalis (C. intestinalis type B) adults were collected in San Diego (CA) and Woods Hole (MA)”.  “Sea water (Bio-Actif Salt, Tropic Marin) was controlled by bio-balls (Biomate, Lifegard Aquatics) seeded with bacteria (BioDigest, Prodibio)”.  “We obtained hundreds of swimming larvae from each cross [..] this contrasts with previous studies, which suggested that C. robusta oocytes were largely refractory to fertilization by C. intestinalis sperm”.  “there were no significant differences in the survival rate between F1 RxI and IxR hybrids”.  “By 50 dpf, half of the C. robusta individuals were producing sperm, whereas that proportion dropped significantly for the other groups of animals.”
+
+”For both RxI and IxR hybrids, the majority of animals had [orange pigment organ] at the tip of the sperm duct, in agreement with a previous report (Sato et al. 2014), thus indicating that [orange pigment organ] formation is a dominant trait.”
+
+”C. intestinalis has yellow and orange pigmentation around the tip of siphons that is lacking in C. robusta [...] the majority of RxI and IxR hybrids displayed a bright red pigmentation at the rim of oral and atrial siphons, also consistent with a previous report (Sato et al. 2014). The observation that siphon pigmentation displays an overdominant phenotype in hybrids is consistent with its lack of reliability for taxonomic purposes.“
+
+“the sperm of F1 RxI hybrid appeared less potent to fertilize C. robusta eggs than that of F1 IxR hybrids, which is reminiscent of previously reported difficulties in using C. robusta eggs in interspecific fertilizations.”  “Both BC1 (RxI)xR and (IxR)xR hybrids had lower survival rates than F2 C. robusta animals, while an ANOVA did not show significant differences in survival rate on 28 and 50 dpf between (RxI)xR and (IxR)xR hybrids.”
+
+“We obtained sperm from 7 and 10 individuals, and eggs from 7 and 11 F1 RxI and IxR mature animals, respectively, and used them for within-type fertilizations. Fertilization rates were significantly higher for IxR hybrids than for RxI hybrids” 
+
+“Finally, F2 IxR hybrids grew and matured to produce sperm and eggs (Table 5 and Supplemental table S3). The sperm and eggs could fertilize each other to produce F3 IxR hybrids, which survived at least 28 dpf, after which we stopped observations.”
+
+“simple quantitative traits, such as body size, showed an increased variability in F2 hybrids as expected for polygenic traits following allele segregation.”
+
diff --git a/tags/Ciona.mdwn b/tags/Ciona.mdwn
index f8d5002c..62966202 100644
--- a/tags/Ciona.mdwn
+++ b/tags/Ciona.mdwn
@@ -37,7 +37,10 @@ Hybrids were infertile and a _C. rob_ - _C. int_ cross from two sympatric
 strains from Plymouth did not develop beyond cleavage ([[Caputi and coll.,
 2007|biblio/17517633]]).  In line with this, the only hybdids found by the SNP
 analysis of wild animals of ([[Bouchemousse and coll., 2016|biblio/27662427]])
-were F1 and of _C. int_ maternal origin.
+were F1 and of _C. int_ maternal origin.  [[Ohta and coll,
+2020|bilbio/32518083]] reported fertile hybrids between _C. rob_ from San Diego
+(CA) and _C. int_ from Woods Hole (MA), but viability was reduced, especially
+when maternal or grand-maternal origin was _C. int_.
 
 _C. roulei_ can cross-hybridise easily with _C. intestinalis_, suggesting
 that they are the same species ([[Malfant, Darras and Viart, 2018|biblio/29367599]]).

heart
diff --git a/biblio/34789899.mdwn b/biblio/34789899.mdwn
new file mode 100644
index 00000000..8200ef1a
--- /dev/null
+++ b/biblio/34789899.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Cardiopharyngeal deconstruction and ancestral tunicate sessility."]]
+[[!tag Oikopleura]]
+
+Ferrández-Roldán A, Fabregà-Torrus M, Sánchez-Serna G, Duran-Bello E, Joaquín-Lluís M, Bujosa P, Plana-Carmona M, Garcia-Fernàndez J, Albalat R, Cañestro C.
+
+Nature. 2021 Nov;599(7885):431-435. doi:10.1038/s41586-021-04041-w
+
+Cardiopharyngeal deconstruction and ancestral tunicate sessility.
+
+[[!pmid 34789899 desc="Mesp, Ets1/2b, Gata4/5/6, Mek1/2, Hand-r and Tbx1/10 are absent from appendicularian genomes.   Nk4, Hand1/2 and FoxF were found."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index c5a59666..e4e9fcb0 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -252,6 +252,7 @@ Genes and pathways
  - 8 Wnt genes were found, belonging to 4 families.  Intronless _Wnt11_ genes
    were found; they might have been created by retrotransposition
    ([[Martí-Solans and coll., 2021|biblio/34179025]]).
+ - _Nk4_, _Hand1/2_ and _FoxF_ (heart development, [[Ferrández-Roldán and coll., 2021|biblio/34789899]]).
 
 ### Lost
 
@@ -285,7 +286,8 @@ Genes and pathways
  - _Nodal_ is not found in _O. dioica_'s genome ([[Onuma and coll., 2020|biblio/32029598]]).
  - Peroxysomes and genes related to them ([[Žárský and Tachezy, 2015|biblio/26700421]];
    [[Kienle, Kloepper and Fasshauer, 2016|biblio/27756227]]).
-
+ - _Mesp_, _Ets1/2b_, _Gata4/5/6_, _Mek1/2_,  _Hand-r_ and _Tbx1/10_ (heart development,
+   [[Ferrández-Roldán and coll., 2021|biblio/34789899]]).
 
 Epigenome
 ---------
@@ -457,7 +459,9 @@ Anatomy
    Electron microscopy shows a large perikaryon, cisternas and a cilium which is inserted
    in the central canal ([[Holmberg and Olsson, 1984|biblio/reissner_oik]]).
  - In contrary to Kowalevskiidae, ([[Brena, Cima and Burighel, 2003|biblio/10.1002_jmor.10145]]),
-   _Oikopleura_ do have a heart.
+   _Oikopleura_ do have a heart.  The genes _Mesp_, _Ets1/2b_, _Gata4/5/6_, _Mek1/2_,
+   _Hand-r_ and _Tbx1/10_, which are essential to heart development in other chordates
+   are lost in appendicularians ([[Ferrández-Roldán and coll., 2021|biblio/34789899]]).
  - A 3D reconstitution of hatchlings and jufeniles was done by SEM tomography by
    [[Nishida and coll., 2021|biblio/33649401]].
 

Café
diff --git a/biblio/34593604.mdwn b/biblio/34593604.mdwn
new file mode 100644
index 00000000..e411c73c
--- /dev/null
+++ b/biblio/34593604.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="DNA repair inhibition leads to active export of repetitive sequences to the cytoplasm triggering an inflammatory response."]]
+[[!tag repeat repair brain]]
+
+Song X, Aw JTM, Ma F, Cheung MF, Leung D, Herrup K.
+
+J Neurosci. 2021 Sep 28:JN-RM-0845-21. doi:10.1523/JNEUROSCI.0845-21.2021.
+
+DNA repair inhibition leads to active export of repetitive sequences to the cytoplasm triggering an inflammatory response. 
+
+[[!pmid 34593604 desc="Microglial cells accumulate cytoplasmic DNA by damage or inhibition of repair.  Blocking DNA export reduces accumulation of cytoplasmic DNA and inflamation.  Transcriptionally inactive sequences, AT-rich regions and repeated elements are enriched in the cytoplasmic DNA fraction."]]

Café
diff --git a/biblio/11087826.mdwn b/biblio/11087826.mdwn
new file mode 100644
index 00000000..4bf8aa81
--- /dev/null
+++ b/biblio/11087826.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Prevalence of small inversions in yeast gene order evolution"]]
+[[!tag variants yeast]]
+
+Proc Natl Acad Sci U S A. 2000 Dec 19;97(26):14433-7. doi:10.1073/pnas.240462997
+
+Seoighe C, Federspiel N, Jones T, Hansen N, Bivolarovic V, Surzycki R, Tamse R, Komp C, Huizar L, Davis RW, Scherer S, Tait E, Shaw DJ, Harris D, Murphy L, Oliver K, Taylor K, Rajandream MA, Barrell BG, Wolfe KH.
+
+Prevalence of small inversions in yeast gene order evolution
+
+[[!pmid 11087826 desc="Classifies pairs of gene orientations as ”parallel”, “convergent”, “divergent” and “alternative parallel” and studies combinations of these orientations in 298 adjacent gene paris from the _S. cerevisiae_ and the _C. albicans_ genomes, and the number of inversions they imply.  “We estimate that about 1,100 single-gene inversions have occurred since the divergence between these species”  (divergence happened ~200 million years ago)  “Our results suggest that successive random small inversions frequently cause a gene's chromosomal position and orientation to drift during its evolution. This process would alter gene order and orientation without moving any genes very far from their starting points.”"]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index a4ea2c03..3b21c19f 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -5,6 +5,8 @@ _in progress_
 Long read sequencing data from 3,622 Icelanders identified a median of 22,636
 SVs per individual (insertios: 13,353; deletions: 9,474) [[Beyter and coll, 2021|biblio/33972781]].
 
+### Inversions
+
 SNP analysis in >1400 seaweed flies identified known and candidate genomic inversions
 ([[Mérot and coll, 2021|biblio/33963409]]).
 
@@ -12,6 +14,12 @@ SV analysis of 31 diploid assemblies of _Theobroma cacao_ showed relaxed
 selection and increased genetic load in inversions and other types of variants
 [[Hämälä and coll., 2021|biblio/34408075]].
 
+~1100 small-scale inversions are estimated to have happened between _S.
+cerevisiae_ and _C. albicans_ ([[|biblio/11087826]]).  The authors propose that
+“successive multigene inversions” have “distrupted” the “precise arrangement”
+of “genes that are adjacent in one species are in the same neighborhood”.  A
+“bias toward small inversions” is reported.
+
 ### Software
 
  - _NanoSV_ ([[Cretu Stancu and coll., 2017|biblio/29109544]]) uses nanopore long

Café
diff --git a/biblio/PG_0485.mdwn b/biblio/PG_0485.mdwn
new file mode 100644
index 00000000..bf66a36c
--- /dev/null
+++ b/biblio/PG_0485.mdwn
@@ -0,0 +1,12 @@
+[[!meta title="Distribution of Oikopleura (Vexillaria) Dioica Fol, 1872 (Class: Appendicularia) in the southern Black sea in 2006-2007"]]
+[[!tag Oikopleura]]
+
+Funda Üstün, Levent Bat and Sengül Besiktepe
+
+Rapp. Comm. int. Mer Médit., 41, 2016, p485
+
+Distribution of Oikopleura (Vexillaria) Dioica Fol, 1872 (Class: Appendicularia) in the southern Black sea in 2006-2007
+
+https://ciesm.org/online/archives/abstracts/pdf/41/#
+
+O. dioica found in June 2006, October 2006 and May 2007, in 4 size classes infour size class (<0.5, 0.5-1, 1-2 and 2-3 mm).
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index d0ab666a..c5a59666 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -656,6 +656,7 @@ Ecology
    ([[Berry and coll., 2019|biblio/30735490]])
  - TARA Oceans ([[Vorobev and coll., 2020|biblio/32205368]]),
    [[Delmont and coll., biblio/10.1101_2020.10.15.341214v2]].
+ - In the southern Black sea in 2006–2007 ([[Üstün, Bat and Besiktepe, 2016|biblio/PG_0485]]).
 
 ### In the past:
 

creating tag page tags/plankton
diff --git a/tags/plankton.mdwn b/tags/plankton.mdwn
new file mode 100644
index 00000000..3f06dbfe
--- /dev/null
+++ b/tags/plankton.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged plankton"]]
+
+[[!inline pages="tagged(plankton)" actions="no" archive="yes"
+feedshow=10]]

Café
diff --git a/biblio/34011609.mdwn b/biblio/34011609.mdwn
new file mode 100644
index 00000000..07969fdf
--- /dev/null
+++ b/biblio/34011609.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Three genomes in the algal genus Volvox reveal the fate of a haploid sex-determining region after a transition to homothallism"]]
+[[!tag chromosome sex plankton]]
+
+Yamamoto K, Hamaji T, Kawai-Toyooka H, Matsuzaki R, Takahashi F, Nishimura Y, Kawachi M, Noguchi H, Minakuchi Y, Umen JG, Toyoda A, Nozaki H.
+
+Proc Natl Acad Sci U S A. 2021 May 25;118(21):e2100712118. doi:10.1073/pnas.2100712118
+
+Three genomes in the algal genus Volvox reveal the fate of a haploid sex-determining region after a transition to homothallism
+
+[[!pmid 34011609 desc="_Volvox_ has a sex-determining region (SDR) of ~1 Mb.  The homothallic species _Volvox africanus_ has a SDR-like region ressembling the female one, and a multicopy array of the male-determining gene (MID) at a different location."]]

creating tag page tags/replication
diff --git a/tags/replication.mdwn b/tags/replication.mdwn
new file mode 100644
index 00000000..9bffe547
--- /dev/null
+++ b/tags/replication.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged replication"]]
+
+[[!inline pages="tagged(replication)" actions="no" archive="yes"
+feedshow=10]]

Café
diff --git a/biblio/32561741.mdwn b/biblio/32561741.mdwn
new file mode 100644
index 00000000..a0c32e83
--- /dev/null
+++ b/biblio/32561741.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Direct observation of independently moving replisomes in Escherichia coli."]]
+[[!tag bacteria replication]]
+
+Japaridze A, Gogou C, Kerssemakers JWJ, Nguyen HM, Dekker C.
+
+Nat Commun. 2020 Jun 19;11(1):3109. doi:10.1038/s41467-020-16946-7
+
+Direct observation of independently moving replisomes in _Escherichia coli_.
+
+[[!pmid 32561741 desc="Replisomes were visualised with labelling the the β-clamp (DnaN).  The chromosome was labelled by attaching a mYpet fluorescent tag to the HU protein.  A temperature-sensitive DnaC allele was used to synchronise the cell cycles and to elongate the cells.  A MreB mutation was used to generate wider cells."]]

Café
diff --git a/biblio/10.2989_025776198784126476.mdwn b/biblio/10.2989_025776198784126476.mdwn
new file mode 100644
index 00000000..79451098
--- /dev/null
+++ b/biblio/10.2989_025776198784126476.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="The role of beak shape in octopodid taxonomy"]]
+[[!tag taxonomy]]
+
+R. S. Ogden , A. L. Allcock , P. C. Wats & J. P. Thorpe
+
+South African Journal of Marine Science, 1998, 20:1, 29-36, doi:10.2989/025776198784126476
+
+The role of beak shape in octopodid taxonomy
+
+[[!doi 10.2989/025776198784126476 desc="PCA and discriminant analysis on morphological measurments of beak shape in octopolids.  Geneera could be distinguished but not species."]]

