Dernières modifications :

Café
diff --git a/biblio/35449136.mdwn b/biblio/35449136.mdwn
new file mode 100644
index 00000000..8402741f
--- /dev/null
+++ b/biblio/35449136.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Emergence of novel cephalopod gene regulation and expression through large-scale genome reorganization."]]
+[[!tag genome synteny]]
+
+Emergence of novel cephalopod gene regulation and expression through large-scale genome reorganization.
+
+Nat Commun. 2022 Apr 21;13(1):2172. doi:10.1038/s41467-022-29694-7
+
+Schmidbaur H, Kawaguchi A, Clarence T, Fu X, Hoang OP, Zimmermann B, Ritschard EA, Weissenbacher A, Foster JS, Nyholm SV, Bates PA, Albertin CB, Tanaka E, Simakov O.
+
+[[!pmid 35449136 desc="Defines “microsyntenic blocks as at least three or more co-occurring orthologous genes with up to five intervening genes with no constraints on their collinearity”. Found 505 microsyntenies unique to cephalopods and 275 unique to metazooans.  “Genes in cephalopod-specific microsyntenies do not tend to be co-expressed, despite their tight co-localization”  “In contrast [to cephalopod-specific microsyntenies], conserved metazoan microsyntenies show significant (Wilcoxon test, p ≤ 0.001) co-expression when compared to simulated microsyntenies”"]]

Café
diff --git a/biblio/35508532.mdwn b/biblio/35508532.mdwn
new file mode 100644
index 00000000..c8a376c9
--- /dev/null
+++ b/biblio/35508532.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Genome and transcriptome mechanisms driving cephalopod evolution."]]
+[[!tag genome synteny]]
+
+Albertin CB, Medina-Ruiz S, Mitros T, Schmidbaur H, Sanchez G, Wang ZY, Grimwood J, Rosenthal JJC, Ragsdale CW, Simakov O, Rokhsar DS.
+
+Nat Commun. 2022 May 4;13(1):2427. doi:10.1038/s41467-022-29748-w
+
+Genome and transcriptome mechanisms driving cephalopod evolution.
+
+[[!pmid 35508532 desc="Most chromosomes of _Doryteuthis pealeii_ have a direct counterpart in _Euprymna scolopes_ and retained visible synteny with the scallop Mizuhopecten yessoensis_.  In both cases, the gene order in syntenic regions is considerably scrambled."]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index a073079e..2b5aa969 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -51,6 +51,9 @@ but not other fungi such as yeast, “genes are conserved within homologous
 chromosomes, but with randomized orders and orientations“ and call that
 phenomenon “mesosynteny”.
 
+Squid chromosomes still have synteny with scallop, but gene order is scrambled
+([[Albertin and coll., 2022|biblio/35