In GR
diff --git a/biblio/10.1101_2020.03.14.992248v3.mdwn b/biblio/32801147.mdwn
similarity index 74%
rename from biblio/10.1101_2020.03.14.992248v3.mdwn
rename to biblio/32801147.mdwn
index 5dc046eb..32b67e78 100644
--- a/biblio/10.1101_2020.03.14.992248v3.mdwn
+++ b/biblio/32801147.mdwn
@@ -1,13 +1,13 @@
 [[!meta title="HiCanu: accurate assembly of segmental duplications, satellites, and allelic variants from high-fidelity long reads"]]
-[[!tag bioRxiv genome assembly chromosome]]
+[[!tag genome assembly chromosome]]
 
 Sergey Nurk, Brian P Walenz, Arang Rhie, Mitchell R Vollger, Glennis A Logsdon, Robert Grothe, Karen H Miga, Evan E Eichler, Adam M Phillippy, Sergey Koren
 
-bioRxiv 2020.03.14.992248; doi: https://doi.org/10.1101/2020.03.14.992248 
+Genome Res. 2020 Sep;30(9):1291-1305. doi:10.1101/gr.263566.120
 
 HiCanu: accurate assembly of segmental duplications, satellites, and allelic variants from high-fidelity long reads
 
-[[!doi 10.1101/2020.03.14.992248v3 desc="“HiCanu modifies the input reads by
+[[!pmid  32801147 desc="“HiCanu modifies the input reads by
 compressing every homopolymer to a single nucleotide.”  “Outputs contigs as
 “pseudo-haplotypes” that preserve local allelic phasing but may switch between
 haplotypes”"]]
diff --git a/tags/assembly.mdwn b/tags/assembly.mdwn
index 7c18baab..0ed2af28 100644
--- a/tags/assembly.mdwn
+++ b/tags/assembly.mdwn
@@ -23,6 +23,10 @@ fast. Shasta assemblies tend to be more fragmented, but have less disagreement
 with the reference.  Shasta also comes with polishing modules similar to Racon
 and Medaka, but also  to be faster. 
 
+The HiCanu assembler ([[Nurk, Walenz and coll., 2020|biblio/32801147]]) can
+take advantage of high-accuracy sequences such as the ones of the PacBio HiFi
+platform, to assemble multiple variants of the same locus.
+
 Some genome assemblers produce a graph file that can be visualised
 with tools such as Bandage [[Wick and coll., 2015|biblio/26099265]].
 

oburo
diff --git a/biblio/34255842.mdwn b/biblio/34255842.mdwn
new file mode 100644
index 00000000..d7daba71
--- /dev/null
+++ b/biblio/34255842.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="capCLIP: a new tool to probe translational control in human cells through capture and identification of the eIF4E-mRNA interactome."]]
+[[!tag cap method library]]
+
+Jensen KB, Dredge BK, Toubia J, Jin X, Iadevaia V, Goodall GJ, Proud CG.
+
+Nucleic Acids Res. 2021 Oct 11;49(18):e105. doi:10.1093/nar/gkab604
+
+capCLIP: a new tool to probe translational control in human cells through capture and identification of the eIF4E-mRNA interactome.
+
+[[!pmid 34255842 desc="eIF4E flagged via CRISPR/Cas9 gene editing.  mRNAs were crosslinked to eIF4E and immunoprecipitated with anti-flag antibodies.  First-strand cDNAs primed via a linker ligated in 3′.  This method (capCLIP) was used to study the effect of rapamycin treatment and eIF4E phosphorylation."]]
diff --git a/tags/cap.mdwn b/tags/cap.mdwn
index 552aa76d..175d7267 100644
--- a/tags/cap.mdwn
+++ b/tags/cap.mdwn
@@ -63,6 +63,11 @@ in the [[template_switching]] tag page.
    biotinylated forward primers, so that the 5′ end can be recovered after
    mechanical fragmentation.
 
+ - capCLIP ([[Jensen and coll., 2021|biblio/34255842]]): eIF4E is flagged by
+   gene editing, mRNA crosslinked to eIF4E and the whole is immunoprecipitated.
+   This circumvents the problem of access to good eIF4E antibodies for
+   immunoprecipitation.
+
 Atypical caps (work in progress)
 --------------------------------
 

Remove tag.
diff --git a/biblio/34385692.mdwn b/biblio/34385692.mdwn
index 7a7102b5..7b6fa118 100644
--- a/biblio/34385692.mdwn
+++ b/biblio/34385692.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Multiplexed direct detection of barcoded protein reporters on a nanopore array"]]
-[[!tag bioRxiv nanopore]]
+[[!tag nanopore]]
 
 Nat Biotechnol. 2021 Aug 12. doi:10.1038/s41587-021-01002-6.
 

TARA Oceans
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 5bbe5de5..d0ab666a 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -654,7 +654,8 @@ Ecology
    (with oral gland cells and ~8 to 14 subchordal cells).
  - Indian ocean near Australia: detected in eDNA sequencing of 18S rRNA
    ([[Berry and coll., 2019|biblio/30735490]])
- - TARA Oceans ([[Vorobev and coll., 2020|biblio/32205368]]).
+ - TARA Oceans ([[Vorobev and coll., 2020|biblio/32205368]]),
+   [[Delmont and coll., biblio/10.1101_2020.10.15.341214v2]].
 
 ### In the past:
 

Peer-reviewed.
diff --git a/biblio/10.1101_837542.mdwn b/biblio/34385692.mdwn
similarity index 55%
rename from biblio/10.1101_837542.mdwn
rename to biblio/34385692.mdwn
index df5c2c40..7a7102b5 100644
--- a/biblio/10.1101_837542.mdwn
+++ b/biblio/34385692.mdwn
@@ -1,10 +1,10 @@
 [[!meta title="Multiplexed direct detection of barcoded protein reporters on a nanopore array"]]
 [[!tag bioRxiv nanopore]]
 
-Posted November 11, 2019.
+Nat Biotechnol. 2021 Aug 12. doi:10.1038/s41587-021-01002-6.
 
-Nicolas Cardozo, Karen Zhang, Katie Doroschak, Aerilynn Nguyen, Zoheb Siddiqui, Karin Strauss, Luis Ceze and Jeff Nivala.
+Nicolas Cardozo, Karen Zhang, Katie Doroschak, Aerilynn Nguyen, Zoheb Siddiqui, Nicholas Bogard, Karin Strauss, Luis Ceze and Jeff Nivala.
 
 Multiplexed direct detection of barcoded protein reporters on a nanopore array
 
-[[!doi 10.1101/837542 desc="Detection of peptide barcodes in Nanopore flow cells."]]
+[[!pmid 34385692 desc="Detection of peptide barcodes in Nanopore flow cells."]]

Café
diff --git a/biblio/10.1101_2020.10.15.341214v2.mdwn b/biblio/10.1101_2020.10.15.341214v2.mdwn
new file mode 100644
index 00000000..a7e64dc1
--- /dev/null
+++ b/biblio/10.1101_2020.10.15.341214v2.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Functional repertoire convergence of distantly related eukaryotic plankton lineages revealed by genome-resolved metagenomics"]]
+[[!tag bioRxiv Oikopleura eDNA]]
+
+Tom O. Delmont, Morgan Gaia, Damien D. Hinsinger, Paul Fremont, Chiara Vanni, Antonio Fernandez Guerra, A. Murat Eren, Artem Kourlaiev, Leo d’Agata, Quentin Clayssen, Emilie Villar, Karine Labadie, Corinne Cruaud, Julie Poulain, Corinne Da Silva, Marc Wessner, Benjamin Noel, Jean-Marc Aury, Tara Oceans Coordinators, Colomban de Vargas, Chris Bowler, Eric Karsenti, Eric Pelletier, Patrick Wincker, Olivier Jaillon
+
+bioRxiv 2020.10.15.341214; doi: https://doi.org/10.1101/2020.10.15.341214 
+
+Functional repertoire convergence of distantly related eukaryotic plankton lineages revealed by genome-resolved metagenomics
+
+[[!doi 10.1101/2020.10.15.341214v2 desc="Assembled more than 700 eukaryotic metagenomes.  37 of them are Appendicularian.  A phylogeny was made using DNA-dependent RNA polymerases."]]

Café
diff --git a/biblio/31857067.mdwn b/biblio/31857067.mdwn
new file mode 100644
index 00000000..19b1826a
--- /dev/null
+++ b/biblio/31857067.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Protein phosphatase 2A is essential to maintain meiotic arrest, and to prevent Ca2+ burst at spawning and eventual parthenogenesis in the larvacean Oikopleura dioica."]]
+[[!tag ]]
+
+Protein phosphatase 2A is essential to maintain meiotic arrest, and to prevent Ca2+ burst at spawning and eventual parthenogenesis in the larvacean Oikopleura dioica.
+
+Dev Biol. 2020 Apr 15;460(2):155-163. doi:10.1016/j.ydbio.2019.12.005
+
+Matsuo M, Onuma TA, Omotezako T, Nishida H.
+
+[[!pmid 31857067 desc="“PP2A is essential for the maintenance of meiotic arrest and prevention of parthenogenesis at spawning event in O. dioica. When PP2Ac is lost, the pH rise at spawning brings about an aberrant Ca burst by still unknown molecular mechanisms, and it activates eggs via CaMK II, reinitiates meiosis, and eventually results in improper initiation of embryogenesis.” Okadaic acid also induced parthenogenesis.  Termination of parthenogenetic migth be explain by failure to complete the cleavages because of the absence of the centrosome that should have been brought by the sperm."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 8badd625..5bbe5de5 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -361,6 +361,9 @@ Development
    2008|biblio/18845138]]).
  - The first and second polar bodies are visible 5 and 15 min after fertilisation,
    respectively ([[Nishino and Morisawa, 1998|biblio/10.2108_zsj.15.723]]).
+ - Meiosis is resumed by change of extracellular pH when the oocytes are released
+   in seawater.  Partenogenesis starts if PP2A is inhibited by DNAi or with
+   okadaic acid ([[Matsuo and coll., 2020|biblio/31857067]).
  - First embryonic cleavages are deterministic and “Clonal organization of the
    tissues is essentially invariant among individuals” ([[Stach and coll.,
    2008|biblio/18490654]]).

Consolidate
diff --git a/biblio/24022005.mdwn b/biblio/24022005.mdwn
index f5776d7a..4a14020d 100644
--- a/biblio/24022005.mdwn
+++ b/biblio/24022005.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Barriers to transmission of transcriptional noise in a c-fos c-jun pathway."]]
-[[!tag single_cell noise immediate_early PLA]]
+[[!tag single_cell noise PLA]]
 
 Shah K, Tyagi S.
 
diff --git a/tags/immediate_early.mdwn b/tags/immediate_early.mdwn
deleted file mode 100644
index 43881d39..00000000
--- a/tags/immediate_early.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged immediate early"]]
-
-[[!inline pages="tagged(immediate_early)" actions="no" archive="yes"
-feedshow=10]]

Consolidation
diff --git a/biblio/25575391.mdwn b/biblio/25575391.mdwn
index 6edd1c2e..e48d0a5c 100644
--- a/biblio/25575391.mdwn
+++ b/biblio/25575391.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Tunic morphology and cellulosic components of pyrosomas, doliolids, and salps (thaliacea, urochordata)."]]
-[[!tag tunic cellulose]]
+[[!tag tunicate cellulose]]
 
 Hirose E, Kimura S, Itoh T, Nishikawa J.
 
diff --git a/tags/tunic.mdwn b/tags/tunic.mdwn
deleted file mode 100644
index 3c7ece5a..00000000
--- a/tags/tunic.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged tunic"]]
-
-[[!inline pages="tagged(tunic)" actions="no" archive="yes"
-feedshow=10]]

Café
diff --git a/biblio/34408075.mdwn b/biblio/34408075.mdwn
new file mode 100644
index 00000000..731289c6
--- /dev/null
+++ b/biblio/34408075.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Genomic structural variants constrain and facilitate adaptation in natural populations of Theobroma cacao, the chocolate tree."]]
+[[!tag haplotype variants]]
+
+Hämälä T, Wafula EK, Guiltinan MJ, Ralph PE, dePamphilis CW, Tiffin P.
+
+Proc Natl Acad Sci U S A. 2021 Aug 31;118(35):e2102914118. doi:10.1073/pnas.2102914118
+
+Genomic structural variants constrain and facilitate adaptation in natural populations of Theobroma cacao, the chocolate tree.
+
+[[!pmid 34408075 desc="31 × 2 haplotype assemblies using Illumina and 10x Genomics linked reads.  dN/dS (interspecies) and πN/πS (intraspecies) values in SVs are higher than expectation and vary according the type of SV and the proximity to the SV's breakpoints.  Genes with allele-specific expression were over-represented at heterozygous inversions.  Genetic load is higher at inversions, as expected if they suppress recombination."]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 6eb4f28c..a4ea2c03 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -8,6 +8,10 @@ SVs per individual (insertios: 13,353; deletions: 9,474) [[Beyter and coll, 2021
 SNP analysis in >1400 seaweed flies identified known and candidate genomic inversions
 ([[Mérot and coll, 2021|biblio/33963409]]).
 
+SV analysis of 31 diploid assemblies of _Theobroma cacao_ showed relaxed
+selection and increased genetic load in inversions and other types of variants
+[[Hämälä and coll., 2021|biblio/34408075]].
+
 ### Software
 
  - _NanoSV_ ([[Cretu Stancu and coll., 2017|biblio/29109544]]) uses nanopore long

Retiring variability tag, used only two times.
diff --git a/biblio/15289471.mdwn b/biblio/15289471.mdwn
index df2443d3..88c5491c 100644
--- a/biblio/15289471.mdwn
+++ b/biblio/15289471.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Regional patterns of gene expression in human and chimpanzee brains."]]
-[[!tag chimpanzee brain visual_cortex variability transcriptome]]
+[[!tag chimpanzee brain visual_cortex population transcriptome]]
 
 Khaitovich P, Muetzel B, She X, Lachmann M, Hellmann I, Dietzsch J, Steigele S, Do HH, Weiss G, Enard W, Heissig F, Arendt T, Nieselt-Struwe K, Eichler EE, Pääbo S.
 
@@ -7,4 +7,4 @@ Genome Res. 2004 Aug;14(8):1462-73 doi:10.1101/gr.2538704
 
 Regional patterns of gene expression in human and chimpanzee brains.
 
-[[!pmid 15289471 desc="Individual variations are stronger than regional variations in cortex. Developmental genes are implicated in inter-reigonal, but not inter-species variations. Differential interspecific variation correlates with recent chromosomal duplications."]]
+[[!pmid 15289471 desc="Individual variations are stronger than regional variations in cortex. Developmental genes are implicated in inter-regional, but not inter-species variations. Differential interspecific variation correlates with recent chromosomal duplications."]]
diff --git a/biblio/29483654.mdwn b/biblio/29483654.mdwn
index 81509e0c..a579bd25 100644
--- a/biblio/29483654.mdwn
+++ b/biblio/29483654.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="The human noncoding genome defined by genetic diversity."]]
-[[!tag non_coding variability]]
+[[!tag non_coding population]]
 
 Nat Genet. 2018 Mar;50(3):333-337. doi:10.1038/s41588-018-0062-7
 
diff --git a/tags/variability.mdwn b/tags/variability.mdwn
deleted file mode 100644
index c70635a0..00000000
--- a/tags/variability.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged variability"]]
-
-[[!inline pages="tagged(variability)" actions="no" archive="yes"
-feedshow=10]]

GOC
diff --git a/biblio/14585609.mdwn b/biblio/14585609.mdwn
new file mode 100644
index 00000000..c51736d2
--- /dev/null
+++ b/biblio/14585609.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="DNA repeats lead to the accelerated loss of gene order in bacteria."]]
+[[!tag synteny]]
+
+Rocha, Eduardo P C.
+
+Trends Genet. 2003 Nov;19(11):600-3. doi:10.1016/j.tig.2003.09.011
+
+DNA repeats lead to the accelerated loss of gene order in bacteria.
+
+[[!pmid 14585609 desc="Defines a Gene Order Conservation (GOC) number as: “the average number of orthologues for which the consecutive orthologue co-occurs close by in the other genome. It varies between 0 (no co-occurrence) and 1 (complete gene order conservation)”."]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 296a3a30..5ec7e063 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -50,4 +50,11 @@ two species [[Mudd and coll, 2020|biblio/32873878]].
 
  - The ancestral amniote has 49 chromosomes ([[Sacerdot and coll., 2018|biblio/30333059]]).
 
+### Computational aspects
+
+ - [[Rocha (2003)|biblio/14585609]] defines a Gene Order Conservation (GOC)
+   number as: “the average number of orthologues for which the consecutive
+   orthologue co-occurs close by in the other genome. It varies between 0 (no
+   co-occurrence) and 1 (complete gene order conservation)”.
+
 [[!inline pages="tagged(synteny)" limit=0]]

C-left
diff --git a/biblio/19592681.mdwn b/biblio/19592681.mdwn
new file mode 100644
index 00000000..d2bf1f59
--- /dev/null
+++ b/biblio/19592681.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Unusual composition of a yeast chromosome arm is associated with its delayed replication."]]
+[[!tag yeast chromosome]]
+
+Payen C, Fischer G, Marck C, Proux C, Sherman DJ, Coppée JY, Johnston M, Dujon B, Neuvéglise C.
+
+Genome Res. 2009 Oct;19(10):1710-21. doi:10.1101/gr.090605.108
+
+Unusual composition of a yeast chromosome arm is associated with its delayed replication.
+
+[[!pmid 19592681 desc="“high GC content (52.9%) of the 1-Mb left arm of chromosome C (abbreviated here as ‘C-left’)”  “The replication timing of C-left is delayed compared with the rest of the genome”  “The global gene density, transcriptional orientations, proportion of orthologs to S. cerevisiae essential genes, and proportion of genes in families are comparable between C-left and the rest of the genome. The only differences are modest: the complete absence of any traces of LTR retrotransposons, an overrepresentation of microsatellites, and a moderate increase in CDS length.”"]]

Quotes
diff --git a/biblio/28416820.mdwn b/biblio/28416820.mdwn
index 2d874f04..30f81ad3 100644
--- a/biblio/28416820.mdwn
+++ b/biblio/28416820.mdwn
@@ -8,3 +8,11 @@ Nat Genet. 2017 Jun;49(6):913-924. doi:10.1038/ng.3847
 Contrasting evolutionary genome dynamics between domesticated and wild yeasts.
 
 [[!pmid 28416820 desc="Yeast subtelomeres accumulate structural variants."]]
+
+“For each subtelomere, we located its proximal boundary on the basis of the sudden loss of synteny conservation and demarcated its distal boundary by the telomere-associated core X and Y′ elements”
+
+“All previously defined essential genes in S. cerevisiae S288C28 fell into the chromosomal cores, whereas all previously described subtelomeric duplication blocks in S288C were fully enclosed in our defined S288C subtelomeres. Furthermore, the genes from our defined subtelomeres showed 36.6-fold higher CNV accumulation than those from the cores”
+
+“subtelomeric one-to-one orthologs also showed significantly higher nonsynonymous-to-synonymous substitution rate ratio (dN/dS) than those from the cores in the S. cerevisiae–S. cerevisiae and S. cerevisiae–S. paradoxus comparisons”
+
+“rapid evolution of subtelomeres can substantially alter the gene repertoire and generate novel recombinants with adaptive potential”

Temperature
diff --git a/biblio/34301628.mdwn b/biblio/34301628.mdwn
new file mode 100644
index 00000000..4996a81b
--- /dev/null
+++ b/biblio/34301628.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Temperature dependence of spontaneous mutation rates."]]
+[[!tag temperature]]
+
+Waldvogel AM, Pfenninger M.
+
+Genome Res. 2021 Sep;31(9):1582-1589. doi:10.1101/gr.275168.120
+
+Temperature dependence of spontaneous mutation rates.
+
+[[!pmid 34301628 desc="Study on the non-biting midge _Chironomus riparius_ (harlequin fly). “short-term mutation accumulation experiments at temperatures between 12°C and 26°C.”  “mutation rates depended on temperature in a U-shaped manner with increasing rates toward both temperature extremes.”  Cold could increase mutation rates by eithery increasing oxydative stress or increasing generation time."]]

FBS
diff --git a/biblio/30775458.mdwn b/biblio/30775458.mdwn
new file mode 100644
index 00000000..88215b6c
--- /dev/null
+++ b/biblio/30775458.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Exosome-mediated horizontal gene transfer occurs in double-strand break repair during genome editing."]]
+[[!tag CRISPR repeat mutation]]
+
+Commun Biol. 2019 Feb 8;2:57. doi:10.1038/s42003-019-0300-2
+
+Ono R, Yasuhiko Y, Aisaki KI, Kitajima S, Kanno J, Hirabayashi Y.
+
+Exosome-mediated horizontal gene transfer occurs in double-strand break repair during genome editing.
+
+[[!pmid 30775458 desc="Insertion of bovine SINE elements in human cells whose genome was edited with CRISPR nucleases.  The bovine sequences are thought to originate from exosomes in the FBS."]]

Earl grey
diff --git a/biblio/10.1038_scientificamerican0776-94.mdwn b/biblio/10.1038_scientificamerican0776-94.mdwn
new file mode 100644
index 00000000..420b69d5
--- /dev/null
+++ b/biblio/10.1038_scientificamerican0776-94.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Appendicularians"]]
+[[!tag Oikopleura]]
+
+Alldredge, Alice
+
+Scientific American Vol. 235, No. 1 (July 1976), pp. 94-105 (12 pages)
+
+Appendicularians
+
+[[!doi 10.1038/scientificamerican0776-94 desc="JSTOR ID 24950396"]]
diff --git a/biblio/34414660.mdwn b/biblio/34414660.mdwn
new file mode 100644
index 00000000..9bb34a28
--- /dev/null
+++ b/biblio/34414660.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Arrhenius equation for developmental processes."]]
+[[!tag development temperature Drosophila frog]]
+
+Crapse J, Pappireddi N, Gupta M, Shvartsman SY, Wieschaus E, Wühr M.
+
+Mol Syst Biol. 2021 Aug;17(8):e9895. doi: 10.15252/msb.20209895
+
+Arrhenius equation for developmental processes.
+
+[[!pmid 34414660 desc="Fitting development time courses at different temperatures to the Arrhenius law shows that different steps have different activation energies.  The fit is not linear, and the fact that each step is a combination of many reactions is not enough to explain the extent of the deviation.  In addition, the fit of simple reactions catalysed by GAPDH or LacZ is also non-linear.  The authors postulate that “Either all rate-limiting steps occurring in parallel at a given embryonic stage have evolved similar activation energies, or the embryos have developed checkpoints that assure a resynchronization of converging developmental processes over wide temperature ranges.”"]]
diff --git a/tags/Drosophila.mdwn b/tags/Drosophila.mdwn
index 9445f484..ca999b86 100644
--- a/tags/Drosophila.mdwn
+++ b/tags/Drosophila.mdwn
@@ -23,4 +23,9 @@ one synteny break every 6 genes in average ([[Renschler and coll., 2019|biblio/3
 
 See also [[Muller elements|muller_element]].
 
+### Other papers
+
+_D. melanogaster_'s development time course at different temperatures was fitted
+to the Arrhenius law in [[Crapse and coll., 2021|biblio/34414660]].
+
 [[!inline pages="tagged(Drosophila)" limit=0]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 1684c65f..8badd625 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -13,7 +13,8 @@ for feeding (and perhaps defending).  The main house proteins are called
 _oikosins_ and half or them are unique to Oikopleura and related animals
 ("_Appendicularia_").  The japanese name of _O. dioica_ is
 [ワカレオタマボヤ](https://www.godac.jamstec.go.jp/bismal/j/view/9018229).
-Review for non-specialists: [[Glover, 2020|biblio/33080189]].
+Review for non-specialists: [[Glover, 2020|biblio/33080189]].  Article
+in Scientific American: [[Alice Alldredge, 1976|biblio/10.1038_scientificamerican0776-94]].
 
 Some links:
 

matin
diff --git a/biblio/34400545.mdwn b/biblio/34400545.mdwn
new file mode 100644
index 00000000..46552aab
--- /dev/null
+++ b/biblio/34400545.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Ultrarapid detection of SARS-CoV-2 RNA using a reverse transcription-free exponential amplification reaction, RTF-EXPAR."]]
+[[!tag amplification]]
+
+Carter JG, Orueta Iturbe L, Duprey JHA, Carter IR, Southern CD, Rana M, Whalley CM, Bosworth A, Beggs AD, Hicks MR, Tucker JHR, Dafforn TR.
+
+Proc Natl Acad Sci U S A. 2021 Aug 31;118(35):e2100347118. doi:10.1073/pnas.2100347118
+
+Ultrarapid detection of SARS-CoV-2 RNA using a reverse transcription-free exponential amplification reaction, RTF-EXPAR.
+
+[[!pmid 34400545 desc="“Binder DNA X anneals to viral RNA; the DNA strand of the DNA:RNA heteroduplex is cut by the restriction endonuclease BstNI, which acts as a nicking enzyme by cutting the DNA strand only; the released DNA strand is Trigger X, which is then amplified by EXPAR.”"]]

Café
diff --git a/biblio/34078885.mdwn b/biblio/34078885.mdwn
new file mode 100644
index 00000000..b52040a5
--- /dev/null
+++ b/biblio/34078885.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Discovery of widespread transcription initiation at microsatellites predictable by sequence-based deep neural network."]]
+[[!tag CAGE method fingerprint nanopore]]
+
+Discovery of widespread transcription initiation at microsatellites predictable by sequence-based deep neural network.
+
+Nat Commun. 2021 Jun 2;12(1):3297. doi:10.1038/s41467-021-23143-7
+
+Grapotte M, Saraswat M, Bessière C, Menichelli C, Ramilowski JA, Severin J, Hayashizaki Y, Itoh M, Tagami M, Murata M, Kojima-Ishiyama M, Noma S, Noguchi S, Kasukawa T, Hasegawa A, Suzuki H, Nishiyori-Sueki H, Frith MC; FANTOM consortium, Chatelain C, Carninci P, de Hoon MJL, Wasserman WW, Bréhélin L, Lecellier CH.
+
+[[!pmid 34078885 desc="Cap Trap RNA-seq (CTR) seq: sequencing of CAGE cDNAs on the Nanopore platform.  RT primers contain some Us and the DNA/RNA hybrids are digested with USER to shorten the tail.  A BBBBBBBB UMI is present."]]

Encore
diff --git a/tags/cellulose.mdwn b/tags/cellulose.mdwn
index 273e6c35..f29f5376 100644
--- a/tags/cellulose.mdwn
+++ b/tags/cellulose.mdwn
@@ -15,7 +15,8 @@ A cellulose synthase and several endoglycanase genes were observed in the _C.
 intestinalis_ genome by [[Dehal and coll., 2002|biblio/12481130]].
 
 _CesA_ is not found in other animals outside Tunicates.  The GH6 (cellulose hydrolase)
-gene is found as an independent copy an as a domain of _CesA_ in Tunicates
-([[Inoue, Nakashima and Satoh, 2019|biblio/30974905]]).
+gene is found as an independent copy and as a domain of _CesA_ in Tunicates
+([[Inoue, Nakashima and Satoh, 2019|biblio/30974905]]).  In _Oikopleura_,
+GHC6-1 lacks a conserved catalytic aspartate ([[Li and coll., 2020|biblio/32823766]]).
 
 [[!inline pages="tagged(cellulose)" limit=0]]

Le soir.
diff --git a/biblio/32823766.mdwn b/biblio/32823766.mdwn
new file mode 100644
index 00000000..e6eaf534
--- /dev/null
+++ b/biblio/32823766.mdwn
@@ -0,0 +1,14 @@
+[[!meta title="Phylogenetic Analyses of Glycosyl Hydrolase Family 6 Genes in Tunicates: Possible Horizontal Transfer."]]
+[[!tag cellulose Oikopleura]]
+
+Li KL, Nakashima K, Inoue J, Satoh N.
+
+Genes (Basel). 2020 Aug 13;11(8):937. doi:10.3390/genes11080937
+
+Phylogenetic Analyses of Glycosyl Hydrolase Family 6 Genes in Tunicates: Possible Horizontal Transfer.
+
+[[!pmid 32823766 desc="Comparison of primary sequence and of intron position suggests that GHC6-1 was transferred in a common ancestor of all living tunicates.  _O. dioica_'s GH6-1 gene lacks a conserved catalytic aspartate, and does not share introns with the other tunicate genes."]]
+
+“We found that in many tunicate GH6-1 proteins, an aspartic acid can be aligned to the catalytic _H. jecorina_ D221, except for SthGH6-1b (E197) and OdiGH6-1 (K211).  However, the catalytic aspartic acid was not conserved in tunicate CesA.”
+
+“In this study, although we found no other sites shared between genes of _O. dioica_ and other tunicates, we found that many shared splice sites are present among GH6-containing genes from three other major clades of tunicates (Thaliacea + Phlebobranchia + Stolidobranchia). It is reasonable to assume that many shared introns were acquired after the branching of larvaceans and before the subsequent divergence of major tunicate clades.”
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 9475b5a3..1684c65f 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -202,7 +202,9 @@ Genes and pathways
    intestinalis_ ([[Matthysse and coll., 2004|biblio/14722352]]).
  - A GH6 (glycosyl hydrolase family 6) domain is found in the CesA genes,
    as well as an independent genes, in Tunicates
-   ([[Inoue, Nakashima and Satoh, 2019|biblio/30974905]]).
+   ([[Inoue, Nakashima and Satoh, 2019|biblio/30974905]]).  In _Oikopleura_, it
+   lacks a conserved catalytic aspatate, and does not share ancestral introns with
+   other tunicates ([[Li and coll., 2020|biblio/32823766]]).
  - _O. dioica_ has multiple CDK1 and Cyclin B paraplogs, some of which are
    implicated in oogenesis ([[Øvrebø and coll., 2015|biblio/25714331]],
    [[Feng & Thompson, 2018|biblio/29969934]]).

Markdown syntax.
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 099fa178..9475b5a3 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -662,7 +662,7 @@ Culture protocols (incomplete list):
 
  - [[Fenaux and Gorsky (1985)|biblio/art0358]] published a method using a
    helicoidal paddle to stir the culture.
- - Rotating vessels: [[Sato and coll, 1999|biblio/10005415955].
+ - Rotating vessels: [[Sato and coll, 1999|biblio/10005415955]].
  - Tested once in Ctenophore tubes ([[Patry, Bubel, Hansen and Knowles,
    2020|biblio/32292660]]).
  - Nishida lab protocol: [[Nishida 2008|biblio/18494706]].

PDF link.
diff --git a/biblio/10005415955.mdwn b/biblio/10005415955.mdwn
index 0059e176..52dadbc2 100644
--- a/biblio/10005415955.mdwn
+++ b/biblio/10005415955.mdwn
@@ -8,3 +8,5 @@ Plankton Biology and Ecology 46(2), 162-164, 1999-08-01
 New apparatuses for cultivation of appendicularians
 
 [Culture of O. dioica and O. longicauda in rotating vessels.  O. lon required an “unidentified flagellate of 2µm cell diameter”.](https://ci.nii.ac.jp/naid/10005415955)
+
+PDF at: http://www.plankton.jp/PBE/issue/vol46_2/vol46_2_162.pdf

Café
diff --git a/biblio/34389685.mdwn b/biblio/34389685.mdwn
new file mode 100644
index 00000000..b77ee199
--- /dev/null
+++ b/biblio/34389685.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Caenorhabditis elegans DSB-3 reveals conservation and divergence among protein complexes promoting meiotic double-strand breaks."]]
+[[!tag meiosis nematode]]
+
+Hinman AW, Yeh HY, Roelens B, Yamaya K, Woglar A, Bourbon HG, Chi P, Villeneuve AM.
+
+Proc Natl Acad Sci U S A. 2021 Aug 17;118(33):e2109306118. doi:10.1073/pnas.2109306118
+
+_Caenorhabditis elegans+ DSB-3 reveals conservation and divergence among protein complexes promoting meiotic double-strand breaks.
+
+[[!pmid 34389685 desc="DSB-3, likely homologue of Mei4, interacts with DSB-1 and DSB-2 (likely homologues of Rec114).  Together, they are interdependent for localisation to meiotic nuclei and promoting formation of crossovers.  Yeast two-hybrid experiments that DSB-3 binds SPO-11 via DSB-1."]]

Café
diff --git a/tags/meiosis.mdwn b/tags/meiosis.mdwn
index 9bfc0b3f..c756bf68 100644
--- a/tags/meiosis.mdwn
+++ b/tags/meiosis.mdwn
@@ -6,4 +6,10 @@ _in progress_
    homologous recombination ([[Johnson and coll., 2021|biblio/34108687]]
    and [[Prieler and coll., 2021|biblio/34108684]]).
 
+ - In _C. elegans_, a yeast two-hybrid experiment suggests that SPO-11 binds
+   the DSB-1,2,3 complex via DSB-1.  The complex is necessary to form
+   cross-overs.  Failure to cross over causes aneuploidy, which is causes
+   embryonic inviability and excess of males ([[Hinmann and coll.,
+   2021|biblio/34389685]]).
+
 [[!inline pages="tagged(meiosis)" limit=0]]

Cafés
diff --git a/biblio/34045355.mdwn b/biblio/34045355.mdwn
new file mode 100644
index 00000000..33785ea9
--- /dev/null
+++ b/biblio/34045355.mdwn
@@ -0,0 +1,18 @@
+[[!meta title="3D genomics across the tree of life reveals condensin II as a determinant of architecture type."]]
+[[!tag centromere]]
+
+Hoencamp C, Dudchenko O, Elbatsh AMO, Brahmachari S, Raaijmakers JA, van Schaik T, Sedeño Cacciatore Á, Contessoto VG, van Heesbeen RGHP, van den Broek B, Mhaskar AN, Teunissen H, St Hilaire BG, Weisz D, Omer AD, Pham M, Colaric Z, Yang Z, Rao SSP, Mitra N, Lui C, Yao W, Khan R, Moroz LL, Kohn A, St Leger J, Mena A, Holcroft K, Gambetta MC, Lim F, Farley E, Stein N, Haddad A, Chauss D, Mutlu AS, Wang MC, Young ND, Hildebrandt E, Cheng HH, Knight CJ, Burnham TLU, Hovel KA, Beel AJ, Mattei PJ, Kornberg RD, Warren WC, Cary G, Gómez-Skarmeta JL, Hinman V, Lindblad-Toh K, Di Palma F, Maeshima K, Multani AS, Pathak S, Nel-Themaat L, Behringer RR, Kaur P, Medema RH, van Steensel B, de Wit E, Onuchic JN, Di Pierro M, Lieberman Aiden E, Rowland BD.
+
+Science. 2021 May 28;372(6545):984-989. doi:10.1126/science.abe2218
+
+3D genomics across the tree of life reveals condensin II as a determinant of architecture type.
+
+[[!pmid 34045355 desc="Hi-C profiles tend to show centromeric clustering in cells that lack condensin II or have very long chromosomes, because they are in “Rabl” conformation."]]
+
+“In ∆CAP-H2 human cells, centromeres also cluster in or around the nucleolus. However, disrupting nucleolar structure did not affect centromeric clustering. The clustering of centromeres at the human nucleolus is likely because rDNA sequences, which are the genomic component of the nucleolus, often lie near centromeres”
+
+“acute depletion of the condensin I subunit CAP-H did not lead to centromeric clustering”
+
+“we found that the notable increase in chromosome length in the Indian muntjac coincides, as expected, with the appearance of centromeric clustering.”
+
+“We hypothesize that (i) centromeres tend to adhere to one another, a process that is facilitated by proximity during and shortly after mitosis; (ii) the shortening of chromosomes interferes with this adhesion, enabling the centromeres to spread out over the newly formed nuclei; and (iii) chromosome territories emerge as a by-product of the resulting chromosomal separation.”
diff --git a/tags/centromere.mdwn b/tags/centromere.mdwn
index d3c212c0..b1444e75 100644
--- a/tags/centromere.mdwn
+++ b/tags/centromere.mdwn
@@ -15,6 +15,8 @@ _Work in progress_
    coll., 2019|biblio/31306061]].
  - Centromeric regions of sister chromatids are rarely resolved in FISH.  Instead,
    the intensity of the spot increases ([[Amakawa and coll., 2013|biblio/23832878]]).
+ - In Hi-C profiles, centromeric clustering is seen in cells that lack condensin II
+   or have extremely long chromosomes ([[Hoencamp and coll., 2021|biblio/34045355]]).
 
 ## Evolution
 
diff --git a/tags/muller_element.mdwn b/tags/muller_element.mdwn
index 2aec4611..6ee4d973 100644
--- a/tags/muller_element.mdwn
+++ b/tags/muller_element.mdwn
@@ -13,6 +13,10 @@ and coll., 2017|biblio/28336562]]; [[Copmton and coll., 2020|biblio/32883756]]).
 Note that the chromosomes of _Aedes aegypti_
 are significantly larger than what is usually found in _Drosophila_.
 
+In [[Hoencamp and coll., 2021|biblio/34045355]], centromeric clustering in Hi-C
+contact maps is also shown; it is hypothtised that it is because of the lack
+of a fully functional condensin II complex.
+
 _D. bifasciata_ (and other Drosophila) have large and highly repetitive
 pericentric regions [[Bracewell and coll., 2020|biblio/31969429]].
 

Interpretation
diff --git a/biblio/22106305.mdwn b/biblio/22106305.mdwn
index 2b266f6a..0e59f5ee 100644
--- a/biblio/22106305.mdwn
+++ b/biblio/22106305.mdwn
@@ -7,4 +7,4 @@ Dmitrieva NI, Cui K, Kitchaev DA, Zhao K, Burg MB.
 
 Proc Natl Acad Sci U S A. 2011 Dec 20;108(51):20796-801. doi:10.1073/pnas.1114677108
 
-[[!pmid 22106305 desc="At high osmolarity, double-strand breaks (DSBs) form in cells.  Repair is much more active once osmolarity has been lowered, as viewed by the increase of γH2AX foci.  ChIP sequencing of these foci show a strong enrichment in gene deserts."]]
+[[!pmid 22106305 desc="At high osmolarity, double-strand breaks (DSBs) form in cells.  Repair is much more active once osmolarity has been lowered, as viewed by the increase of γH2AX foci.  ChIP sequencing of these foci show a strong enrichment in gene deserts.  The authors suggest that gene deserts could be a vertebrate adaptation to the high-salt environment of their kidney cells."]]

creating tag page tags/γH2AX
diff --git "a/tags/\316\263H2AX.mdwn" "b/tags/\316\263H2AX.mdwn"
new file mode 100644
index 00000000..78e77919
--- /dev/null
+++ "b/tags/\316\263H2AX.mdwn"
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged γH2AX"]]
+
+[[!inline pages="tagged(γH2AX)" actions="no" archive="yes"
+feedshow=10]]

creating tag page tags/H2AX
diff --git a/tags/H2AX.mdwn b/tags/H2AX.mdwn
new file mode 100644
index 00000000..03083502
--- /dev/null
+++ b/tags/H2AX.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged H2AX"]]
+
+[[!inline pages="tagged(H2AX)" actions="no" archive="yes"
+feedshow=10]]

Au bureau
diff --git a/biblio/21756361.mdwn b/biblio/21756361.mdwn
index 005b2ba3..c22dc346 100644
--- a/biblio/21756361.mdwn
+++ b/biblio/21756361.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Histone variant innovation in a rapidly evolving chordate lineage."]]
-[[!tag Oikopleura histone]]
+[[!tag Oikopleura histone H2AX]]
 
 Histone variant innovation in a rapidly evolving chordate lineage.
 
diff --git a/biblio/22106305.mdwn b/biblio/22106305.mdwn
new file mode 100644
index 00000000..2b266f6a
--- /dev/null
+++ b/biblio/22106305.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="DNA double-strand breaks induced by high NaCl occur predominantly in gene deserts."]]
+[[!tag repair γH2AX H2AX]]
+
+DNA double-strand breaks induced by high NaCl occur predominantly in gene deserts.
+
+Dmitrieva NI, Cui K, Kitchaev DA, Zhao K, Burg MB.
+
+Proc Natl Acad Sci U S A. 2011 Dec 20;108(51):20796-801. doi:10.1073/pnas.1114677108
+
+[[!pmid 22106305 desc="At high osmolarity, double-strand breaks (DSBs) form in cells.  Repair is much more active once osmolarity has been lowered, as viewed by the increase of γH2AX foci.  ChIP sequencing of these foci show a strong enrichment in gene deserts."]]

Café le matin.
diff --git a/biblio/16775417.mdwn b/biblio/16775417.mdwn
new file mode 100644
index 00000000..c9fa3077
--- /dev/null
+++ b/biblio/16775417.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="The saltiness of the sea breaks DNA in marine invertebrates: possible implications for animal evolution."]]
+[[!tag evolution repair]]
+
+Dmitrieva NI, Ferraris JD, Norenburg JL, Burg MB.
+
+Cell Cycle. 2006 Jun;5(12):1320-3. doi:10.4161/cc.5.12.2867
+
+The saltiness of the sea breaks DNA in marine invertebrates: possible implications for animal evolution.
+
+[[!pmid 16775417 desc="Proposes that increased salinity in evaporating seas during the Cambrian caused elevated numbers of DNA breaks and accelerated evolution, leading to the Cambrian explosion.  Vertebrates maintain constant interstitial osmolarity at ~300 mosmol/kg.  Invertebrates show increased levels of DNA breaks (measured by TUNEL assay) at 1000 mosmol/kg compared to 300 mosmol/kg."]]

Encore plus de café
diff --git a/biblio/31601616.mdwn b/biblio/31601616.mdwn
index a96cc4fe..1afde776 100644
--- a/biblio/31601616.mdwn
+++ b/biblio/31601616.mdwn
@@ -8,3 +8,17 @@ Genes Dev. 2019 Oct 10. doi: 10.1101/gad.328971.119
 Hi-C guided assemblies reveal conserved regulatory topologies on X and autosomes despite extensive genome shuffling.
 
 [[!pmid 31601616 desc="Found 20 synteny breakpoints (SB) per Mb on average. “Approximately 75% of SBs stay within the A or B compartment”  “Overlaps of TAD boundaries and SB breakpoints in all comparisons are highly significant”"]]
+
+“Hi-C data of D. melanogaster, D. virilis, and D. busckii embryos”
+
+“D. virilis and D. busckii [...] cover ∼40 million years of evolution and multiple subgenera (Russo et al. 2013).”
+
+“conserved sequences mostly reside on the same chromosomal arms”
+
+“we defined synteny blocks (SBs), which are chains of conserved collinear regions that are used to identify and compare homologous regions between different species. On average, we find 20 synteny breakpoints per megabase (3726 and 3252 breakpoints in the D. melanogaster vs. D. virilis comparison, respectively, and 3340 and 2776 breakpoints in the D. melanogaster vs. D. busckii comparison, respectively), corresponding to about one breakpoint every six genes.”
+
+“Approximately 75% of SBs stay within the A or B compartment and 25% switch between compartments. In general, about double the number of SBs lie within the A compartment than the B compartment.”
+
+“many SB breakpoints overlap with TAD boundaries”
+
+“To identify synteny blocks (SBs) we use LASTZ (Harris 2007) with the following parameters: “–gfextend –nochain –gapped,” which identifies local alignment blocks. We then chained blocks that are within 10-kb distance, have the same orientation, and contain at least four LASTZ-defined blocks. Chained results that were <4 kb or completely overlapped a bigger synteny block were removed.”
diff --git a/tags/Drosophila.mdwn b/tags/Drosophila.mdwn
index b48f6760..9445f484 100644
--- a/tags/Drosophila.mdwn
+++ b/tags/Drosophila.mdwn
@@ -18,6 +18,9 @@ year ([[Schlötterer and coll., 1994|biblio/8015444]]).
 12 Drosophila genomes were sequenced and compared by the [[Drosophila 12
 Genomes Consortium (2007)|biblio/17994087]].
 
+Hi-C scaffolding and genome comparison between _D. virilis_ and _D. buskii_ shows
+one synteny break every 6 genes in average ([[Renschler and coll., 2019|biblio/31601616]]).
+
 See also [[Muller elements|muller_element]].
 
 [[!inline pages="tagged(Drosophila)" limit=0]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 7877f2c5..296a3a30 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -14,7 +14,8 @@ distribution follows a power law and explain it with a model that requires
 breakpoints to be in open regions (ENCODE) interacting with each other (Hi-C).
 
 [[Renschler and coll. (2019)|biblio/31601616]] found 20 synteny breakpoints
-(SB) per Mb on average. “Approximately 75% of SBs stay within the A or B
+(SB) per Mb on average (1 every 6 gene) when comparing _D. virilis_ and _D. buskii_,
+which are ~40 MY apart.  “Approximately 75% of SBs stay within the A or B
 compartment”  “Overlaps of TAD boundaries and SB breakpoints in all comparisons
 are highly significant”
 

poedit
diff --git "a/Debian/debi\303\242neries/codesearch.en.po" "b/Debian/debi\303\242neries/codesearch.en.po"
index 990bd4ab..b8654e40 100644
--- "a/Debian/debi\303\242neries/codesearch.en.po"
+++ "b/Debian/debi\303\242neries/codesearch.en.po"
@@ -7,7 +7,7 @@ msgid ""
 msgstr ""
 "Project-Id-Version: \n"
 "POT-Creation-Date: 2021-07-22 08:43+0000\n"
-"PO-Revision-Date: 2021-07-22 17:43+0900\n"
+"PO-Revision-Date: 2021-07-22 17:46+0900\n"
 "Last-Translator: Charles Plessy <toto@example.com>\n"
 "Language-Team: \n"
 "Language: en\n"

Merge branch 'master' of ssh://charles-plessy-org.branchable.com
https
diff --git "a/Debian/debi\303\242neries/codesearch.en.po" "b/Debian/debi\303\242neries/codesearch.en.po"
index a9a55728..9153742d 100644
--- "a/Debian/debi\303\242neries/codesearch.en.po"
+++ "b/Debian/debi\303\242neries/codesearch.en.po"
@@ -7,7 +7,7 @@ msgid ""
 msgstr ""
 "Project-Id-Version: \n"
 "POT-Creation-Date: 2021-07-22 08:44+0000\n"
-"PO-Revision-Date: 2021-07-22 17:43+0900\n"
+"PO-Revision-Date: 2021-07-22 17:45+0900\n"
 "Last-Translator: Charles Plessy <toto@example.com>\n"
 "Language-Team: \n"
 "Language: en\n"
@@ -37,16 +37,6 @@ msgid "[[!meta title=\"Recherche dans les sources de Debian\"]]\n"
 msgstr "[[!meta title=\"Search in Debian's sources\"]]\n"
 
 #. type: Plain text
-#, fuzzy
-#| msgid ""
-#| "Via mon travail sur le paquet [`media-types`](packages.debian.org/media-"
-#| "types)\n"
-#| "je voulais savoir quel paquets utilisaient le type média `application/x-"
-#| "xcf`\n"
-#| "qui apparemment est erroné ([#991158](https://bugs.debian.org/991158)).  "
-#| "Le\n"
-#| "site <codesearch.debian.net> permet de répondre à cette question.  "
-#| "(Merci !)\n"
 msgid ""
 "Via mon travail sur le paquet [`media-types`](packages.debian.org/media-"
 "types)  je voulais savoir quel paquets utilisaient le type média "
@@ -60,7 +50,7 @@ msgstr ""
 "xcf`,\n"
 "which apparently is not correct ([#991158](https://bugs.debian."
 "org/991158)).\n"
-"The <codesearch.debian.net> site gives the answer.  (Thanks!)\n"
+"The <https://codesearch.debian.net> site gives the answer.  (Thanks!)"
 
 #. type: Plain text
 msgid ""

updated PO files
diff --git "a/Debian/debi\303\242neries/codesearch.en.po" "b/Debian/debi\303\242neries/codesearch.en.po"
index 923df5f1..a9a55728 100644
--- "a/Debian/debi\303\242neries/codesearch.en.po"
+++ "b/Debian/debi\303\242neries/codesearch.en.po"
@@ -6,14 +6,14 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: \n"
-"POT-Creation-Date: 2021-07-22 08:37+0000\n"
+"POT-Creation-Date: 2021-07-22 08:44+0000\n"
 "PO-Revision-Date: 2021-07-22 17:43+0900\n"
+"Last-Translator: Charles Plessy <toto@example.com>\n"
+"Language-Team: \n"
 "Language: en\n"
 "MIME-Version: 1.0\n"
 "Content-Type: text/plain; charset=UTF-8\n"
 "Content-Transfer-Encoding: 8bit\n"
-"Last-Translator: Charles Plessy <toto@example.com>\n"
-"Language-Team: \n"
 "X-Generator: Poedit 2.2.1\n"
 
 #. type: Plain text
@@ -37,27 +37,42 @@ msgid "[[!meta title=\"Recherche dans les sources de Debian\"]]\n"
 msgstr "[[!meta title=\"Search in Debian's sources\"]]\n"
 
 #. type: Plain text
-#, no-wrap
+#, fuzzy
+#| msgid ""
+#| "Via mon travail sur le paquet [`media-types`](packages.debian.org/media-"
+#| "types)\n"
+#| "je voulais savoir quel paquets utilisaient le type média `application/x-"
+#| "xcf`\n"
+#| "qui apparemment est erroné ([#991158](https://bugs.debian.org/991158)).  "
+#| "Le\n"
+#| "site <codesearch.debian.net> permet de répondre à cette question.  "
+#| "(Merci !)\n"
 msgid ""
-"Via mon travail sur le paquet [`media-types`](packages.debian.org/media-types)\n"
-"je voulais savoir quel paquets utilisaient le type média `application/x-xcf`\n"
-"qui apparemment est erroné ([#991158](https://bugs.debian.org/991158)).  Le\n"
-"site <codesearch.debian.net> permet de répondre à cette question.  (Merci !)\n"
+"Via mon travail sur le paquet [`media-types`](packages.debian.org/media-"
+"types)  je voulais savoir quel paquets utilisaient le type média "
+"`application/x-xcf` qui apparemment est erroné ([#991158](https://bugs."
+"debian.org/991158)).  Le site <https://codesearch.debian.net> permet de "
+"répondre à cette question.  (Merci !)"
 msgstr ""
-"Via my work on the [`media-types`](packages.debian.org/media-types) package, \n"
-"I wanted to know which packages were using the media type `application/x-xcf`,\n"
-"which apparently is not correct ([#991158](https://bugs.debian.org/991158)).\n"
+"Via my work on the [`media-types`](packages.debian.org/media-types) "
+"package, \n"
+"I wanted to know which packages were using the media type `application/x-"
+"xcf`,\n"
+"which apparently is not correct ([#991158](https://bugs.debian."
+"org/991158)).\n"
 "The <codesearch.debian.net> site gives the answer.  (Thanks!)\n"
 
 #. type: Plain text
 msgid ""
-"De plus, [en créant une clé d'utilisateur](https://codesearch.debian.net/apikeys/), on peut "
-"interroger le site en ligne de commande; voici un exemple ci-dessous (le fichier `dcs-apikeyHeader-"
-"plessy.txt` contient `x-dcs-apikey: ` suivi de ma clé d'accès)"
+"De plus, [en créant une clé d'utilisateur](https://codesearch.debian.net/"
+"apikeys/), on peut interroger le site en ligne de commande; voici un exemple "
+"ci-dessous (le fichier `dcs-apikeyHeader-plessy.txt` contient `x-dcs-apikey: "
+"` suivi de ma clé d'accès)"
 msgstr ""
-"Moreover, one can [create a user key](https://codesearch.debian.net/apikeys/), for command-line "
-"remote access; here is an example below (the file `dcs-apikeyHeader-plessy.txt` contains `x-dcs-"
-"apikey: ` followed by my access key)."
+"Moreover, one can [create a user key](https://codesearch.debian.net/"
+"apikeys/), for command-line remote access; here is an example below (the "
+"file `dcs-apikeyHeader-plessy.txt` contains `x-dcs-apikey: ` followed by my "
+"access key)."
 
 #. type: Plain text
 #, no-wrap
@@ -66,11 +81,12 @@ msgstr "    curl -X GET \"https://codesearch.debian.net/api/v1/searchperpackage?
 
 #. type: Plain text
 msgid ""
-"Le résultat est en JSON.  Voici comment de l'ai transformé pour faire une liste d'adresses courriel "
-"à contacter que j'ai pu facilement coller dans `mutt`."
+"Le résultat est en JSON.  Voici comment de l'ai transformé pour faire une "
+"liste d'adresses courriel à contacter que j'ai pu facilement coller dans "
+"`mutt`."
 msgstr ""
-"The result is serialised in JSON.  Here is how I transformed it to make a list of email addresses "
-"that I could easily paste in `mutt`."
+"The result is serialised in JSON.  Here is how I transformed it to make a "
+"list of email addresses that I could easily paste in `mutt`."
 
 #. type: Plain text
 #, no-wrap

https
diff --git "a/Debian/debi\303\242neries/codesearch.mdwn" "b/Debian/debi\303\242neries/codesearch.mdwn"
index 56b47562..9f7084fe 100644
--- "a/Debian/debi\303\242neries/codesearch.mdwn"
+++ "b/Debian/debi\303\242neries/codesearch.mdwn"
@@ -7,7 +7,7 @@
 Via mon travail sur le paquet [`media-types`](packages.debian.org/media-types)
 je voulais savoir quel paquets utilisaient le type média `application/x-xcf`
 qui apparemment est erroné ([#991158](https://bugs.debian.org/991158)).  Le
-site <codesearch.debian.net> permet de répondre à cette question.  (Merci !)
+site <https://codesearch.debian.net> permet de répondre à cette question.  (Merci !)
 
 De plus, [en créant une clé d'utilisateur](https://codesearch.debian.net/apikeys/),
 on peut interroger le site en ligne de commande; voici un exemple ci-dessous

updated PO files
diff --git "a/Debian/debi\303\242neries/codesearch.en.po" "b/Debian/debi\303\242neries/codesearch.en.po"
index 923df5f1..51ae2ecf 100644
--- "a/Debian/debi\303\242neries/codesearch.en.po"
+++ "b/Debian/debi\303\242neries/codesearch.en.po"
@@ -6,14 +6,14 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: \n"
-"POT-Creation-Date: 2021-07-22 08:37+0000\n"
+"POT-Creation-Date: 2021-07-22 08:43+0000\n"
 "PO-Revision-Date: 2021-07-22 17:43+0900\n"
+"Last-Translator: Charles Plessy <toto@example.com>\n"
+"Language-Team: \n"
 "Language: en\n"
 "MIME-Version: 1.0\n"
 "Content-Type: text/plain; charset=UTF-8\n"
 "Content-Transfer-Encoding: 8bit\n"
-"Last-Translator: Charles Plessy <toto@example.com>\n"
-"Language-Team: \n"
 "X-Generator: Poedit 2.2.1\n"
 
 #. type: Plain text
@@ -51,13 +51,15 @@ msgstr ""
 
 #. type: Plain text
 msgid ""
-"De plus, [en créant une clé d'utilisateur](https://codesearch.debian.net/apikeys/), on peut "
-"interroger le site en ligne de commande; voici un exemple ci-dessous (le fichier `dcs-apikeyHeader-"
-"plessy.txt` contient `x-dcs-apikey: ` suivi de ma clé d'accès)"
+"De plus, [en créant une clé d'utilisateur](https://codesearch.debian.net/"
+"apikeys/), on peut interroger le site en ligne de commande; voici un exemple "
+"ci-dessous (le fichier `dcs-apikeyHeader-plessy.txt` contient `x-dcs-apikey: "
+"` suivi de ma clé d'accès)"
 msgstr ""
-"Moreover, one can [create a user key](https://codesearch.debian.net/apikeys/), for command-line "
-"remote access; here is an example below (the file `dcs-apikeyHeader-plessy.txt` contains `x-dcs-"
-"apikey: ` followed by my access key)."
+"Moreover, one can [create a user key](https://codesearch.debian.net/"
+"apikeys/), for command-line remote access; here is an example below (the "
+"file `dcs-apikeyHeader-plessy.txt` contains `x-dcs-apikey: ` followed by my "
+"access key)."
 
 #. type: Plain text
 #, no-wrap
@@ -66,11 +68,12 @@ msgstr "    curl -X GET \"https://codesearch.debian.net/api/v1/searchperpackage?
 
 #. type: Plain text
 msgid ""
-"Le résultat est en JSON.  Voici comment de l'ai transformé pour faire une liste d'adresses courriel "
-"à contacter que j'ai pu facilement coller dans `mutt`."
+"Le résultat est en JSON.  Voici comment de l'ai transformé pour faire une "
+"liste d'adresses courriel à contacter que j'ai pu facilement coller dans "
+"`mutt`."
 msgstr ""
-"The result is serialised in JSON.  Here is how I transformed it to make a list of email addresses "
-"that I could easily paste in `mutt`."
+"The result is serialised in JSON.  Here is how I transformed it to make a "
+"list of email addresses that I could easily paste in `mutt`."
 
 #. type: Plain text
 #, no-wrap

En english
diff --git "a/Debian/debi\303\242neries/codesearch.en.po" "b/Debian/debi\303\242neries/codesearch.en.po"
index 61139f59..923df5f1 100644
--- "a/Debian/debi\303\242neries/codesearch.en.po"
+++ "b/Debian/debi\303\242neries/codesearch.en.po"
@@ -3,75 +3,74 @@
 # This file is distributed under the same license as the PACKAGE package.
 # FIRST AUTHOR <EMAIL@ADDRESS>, YEAR.
 #
-#, fuzzy
 msgid ""
 msgstr ""
-"Project-Id-Version: PACKAGE VERSION\n"
+"Project-Id-Version: \n"
 "POT-Creation-Date: 2021-07-22 08:37+0000\n"
-"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
-"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
-"Language-Team: LANGUAGE <LL@li.org>\n"
-"Language: \n"
+"PO-Revision-Date: 2021-07-22 17:43+0900\n"
+"Language: en\n"
 "MIME-Version: 1.0\n"
 "Content-Type: text/plain; charset=UTF-8\n"
 "Content-Transfer-Encoding: 8bit\n"
+"Last-Translator: Charles Plessy <toto@example.com>\n"
+"Language-Team: \n"
+"X-Generator: Poedit 2.2.1\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!meta date=\"Thu, 22 Jul 2021 17:24:34 +0900\"]]\n"
-msgstr ""
+msgstr "[[!meta date=\"Thu, 22 Jul 2021 17:24:34 +0900\"]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!meta updated=\"Thu, 22 Jul 2021 17:24:34 +0900\"]]\n"
-msgstr ""
+msgstr "[[!meta updated=\"Thu, 22 Jul 2021 17:24:34 +0900\"]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!tag Debian]]\n"
-msgstr ""
+msgstr "[[!tag Debian]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!meta title=\"Recherche dans les sources de Debian\"]]\n"
-msgstr ""
+msgstr "[[!meta title=\"Search in Debian's sources\"]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid ""
-"Via mon travail sur le paquet "
-"[`media-types`](packages.debian.org/media-types)\n"
-"je voulais savoir quel paquets utilisaient le type média "
-"`application/x-xcf`\n"
-"qui apparemment est erroné ([#991158](https://bugs.debian.org/991158)).  "
-"Le\n"
-"site <codesearch.debian.net> permet de répondre à cette question.  "
-"(Merci !)\n"
+"Via mon travail sur le paquet [`media-types`](packages.debian.org/media-types)\n"
+"je voulais savoir quel paquets utilisaient le type média `application/x-xcf`\n"
+"qui apparemment est erroné ([#991158](https://bugs.debian.org/991158)).  Le\n"
+"site <codesearch.debian.net> permet de répondre à cette question.  (Merci !)\n"
 msgstr ""
+"Via my work on the [`media-types`](packages.debian.org/media-types) package, \n"
+"I wanted to know which packages were using the media type `application/x-xcf`,\n"
+"which apparently is not correct ([#991158](https://bugs.debian.org/991158)).\n"
+"The <codesearch.debian.net> site gives the answer.  (Thanks!)\n"
 
 #. type: Plain text
 msgid ""
-"De plus, [en créant une clé "
-"d'utilisateur](https://codesearch.debian.net/apikeys/), on peut interroger "
-"le site en ligne de commande; voici un exemple ci-dessous (le fichier "
-"`dcs-apikeyHeader-plessy.txt` contient `x-dcs-apikey: ` suivi de ma clé "
-"d'accès)"
+"De plus, [en créant une clé d'utilisateur](https://codesearch.debian.net/apikeys/), on peut "
+"interroger le site en ligne de commande; voici un exemple ci-dessous (le fichier `dcs-apikeyHeader-"
+"plessy.txt` contient `x-dcs-apikey: ` suivi de ma clé d'accès)"
 msgstr ""
+"Moreover, one can [create a user key](https://codesearch.debian.net/apikeys/), for command-line "
+"remote access; here is an example below (the file `dcs-apikeyHeader-plessy.txt` contains `x-dcs-"
+"apikey: ` followed by my access key)."
 
 #. type: Plain text
 #, no-wrap
-msgid ""
-"    curl -X GET "
-"\"https://codesearch.debian.net/api/v1/searchperpackage?query=application/x-xcf&match_mode=literal\" "
-"-H @dcs-apikeyHeader-plessy.txt > result.json\n"
-msgstr ""
+msgid "    curl -X GET \"https://codesearch.debian.net/api/v1/searchperpackage?query=application/x-xcf&match_mode=literal\" -H @dcs-apikeyHeader-plessy.txt > result.json\n"
+msgstr "    curl -X GET \"https://codesearch.debian.net/api/v1/searchperpackage?query=application/x-xcf&match_mode=literal\" -H @dcs-apikeyHeader-plessy.txt > result.json\n"
 
 #. type: Plain text
 msgid ""
-"Le résultat est en JSON.  Voici comment de l'ai transformé pour faire une "
-"liste d'adresses courriel à contacter que j'ai pu facilement coller dans "
-"`mutt`."
+"Le résultat est en JSON.  Voici comment de l'ai transformé pour faire une liste d'adresses courriel "
+"à contacter que j'ai pu facilement coller dans `mutt`."
 msgstr ""
+"The result is serialised in JSON.  Here is how I transformed it to make a list of email addresses "
+"that I could easily paste in `mutt`."
 
 #. type: Plain text
 #, no-wrap
@@ -81,3 +80,7 @@ msgid ""
 "      dd-list --stdin |\n"
 "      sed -e '/^ /d' -e '/^$/'d -e 's/$/,/' -e 's/^/  /'\n"
 msgstr ""
+"    cat result.json |\n"
+"      jq --raw-output '.[].\"package\"' |\n"
+"      dd-list --stdin |\n"
+"      sed -e '/^ /d' -e '/^$/'d -e 's/$/,/' -e 's/^/  /'\n"

updated PO files
diff --git "a/Debian/debi\303\242neries/codesearch.en.po" "b/Debian/debi\303\242neries/codesearch.en.po"
new file mode 100644
index 00000000..61139f59
--- /dev/null
+++ "b/Debian/debi\303\242neries/codesearch.en.po"
@@ -0,0 +1,83 @@
+# SOME DESCRIPTIVE TITLE
+# Copyright (C) YEAR Free Software Foundation, Inc.
+# This file is distributed under the same license as the PACKAGE package.
+# FIRST AUTHOR <EMAIL@ADDRESS>, YEAR.
+#
+#, fuzzy
+msgid ""
+msgstr ""
+"Project-Id-Version: PACKAGE VERSION\n"
+"POT-Creation-Date: 2021-07-22 08:37+0000\n"
+"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
+"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
+"Language-Team: LANGUAGE <LL@li.org>\n"
+"Language: \n"
+"MIME-Version: 1.0\n"
+"Content-Type: text/plain; charset=UTF-8\n"
+"Content-Transfer-Encoding: 8bit\n"
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!meta date=\"Thu, 22 Jul 2021 17:24:34 +0900\"]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!meta updated=\"Thu, 22 Jul 2021 17:24:34 +0900\"]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!tag Debian]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!meta title=\"Recherche dans les sources de Debian\"]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid ""
+"Via mon travail sur le paquet "
+"[`media-types`](packages.debian.org/media-types)\n"
+"je voulais savoir quel paquets utilisaient le type média "
+"`application/x-xcf`\n"
+"qui apparemment est erroné ([#991158](https://bugs.debian.org/991158)).  "
+"Le\n"
+"site <codesearch.debian.net> permet de répondre à cette question.  "
+"(Merci !)\n"
+msgstr ""
+
+#. type: Plain text
+msgid ""
+"De plus, [en créant une clé "
+"d'utilisateur](https://codesearch.debian.net/apikeys/), on peut interroger "
+"le site en ligne de commande; voici un exemple ci-dessous (le fichier "
+"`dcs-apikeyHeader-plessy.txt` contient `x-dcs-apikey: ` suivi de ma clé "
+"d'accès)"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid ""
+"    curl -X GET "
+"\"https://codesearch.debian.net/api/v1/searchperpackage?query=application/x-xcf&match_mode=literal\" "
+"-H @dcs-apikeyHeader-plessy.txt > result.json\n"
+msgstr ""
+
+#. type: Plain text
+msgid ""
+"Le résultat est en JSON.  Voici comment de l'ai transformé pour faire une "
+"liste d'adresses courriel à contacter que j'ai pu facilement coller dans "
+"`mutt`."
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid ""
+"    cat result.json |\n"
+"      jq --raw-output '.[].\"package\"' |\n"
+"      dd-list --stdin |\n"
+"      sed -e '/^ /d' -e '/^$/'d -e 's/$/,/' -e 's/^/  /'\n"
+msgstr ""
diff --git "a/Debian/debi\303\242neries/r-4.1.en.po" "b/Debian/debi\303\242neries/r-4.1.en.po"
index 441cd445..33130930 100644
--- "a/Debian/debi\303\242neries/r-4.1.en.po"
+++ "b/Debian/debi\303\242neries/r-4.1.en.po"
@@ -6,14 +6,14 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: \n"
-"POT-Creation-Date: 2021-05-24 02:21+0000\n"
+"POT-Creation-Date: 2021-07-22 08:37+0000\n"
 "PO-Revision-Date: 2021-05-24 11:26+0900\n"
+"Last-Translator: \n"
+"Language-Team: \n"
 "Language: en\n"
 "MIME-Version: 1.0\n"
 "Content-Type: text/plain; charset=UTF-8\n"
 "Content-Transfer-Encoding: 8bit\n"
-"Last-Translator: \n"
-"Language-Team: \n"
 "X-Generator: Poedit 2.2.1\n"
 
 #. type: Plain text

Codesearch
diff --git "a/Debian/debi\303\242neries/codesearch.mdwn" "b/Debian/debi\303\242neries/codesearch.mdwn"
new file mode 100644
index 00000000..56b47562
--- /dev/null
+++ "b/Debian/debi\303\242neries/codesearch.mdwn"
@@ -0,0 +1,25 @@
+[[!meta date="Thu, 22 Jul 2021 17:24:34 +0900"]]
+[[!meta updated="Thu, 22 Jul 2021 17:24:34 +0900"]]
+[[!tag Debian]]
+
+[[!meta title="Recherche dans les sources de Debian"]]
+
+Via mon travail sur le paquet [`media-types`](packages.debian.org/media-types)
+je voulais savoir quel paquets utilisaient le type média `application/x-xcf`
+qui apparemment est erroné ([#991158](https://bugs.debian.org/991158)).  Le
+site <codesearch.debian.net> permet de répondre à cette question.  (Merci !)
+
+De plus, [en créant une clé d'utilisateur](https://codesearch.debian.net/apikeys/),
+on peut interroger le site en ligne de commande; voici un exemple ci-dessous
+(le fichier `dcs-apikeyHeader-plessy.txt` contient `x-dcs-apikey: ` suivi de ma
+clé d'accès)
+
+    curl -X GET "https://codesearch.debian.net/api/v1/searchperpackage?query=application/x-xcf&match_mode=literal" -H @dcs-apikeyHeader-plessy.txt > result.json
+
+Le résultat est en JSON.  Voici comment de l'ai transformé pour faire une liste
+d'adresses courriel à contacter que j'ai pu facilement coller dans `mutt`.
+
+    cat result.json |
+      jq --raw-output '.[]."package"' |
+      dd-list --stdin |
+      sed -e '/^ /d' -e '/^$/'d -e 's/$/,/' -e 's/^/  /'

Parenthèses
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 94662e25..099fa178 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -236,12 +236,12 @@ Genes and pathways
  - Two connexins, CxA and CxB are expressed during embyogenesis ([[Mikhaleva,
    Tolstenkov and Glover 2019|biblio/30905687]]).
  - Piwi ([[Henriet and coll., 2015|biblio/25779047]]).
- - Metallothioneins _OdMT1_ and _OdMT2_ [[Calatayud and coll., 2018|biblio/30284576]].
+ - Metallothioneins _OdMT1_ and _OdMT2_ ([[Calatayud and coll., 2018|biblio/30284576]]).
    Their cysteins are organised in a way that is not found in other branches of the
-   evolutionary tree [[Calatayud and coll., 2021a|biblio/34146103]].  They bind cadmium
+   evolutionary tree ([[Calatayud and coll., 2021a|biblio/34146103]]).  They bind cadmium
    ions and display variations of number of tandem repeats between dioceous species.
    Non-functional alleles were found, raising the possibility that some individuals
-   lack MT genes [[Calatayud and coll., 2021b|biblio/34277643]].
+   lack MT genes ([[Calatayud and coll., 2021b|biblio/34277643]]).
  - 2 NUMB genes were found; both are closer to Vertebrate NUMB than to Vertebrate NUMB-Like
    ([[Confalonieri and coll., 2019|biblio/31451549]]).
  - Genes related to thyroid functions (_vWFL_, _Nkx2-1_, _FoxE_, _TPO_ and _Duox_)

MTs
diff --git a/biblio/34277643.mdwn b/biblio/34277643.mdwn
new file mode 100644
index 00000000..d8968413
--- /dev/null
+++ b/biblio/34277643.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Modular Evolution and Population Variability of Oikopleura dioica Metallothioneins."]]
+[[!tag Oikopleura]]
+
+Calatayud S, Garcia-Risco M, Capdevila M, Cañestro C, Palacios Ò, Albalat R.
+
+Front Cell Dev Biol. 2021 Jul 2;9:702688. doi:10.3389/fcell.2021.702688
+
+Modular Evolution and Population Variability of Oikopleura dioica Metallothioneins.
+
+[[!pmid 34277643 desc="“we concluded that the 11C/12C domain of OdiMTs formed stable clusters with four Cd(II) ions”  “protein sequence comparisons reveal amino-acid identities ranging from 94.4% between Norway and Barcelona, up to 63.9% when compared with the sequence of Okinawa”  “amino acid identities persistently were slightly lower than nucleotide identities [...] indicated that nucleotide substitutions are significantly affecting non-synonymous positions, which can be considered an indication [of] positive selection.”  “The presence of [...] non-functional alleles for both MTs [...] opened the possibility that some O. dioica specimens might lack functional MTs”  “The most conspicuous difference of OdiMT genes between O. dioica populations was the identification of OdiMT2 encoding proteins with variable number of RUs (i.e., t-12C/12 pairs). OdiMT2ORE with seven repeats (RU1–RU7) was the longest one, followed by OdiMT2NOR, with six repeats, OdiMT2OSA, with five repeats, OdiMT2CAT, with four repeats, and OdiMT2OKI, with three repeats.”"]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 2d481120..94662e25 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -238,7 +238,10 @@ Genes and pathways
  - Piwi ([[Henriet and coll., 2015|biblio/25779047]]).
  - Metallothioneins _OdMT1_ and _OdMT2_ [[Calatayud and coll., 2018|biblio/30284576]].
    Their cysteins are organised in a way that is not found in other branches of the
-   evolutionary tree [Calatayud and coll., 2021|biblio/34146103].
+   evolutionary tree [[Calatayud and coll., 2021a|biblio/34146103]].  They bind cadmium
+   ions and display variations of number of tandem repeats between dioceous species.
+   Non-functional alleles were found, raising the possibility that some individuals
+   lack MT genes [[Calatayud and coll., 2021b|biblio/34277643]].
  - 2 NUMB genes were found; both are closer to Vertebrate NUMB than to Vertebrate NUMB-Like
    ([[Confalonieri and coll., 2019|biblio/31451549]]).
  - Genes related to thyroid functions (_vWFL_, _Nkx2-1_, _FoxE_, _TPO_ and _Duox_)

Taco Kimchi
diff --git a/biblio/10.1111_cla.12405.mdwn b/biblio/10.1111_cla.12405.mdwn
index fec5609f..84f37f1c 100644
--- a/biblio/10.1111_cla.12405.mdwn
+++ b/biblio/10.1111_cla.12405.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Phylogenetic analysis of phenotypic characters of Tunicata supports basal Appendicularia and monophyletic Ascidiacea"]]
-[[!tag to_read Oikopleura]]
+[[!tag Oikopleura]]
 
 Katrin Braun, Fanny Leubner, Thomas Stach
 
@@ -7,4 +7,4 @@ Cladistics Volume36, Issue3, June 2020, Pages 259–300 doi:10.1111/cla.12405
 
 Phylogenetic analysis of phenotypic characters of Tunicata supports basal Appendicularia and monophyletic Ascidiacea
 
-[[!doi 10.1111/cla.12405 desc="Places appendicularians basal in tunicates."]]
+[[!doi 10.1111/cla.12405 desc="Places appendicularians basal in tunicates.  Detailed summary of past studies pro and con that placement."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 7c372cb9..2d481120 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -51,6 +51,8 @@ Phylogeny
    and 210 single-copy orthogroups from 37 tunicates + 10 outgroups
    [[DeBiasse and coll., 2020|biblio/32211845]] show that appendicularians are
    sister to all other tunicates.
+ - Study of 117 phenotypic characters in 49 tunicate species also support basal
+   position of appendicularians ([[Braun, Leubner and Stach, 2019|biblio/10.1111_cla.12405]].
  - “The difference between coding sequences was considerably higher in
    comparisons between strains of different oceans than within the Bergen gene
    pool.  We ignore whether and how Oikopleura dioica is subdivided into multiple

eDNA primers
diff --git a/tags/eDNA.mdwn b/tags/eDNA.mdwn
index d17cbe9b..48987409 100644
--- a/tags/eDNA.mdwn
+++ b/tags/eDNA.mdwn
@@ -11,4 +11,22 @@
 
  - A Nextflow pipeline: eDNAFlow [[Mousavi‐Derazmahalleh and coll., 2021|biblio/10.1111_1755-0998.13356]].
 
+### Published primers
+
+```
+>18S_1F 10.1371/journal.pone.0073935
+GCCAGTAGTCATATGCTTGTCT
+>18S_701R 10.1371/journal.pone.0073935
+GGAGCTGGAATTACCGC
+```
+https://doi.org/10.1371/journal.pone.0073935
+
+```
+>UroCox1-244 F 10.2108/zsj.26.564
+CATTTWTTTTGATTWTTTRGWCATCCNGA
+>UroCox1-387R 10.2108/zsj.26.564
+GCWCYTATWSWWAAWACATAATGAAARTG
+```
+https://doi.org/10.2108/zsj.26.564
+
 [[!inline pages="tagged(eDNA)" limit=0]]

Café
diff --git a/biblio/33963409.mdwn b/biblio/33963409.mdwn
new file mode 100644
index 00000000..219e4217
--- /dev/null
+++ b/biblio/33963409.mdwn
@@ -0,0 +1,12 @@
+[[!meta title="Locally adaptive inversions modulate genetic variation at different geographic scales in a seaweed fly"]]
+[[!tag variants genome]]
+
+Mérot C, Berdan E, Cayuela H, Djambazian H, Ferchaud AL, Laporte M, Normandeau E, Ragoussis J, Wellenreuther M, Bernatchez L.
+
+Mol Biol Evol. 2021 May 7:msab143. doi:10.1093/molbev/msab143
+
+Locally adaptive inversions modulate genetic variation at different geographic scales in a seaweed fly.
+
+[[!pmid 33963409 desc="Chromosomal assembly of Coelopa frigida.  SNP analysis and PCA revealed known and candidate genomic inversions."]]
+
+“We sampled the seaweed fly _Coelopa frigida_ along a bioclimatic gradient stretching across 10° of latitude, a salinity gradient and a range of heterogeneous, patchy habitats. We generated a chromosome-level genome assembly to analyse 1,446 low-coverage whole genomes collected along those gradients.“  “Analyses of more than 1,400 whole genomes of _C. frigida_ flies revealed four large chromosomal inversions affecting a large fraction of the genome (36.1Mb, 15%), and three low recombining genomic regions.”  “Among the 124,701 candidate SNPs identified by the GWAS, more than 99.8% were located in Cf-Inv(1)”  “At a finer geographic scale, outlier SNPs associated with wrackbed abiotic characteristics (depth, temperature and salinity) were strongly enriched in the inverted region Cf-Inv(1) with an odds ratio of 5, including outliers with very strong support”
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 864be2d8..6eb4f28c 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -5,6 +5,9 @@ _in progress_
 Long read sequencing data from 3,622 Icelanders identified a median of 22,636
 SVs per individual (insertios: 13,353; deletions: 9,474) [[Beyter and coll, 2021|biblio/33972781]].
 
+SNP analysis in >1400 seaweed flies identified known and candidate genomic inversions
+([[Mérot and coll, 2021|biblio/33963409]]).
+
 ### Software
 
  - _NanoSV_ ([[Cretu Stancu and coll., 2017|biblio/29109544]]) uses nanopore long

Remove rarely used tag
diff --git a/biblio/21177961.mdwn b/biblio/21177961.mdwn
index 7bef1fc6..5c1aa053 100644
--- a/biblio/21177961.mdwn
+++ b/biblio/21177961.mdwn
@@ -1,3 +1,3 @@
 [[!meta title="Genome-wide analysis of promoter architecture in Drosophila melanogaster."]]
-[[!tag fly CAGE promoter 3′_UTR]]
+[[!tag Drosophila CAGE promoter 3′_UTR]]
 [[!pmid 21177961 desc="Introduces promoter ‘shape index’, finds tags aligning to mitochondrial genome, and suggests that, because they do not overlap with the small RNAs produced by PolII stalling, the 3′ peaks are a processing product."]]
diff --git a/tags/fly.mdwn b/tags/fly.mdwn
deleted file mode 100644
index 4ada57c1..00000000
--- a/tags/fly.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged fly"]]
-
-[[!inline pages="tagged(fly)" actions="no" archive="yes"
-feedshow=10]]

Café
diff --git a/biblio/17780989.mdwn b/biblio/17780989.mdwn
new file mode 100644
index 00000000..0ad5b777
--- /dev/null
+++ b/biblio/17780989.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Abandoned larvacean houses: a unique food source in the pelagic environment"]]
+[[!tag Oikopleura]]
+
+Alldredge AL.
+
+Science. 1972 Sep 8;177(4052):885-7. doi:10.1126/science.177.4052.885
+
+Abandoned larvacean houses: a unique food source in the pelagic environment
+
+[[!pmid 17780989 desc="The copepod _Oncaea mediterranea_ can feed on appendicularian houses (lab experiment with starved copepods).  As some nanoplankton is caugt in the abandonned houses, this brings back the nanplankton in the copepod food chain."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 74c9472a..7c372cb9 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -509,6 +509,8 @@ House
    is lost during later development.
  - Study of the _O. dioica_ house and the origin of its components on the oikoblastic
    epithelium, using multiple microscopy techniques [[Razghandi and coll., 2020|biblio/34041785]].
+ - Abandonned houses bring nanoplankton into the copepod food chain
+   ([[Alldredge AL, 1972|biblio/17780989]]).
 
 Phenotypes
 ----------

Café
diff --git a/biblio/33461212.mdwn b/biblio/33461212.mdwn
new file mode 100644
index 00000000..697cfcb2
--- /dev/null
+++ b/biblio/33461212.mdwn
@@ -0,0 +1,22 @@
+[[!meta title="Giant lungfish genome elucidates the conquest of land by vertebrates."]]
+[[!tag fish genome intron]]
+
+Meyer A, Schloissnig S, Franchini P, Du K, Woltering JM, Irisarri I, Wong WY, Nowoshilow S, Kneitz S, Kawaguchi A, Fabrizius A, Xiong P, Dechaud C, Spaink HP, Volff JN, Simakov O, Burmester T, Tanaka EM, Schartl M.
+
+Nature. 2021 Feb;590(7845):284-289. doi:10.1038/s41586-021-03198-8
+
+Giant lungfish genome elucidates the conquest of land by vertebrates.
+
+[[!pmid 33461212 desc="37-Gb assembly, 90% repetitive, with long introns.  However, introns in developmental genes are proportionally smaller than other introns.  The proportion of intronic sequences (~20%) is simlar to the one of human.  Microchromosomes were retained."]]
+
+“37-Gb assembly with an N50 contig size 1.86 Mb”
+
+“The complete retention of microchromosomes [...] suggests that stabilizing selection maintains these ancestral units. In support of this, lungfish microchromosomes show—on average—higher gene densities and a lower density of long interspersed nuclear elements (LINEs), which are the major contributors to genome size”
+
+“[We] identified 67.3% (24.65 Gb) as repetitive. To our knowledge, this is the highest repetitive DNA content in a genome found in the animal kingdom.  [...] applying a second round of repeat annotation [...] revealed an additional 23.92% of repetitive DNA”
+
+“All major categories of transposable elements (1,106 out of 1,821 (60.7%)) were expressed [in poly(A)-RNA-derived RNA-seq data].”
+
+“The largest intron of the lungfish is 5.8 Mb (in the dmbt1 gene) and average intron size is 50 kb as in axolotl, compared to 1 kb in fugu and 6 kb in human. Introns in the N. forsteri genome comprise about 8 Gb (21% of genome)—a similar proportion to that in human (21%), but half that of fugu (40%).”  ”Similar to axolotl, the introns in developmental genes in lungfish are smaller than in nondevelopmental genes”
+
+“The 4 clusters of hox genes [...] comprise 43 genes; the presence of hoxb10 and hoxa14 in lungfish confirms their loss at the fish-to-tetrapod transition.”

mini-chromosomeswq
diff --git a/biblio/32313176.mdwn b/biblio/32313176.mdwn
index 614e184a..f1da69c7 100644
--- a/biblio/32313176.mdwn
+++ b/biblio/32313176.mdwn
@@ -7,4 +7,4 @@ Nat Ecol Evol. 2020 Jun;4(6):820-830. doi:10.1038/s41559-020-1156-z
 
 Deeply conserved synteny resolves early events in vertebrate evolution.
 
-[[!pmid 32313176 desc="Most of the 19 amphioxus (lancelet) chromosomes directly correspond to one of the 17 ancestral chordate linkage groups.  Pattern of paralogue elimination show that autotetraploidy was followed by allotetraploidy in bony vertebrates."]]
+[[!pmid 32313176 desc="Most of the 19 amphioxus (lancelet) chromosomes directly correspond to one of the 17 ancestral chordate linkage groups.  Pattern of paralogue elimination show that autotetraploidy was followed by allotetraploidy in bony vertebrates.  Vertebrate and amphioxus mini-chromosomes descend from the ancestral linkage groups too."]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index f915e414..7877f2c5 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -38,6 +38,8 @@ two species [[Mudd and coll, 2020|biblio/32873878]].
 
  - The ancestral chordate has 17 chromosomes according to amphioxus assemblies
   ([[Putnam and coll, 2008|biblio/18563158]], [[Simakov and coll., 2020|biblio/32313176]]).
+   Vertebrate and amphioxus mini-chromosomes also descend from the ancestral
+   chordate linkage groups (CLG).
 
  - The scallop genome has 19 chromosomes, which are syntenic to the 17 ancestral
    chordate chromosomes.  _Drosophila_ has no synteny with scallop, but _C.

Merge branch 'master' of ssh://charles-plessy-org.branchable.com
GenBank accession numbers.
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index befcf656..754ed7ca 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -27,7 +27,8 @@ Some links:
    ([[Dardaillon and coll., 2020|biblio/31680137]]):
    <https://www.aniseed.cnrs.fr/aniseed/species/show_species?unique_name=Oikopleura_dioica>
  - OKI2018_I69 genome [[Bliznina and coll., 2021|biblio/33781200]] on ZENBU:
-   <https://fantom.gsc.riken.jp/zenbu/gLyphs/#config=0tPT7vwSO1Vm5QV9iKqfAC>.
+   <https://fantom.gsc.riken.jp/zenbu/gLyphs/#config=0tPT7vwSO1Vm5QV9iKqfAC>
+   and in GenBank [CAJRAX010000001-CAJRAX010000013](https://www.ncbi.nlm.nih.gov/nuccore/2038458167).
 
 Parasites: _Oodinium pouchetii_, microsporidia (on _O. gracilis_ ([[Savelieva
 2019|biblio/10.1134_S1063074019020111]])), bacteria ([[Flood,

Café
diff --git a/biblio/34108684.mdwn b/biblio/34108684.mdwn
new file mode 100644
index 00000000..7cf530e7
--- /dev/null
+++ b/biblio/34108684.mdwn
@@ -0,0 +1,22 @@
+[[!meta title="Spo11 generates gaps through concerted cuts at sites of topological stress."]]
+[[!tag meiosis repair]]
+
+Nature. 2021 Jun;594(7864):577-582. doi:10.1038/s41586-021-03632-x
+
+Prieler S, Chen D, Huang L, Mayrhofer E, Zsótér S, Vesely M, Mbogning J, Klein F.
+
+Spo11 generates gaps through concerted cuts at sites of topological stress. 
+
+[[!pmid 34108684 desc="Spo11 has a binding preference for CN7AAGCA|TGCTTN7G and for bendable DNA.  Double Spo11 cleavage generates chromosome gaps repaired by gene conversion."]]
+
+“we developed ‘Protec-seq’ for the purification of end-protected DNA, which includes ChIP of Spo11, ExoV digestion, and the removal of residual 5′-tyrosyl [with hTDP2 (BPS Bioscience)] followed by deep sequencing.”
+
+“dDSB fragments also densely cover chromosomal regions between hotspots, with approximately 31% of cuts outside of hotspots in wild-type cells and around 62% in rad50S mutants”
+
+”The high precision of Protec-seq enabled us to identify that Spo11 has a preference for sequences that partially match a 26-nt long palindromic motif, CN7AAGCA|TGCTTN7G, centred at the cleavage axis (Fig. 2a), and a preference for C and G at position ±13 bp marking the border of the footprint of Spo1133.”
+
+“Dividing the preferred fragment lengths into n helical turns leads to helix lengths above 10.4 bp, indicative of underwound DNA. [...] DNA at promoters is underwound or negatively supercoiled [...] In both wild-type and rad50S cells, (d)DSB levels correlate positively with the corresponding transcriptional stress.”
+
+”As an evolutionary relative of a type IIB topoisomerase, the Spo11 complex may require DNA crossings for the cleavage reaction, which are likely to form at promoters known to accumulate negative supercoils. [...] topoisomerase II (Top2) prefers to bind to DNA crossings under superhelical stress [...] robust [Top2] peaks accumulate at nearly all dDSB sites by the time of DSB formation [...] the occupancy of Top2 increases moderately with higher transcriptional stress at (divergent and tandem) promoters, but not at convergent sites”
+
+“we tested whether gaps that result from dDSBs could account for the observed 6:2 [gene conversion] events by determining the set of dDSB fragments that fully overlap a 6:2 event as an indicator for the local probability of gap formation. The 6:2 event distribution is significantly shifted to genomic positions with higher dDSB gap probability, which indicates that dDSB gaps are enriched at full gene conversion sites and of sufficient length in both wild-type strains and rad50S mutants, as opposed to spo11Y135F mutants”
diff --git a/tags/meiosis.mdwn b/tags/meiosis.mdwn
index be28595d..9bfc0b3f 100644
--- a/tags/meiosis.mdwn
+++ b/tags/meiosis.mdwn
@@ -3,6 +3,7 @@
 _in progress_
 
  - Spo11 cleaves both DNA strands.  Double cleavage creates gaps repaired by
-   homologous recombination ([[Johnson and coll., 2021|biblio/34108687]]).
+   homologous recombination ([[Johnson and coll., 2021|biblio/34108687]]
+   and [[Prieler and coll., 2021|biblio/34108684]]).
 
 [[!inline pages="tagged(meiosis)" limit=0]]

Café
diff --git a/biblio/34146103.mdwn b/biblio/34146103.mdwn
new file mode 100644
index 00000000..de687d52
--- /dev/null
+++ b/biblio/34146103.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Tunicates illuminate the enigmatic evolution of chordate metallothioneins by gene gains and losses, independent modular expansions and functional convergences."]]
+[[!tag Oikopleura]]
+
+Calatayud S, Garcia-Risco M, Palacios Ò, Capdevila M, Cañestro C, Albalat R.
+
+Mol Biol Evol. 2021 Jun 19:msab184. doi:10.1093/molbev/msab184
+
+Tunicates illuminate the enigmatic evolution of chordate metallothioneins by gene gains and losses, independent modular expansions and functional convergences.
+
+[[!pmid 34146103 desc="Ancestral two-domain organisation found in Cephalochordates and Vertebrates.  Ascidians appear to have lost one domain and larvaceans proteins ressemble no other."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index fcddd23c..d6b9b711 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -234,6 +234,8 @@ Genes and pathways
    Tolstenkov and Glover 2019|biblio/30905687]]).
  - Piwi ([[Henriet and coll., 2015|biblio/25779047]]).
  - Metallothioneins _OdMT1_ and _OdMT2_ [[Calatayud and coll., 2018|biblio/30284576]].
+   Their cysteins are organised in a way that is not found in other branches of the
+   evolutionary tree [Calatayud and coll., 2021|biblio/34146103].
  - 2 NUMB genes were found; both are closer to Vertebrate NUMB than to Vertebrate NUMB-Like
    ([[Confalonieri and coll., 2019|biblio/31451549]]).
  - Genes related to thyroid functions (_vWFL_, _Nkx2-1_, _FoxE_, _TPO_ and _Duox_)

Café
diff --git a/biblio/34179025.mdwn b/biblio/34179025.mdwn
new file mode 100644
index 00000000..676538d4
--- /dev/null
+++ b/biblio/34179025.mdwn
@@ -0,0 +1,12 @@
+[[!meta title="Massive Gene Loss and Function Shuffling in Appendicularians Stretch the Boundaries of Chordate Wnt Family Evolution."]]
+[[!tag Oikopleura]]
+
+Martí-Solans J, Godoy-Marín H, Diaz-Gracia M, Onuma TA, Nishida H, Albalat R, Cañestro C.
+
+Front Cell Dev Biol. 2021 Jun 9;9:700827. doi:10.3389/fcell.2021.700827
+
+Massive Gene Loss and Function Shuffling in Appendicularians Stretch the Boundaries of Chordate Wnt Family Evolution.
+
+[[!pmid 34179025 desc="Localised subcellular expression in the “postplasm” during early embryogenesis.  Gene amplification by retrotranscription."]]
+
+”8 _O. dioica_ Wnts belonged to 4 Wnt subfamilies—i.e., Wnt5, Wnt10, Wnt11 (5 sequences) and Wnt16 subfamilies). The results, therefore, show that O. dioica have lost 9 Wnt subfamilies during its evolution. On the other hand, our results revealed that_ O. dioica_ has expanded the Wnt11 subfamily to at least 4 paralogs, named _Odi_Wnt11a_ to _Odi_Wnt11d_.”  “Odi_Wnt11b, Odi_Wnt11c, and Odi_Wnt11d, had no introns, pointing to the possibility of a retrotranscriptional origin during the evolution of the appendicularian lineage.”
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 4e1c5b82..fcddd23c 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -238,6 +238,9 @@ Genes and pathways
    ([[Confalonieri and coll., 2019|biblio/31451549]]).
  - Genes related to thyroid functions (_vWFL_, _Nkx2-1_, _FoxE_, _TPO_ and _Duox_)
    were studied by [[Onuma and coll., 2020|biblio/34107272]].
+ - 8 Wnt genes were found, belonging to 4 families.  Intronless _Wnt11_ genes
+   were found; they might have been created by retrotransposition
+   ([[Martí-Solans and coll., 2021|biblio/34179025]]).
 
 ### Lost
 

Café
diff --git a/biblio/34108687.mdwn b/biblio/34108687.mdwn
new file mode 100644
index 00000000..19fbc116
--- /dev/null
+++ b/biblio/34108687.mdwn
@@ -0,0 +1,20 @@
+[[!meta title="Concerted cutting by Spo11 illuminates meiotic DNA break mechanics."]]
+[[!tag meiosis repair]]
+
+Johnson D, Crawford M, Cooper T, Claeys Bouuaert C, Keeney S, Llorente B, Garcia V, Neale MJ.
+
+Concerted cutting by Spo11 illuminates meiotic DNA break mechanics.
+
+Nature. 2021 Jun;594(7864):572-576. doi:10.1038/s41586-021-03389-3
+
+[[!pmid 34108687 desc="Pairs of double strand breaks created by Spo11 causes loss of short oligonucleotides, creating a cap repaired by homologous recombination."]]
+
+“High-resolution analysis of deproteinized Spo11-oligos showed [a ladder of] periodicity of around 10 nt [that] ranges in length from around 33 nt to more than 100 nt”  “The ladder also arose in rad50S-mutant and Mre11-nuclease-defective strains of S. cerevisiae, which, like the sae2∆ mutant, cannot remove Spo11 from DSB ends. Notably, the ladder depended on the catalytic activity of Spo11”  “we refer to this ladder as hyperlocalized ‘Spo11 double cuts’ (Spo11-DCs).”
+
+“because Spo11-DCs of less than 30 nt in length are not detected on gels and are depleted from filtered Spo11-oligo libraries, we propose that adjacent Spo11 complexes that are capable of making double cuts must, in vivo, interact with DNA from the same direction, thereby generating a ladder of Spo11-DCs with periodicity dictated by the helical pitch of DNA (around 10.5 bp).”
+
+“the global frequency of Spo11-DCs was disproportionately associated with regions of stronger Spo11 activity”
+
+“Deep sequencing of meiotic progeny identifies recombination scars that are consistent with repair initiated from gaps generated by adjacent Spo11 DSBs.”
+
+“We envision a mechanism in which multiple Spo11 proteins assemble with other pro-DSB factors to create a platform that enables concerted Spo11-DSB formation”
diff --git a/tags/meiosis.mdwn b/tags/meiosis.mdwn
index 3424eba1..be28595d 100644
--- a/tags/meiosis.mdwn
+++ b/tags/meiosis.mdwn
@@ -1,4 +1,8 @@
 [[!meta title="pages tagged meiosis"]]
 
-[[!inline pages="tagged(meiosis)" actions="no" archive="yes"
-feedshow=10]]
+_in progress_
+
+ - Spo11 cleaves both DNA strands.  Double cleavage creates gaps repaired by
+   homologous recombination ([[Johnson and coll., 2021|biblio/34108687]]).
+
+[[!inline pages="tagged(meiosis)" limit=0]]

Café
diff --git a/biblio/10.1007_BF00353257.mdwn b/biblio/10.1007_BF00353257.mdwn
new file mode 100644
index 00000000..dbb900ca
--- /dev/null
+++ b/biblio/10.1007_BF00353257.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Diet of anguilloid larvae: leptocephali feed selectively on larvacean houses and fecal pellets."]]
+[[!tag Oikopleura]]
+
+Mochioka, N., Iwamizu, M.
+
+Marine Biology 125, 447–452 (1996). doi:10.1007/BF00353257
+
+Diet of anguilloid larvae: leptocephali feed selectively on larvacean houses and fecal pellets.
+
+[[!doi 10.1007/BF00353257 desc="Proposes that “that the peculiar, large, fang-like teeth of leptocephali are used for feed- ing, and evolved to pierce and grasp the mucous houses of larvaceans”.  Found houses and fecal pellets that may be from _O. longicauda_."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index befcf656..4e1c5b82 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -552,6 +552,8 @@ Ecology
  - _O. dioica_ can filter, ingest and defecate the _Emiliania huxleyi_ virus
    ([[Lawrence and coll., 2018|biblio/10.1002_lno.10734]]).  This study does not assess
    whether the viruses are digested.
+ - Houses and fecal pellets of _Oikopleura_ species are consumed by eel larvae
+   ([[Mochioka and Iwamizu, 1996|biblio/10.1007_BF00353257]]).
 
 ### Distribution in and near Japan
 

Café
diff --git a/biblio/32883756.mdwn b/biblio/32883756.mdwn
new file mode 100644
index 00000000..4fb7dd48
--- /dev/null
+++ b/biblio/32883756.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="The Beginning of the End: A Chromosomal Assembly of the New World Malaria Mosquito Ends with a Novel Telomere. G3 (Bethesda)."]]
+[[!tag mosquito genome]]
+
+Compton A, Liang J, Chen C, Lukyanchikova V, Qi Y, Potters M, Settlage R, Miller D, Deschamps S, Mao C, Llaca V, Sharakhov IV, Tu Z.
+
+G3 (Bethesda). 2020 Oct 5;10(10):3811-3819. doi:10.1534/g3.120.401654
+
+The Beginning of the End: A Chromosomal Assembly of the New World Malaria Mosquito Ends with a Novel Telomere. G3 (Bethesda).
+
+[[!pmid 32883756 desc="Little interactions between chromosome arms."]]
diff --git a/tags/mosquito.mdwn b/tags/mosquito.mdwn
index 54da32e1..0354e7f3 100644
--- a/tags/mosquito.mdwn
+++ b/tags/mosquito.mdwn
@@ -1,4 +1,11 @@
 [[!meta title="pages tagged mosquito"]]
 
-[[!inline pages="tagged(mosquito)" actions="no" archive="yes"
-feedshow=10]]
+_work in progress_
+
+### Hi-C
+
+Little interactions between chromosome arms in _Aedes aegypti_
+([[Dudchenko and coll., 2017|biblio/28336562]]) and _Anopheles
+albimanus_ ([[Copmton and coll., 2020|biblio/32883756]]).
+
+[[!inline pages="tagged(mosquito)" limit=0]]
diff --git a/tags/muller_element.mdwn b/tags/muller_element.mdwn
index dad30cae..2aec4611 100644
--- a/tags/muller_element.mdwn
+++ b/tags/muller_element.mdwn
@@ -9,8 +9,9 @@ Synteny conservation is even visible between fruit flies and cockroaches
 
 Hi-C shows contacts between telomeres and between centromeres in mosquito
 species, and few contacts between both arms of the same chromosome ([[Dudchenko
-and coll., 2017|biblio/28336562]]).  Note that the chromosomes of Aedes aegypti
-are significantly larger than what is usually found in Drosophila.
+and coll., 2017|biblio/28336562]]; [[Copmton and coll., 2020|biblio/32883756]]).
+Note that the chromosomes of _Aedes aegypti_
+are significantly larger than what is usually found in _Drosophila_.
 
 _D. bifasciata_ (and other Drosophila) have large and highly repetitive
 pericentric regions [[Bracewell and coll., 2020|biblio/31969429]].

Avec du vin
diff --git a/biblio/34099548.mdwn b/biblio/34099548.mdwn
new file mode 100644
index 00000000..ea8bcc35
--- /dev/null
+++ b/biblio/34099548.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Accurate genomic variant detection in single cells with primary template-directed amplification."]]
+[[!tag amplification method]]
+
+Gonzalez-Pena V, Natarajan S, Xia Y, Klein D, Carter R, Pang Y, Shaner B, Annu K, Putnam D, Chen W, Connelly J, Pruett-Miller S, Chen X, Easton J, Gawad C.
+
+Proc Natl Acad Sci U S A. 2021 Jun 15;118(24):e2024176118. doi:10.1073/pnas.2024176118
+
+Accurate genomic variant detection in single cells with primary template-directed amplification.
+
+[[!pmid 34099548 desc="“primary template-directed amplification (PTA) [...] takes advantage of the processivity, strong strand displacement activity, and low error rate of phi29 polymerase [...] exonuclease-resistant terminators are incorporated into the reaction, creating smaller double-stranded amplification products that undergo limited subsequent amplification. This transforms the reaction from exponential into a quasilinear process with more of the amplification occurring from the primary template.”"]]
diff --git a/tags/amplification.mdwn b/tags/amplification.mdwn
index 798fcbaf..7c8520fe 100644
--- a/tags/amplification.mdwn
+++ b/tags/amplification.mdwn
@@ -18,4 +18,9 @@ concentration and annealing temperature) were investigated by [[Dai and coll.,
 complex sample, relatively long ITR (compared to primer length), high
 [annealing temperature], and high concentration of primer should be used.”.
 
+## Other methods
+
+ - Primary Template-directed Amplification (PTA), a kind of MDA with terminators
+   to limit the size of intermediate amplicaons [[Gonzalez-Pena and coll., 2021|biblio/34099548]]
+
 [[!inline pages="tagged(amplification)" limit=0]]

Oik
diff --git a/biblio/10.1007_s00343-020-0071-0.mdwn b/biblio/10.1007_s00343-020-0071-0.mdwn
new file mode 100644
index 00000000..4ab803e3
--- /dev/null
+++ b/biblio/10.1007_s00343-020-0071-0.mdwn
@@ -0,0 +1,26 @@
+[[!meta title="Role of intraspecific competition in intrinsic growth rate regulation in an Oikopleura dioica (Tunicata) population"]]
+[[!tag Oikopleura]]
+
+Li, S., Zhang, G.
+
+J. Ocean. Limnol. 39, 609–622 (2021). doi:10.1007/s00343-020-0071-0
+
+Role of intraspecific competition in intrinsic growth rate regulation in an _Oikopleura dioica_ (Tunicata) population.
+
+[[!doi 10.1007/s00343-020-0071-0 desc="_O. dioica_ found in Jiaozhou Bay, Qingdao, China and cultured at 18 °C.  Generation time of 4.5 days.  Largest animals tend to appear with low density of individuals and large amounts of food."]]
+
+“Individuals of Oikopleura dioica (Tunicata, Appendicularia) were collected in the Jiaozhou Bay, Qingdao, China (35°03′N, 120°20′E) on June 20, 2017, using a plankton net with a large-volume cod-end (10L). The samples were diluted into 50 L buckets and transported immediately to the laboratory, where healthy individuals were sorted and cultured in a small room (approximately 10 m2) maintained at 18 ± 1°C using a standard air conditioner.”
+
+“parental animals were forced to release their gametes by gentle aspiration in a pipette.  Then, all dishes were placed in a speed-regulating vibrator (HY-4H) rotating at 60 r/min for 5 min to mix the eggs and male gametes together, and this time was considered time zero (D0).”
+
+“To control the food concentration, a mono-diet of Isochrysis galbana was adopted for all treatments.”
+
+“From gamete production, the entire incubation duration was 4 d and 12 h.”
+
+“The body length of O. dioica was 145 ± 17 μm on average after 15 h of metamorphosis.”  “ On average, body lengths of 324–549 μm were achieved at the end of the experiments.”  “At each food level, both the final body and gonad length decreased on average with density.”
+
+“Calculated with a fixed generation duration of 4.5 d, the mean maximal intrinsic rate of natural increase (rmax) varied between 0.25 and 0.65/d”
+
+“In general, the population growth was significantly regulated by the PFS. The rmax was increased with the PFS and was saturated at values higher than 8.1 μg C/ind.”
+
+“Though the mortality recorded in our experiments was generally higher at low food concentrations, it is uncertain whether mortality increased with increased competition stress.”
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 86c71c2c..befcf656 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -368,6 +368,8 @@ Development
    eventually pause.  Animals in GA can survive ~18 days at 15°C.  GA can also be
    induced by inhibiting the TOR pathway ([[Subramaniam, Campsteijn and Thompson,
    2014|biblio/24695788]]).
+ - Large animals (~5 mm body length) could be cultivated when provided with large
+   amounts of food ([[Li and Zhang, 2021|biblio/10.1007_s00343-020-0071-0]]).
  - Telomeres are localised at the nuclear envelope and do not overlap with nuclear
    pore complexes in early meiotic oocytes before H3S10 phosphorylation.  In nurse
    cells at a later stage of oocyte development, the telomeres localise in silent
@@ -587,6 +589,8 @@ Ecology
  - In the northern south China sea, _O. longicauda_ and _O. rufescens_ were
    reported to be more abundant than _O. dioica_ in 2006 by ([[Li and coll.,
    2012|biblio/10.1007_s13131-012-0243-7]]).
+ - _O. dioica_ captured in 2017 from Jiaozhou Bay, Qingdao, China (35°03′N, 120°20′E)
+    could be cultivated at 18 °C ([[Li and Zhang, 2021|biblio/10.1007_s00343-020-0071-0]]).
  - _O. dioica_ and _O. longicauda_ were found throurought 2006-2007 in the Yellow sea
    ([[Franco, Chen and Li, 2014|biblio/10.1007_s11802-014-2376-0]]).  Abundance peaked
    is spring, but the animals could also be found in winter when water temperature

Accession numbers, typos, ...
diff --git a/tags/Ciona.mdwn b/tags/Ciona.mdwn
index 25dd9e73..f8d5002c 100644
--- a/tags/Ciona.mdwn
+++ b/tags/Ciona.mdwn
@@ -20,7 +20,7 @@ during the Pliocene (≈ 3.8 Ma); a recent introgression then happened 15,000
 years ago ([[Roux and coll., 2013|biblio/23564941]]).
 
 The _C. intermedia_ species was described by [[Mastrototaro and coll.,
-2021|biblio/10.1093_zoolinnean_zlaa042]].  It is sister to _C. edwardsi_
+2020|biblio/10.1093_zoolinnean_zlaa042]].  It is sister to _C. edwardsi_
 but their placement regarding to _C. int_ and _robusta_ varies in
 different computations presented in that work.
 
@@ -64,8 +64,9 @@ with respcet to _C. roulei_ ([[Nydam and Harrison, 2010|biblio/20403444]]).
 
 ## Genomes
 
- - _Ciona robusta_ latest genome: version HT ([[Satou and coll.,
-   2019|biblio/31621849]]) is a reassembly of the KS genome using Hi-C and
+ - _Ciona robusta_ latest genome: version HT
+   [GCA_009617815](https://www.ncbi.nlm.nih.gov/assembly/GCA_009617815.1/)
+   ([[Satou and coll., 2019|biblio/31621849]]) is a reassembly of the KS genome using Hi-C and
    PacBio additional data, in which over 95 % of the dequences is included in
    chromosomes.  Out of 14 pairs of chromosomes, 10 are metacentric ([[Shoguchi
    and coll., 2005|biblio/15930823]]); the Hi-C contact map suggests that their
@@ -73,7 +74,9 @@ with respcet to _C. roulei_ ([[Nydam and Harrison, 2010|biblio/20403444]]).
    Inter-chromosomal contacts are much more rare in comparison.
 
  - _Ciona intestinalis_: chromosome-level assemblies of two individuals
-   ([[Satou and coll., 2021|biblio/]]) suggests that there are ~20 inversions
+   [GCA_018327805](https://www.ncbi.nlm.nih.gov/assembly/GCA_018327805.1)
+   [GCA_018327825](https://www.ncbi.nlm.nih.gov/assembly/GCA_018327825.1)
+   ([[Satou and coll., 2021|biblio/33822040]]) suggests that there are ~20 inversions
    (containing at least 3 genes) between the two species.  Some of them are
    not fixed.
 

Nouveau tag taxononmie
diff --git a/tags/taxonomy.mdwn b/tags/taxonomy.mdwn
index 71e4c475..8d9f3bd2 100644
--- a/tags/taxonomy.mdwn
+++ b/tags/taxonomy.mdwn
@@ -1,4 +1,7 @@
 [[!meta title="pages tagged taxonomy"]]
 
-[[!inline pages="tagged(taxonomy)" actions="no" archive="yes"
-feedshow=10]]
+_work in progress_
+
+ - _Ciona intermedia_: [[Mastrototaro and coll., 2021|biblio/10.1093_zoolinnean_zlaa042]]
+
+[[!inline pages="tagged(taxonomy)" limit=0]]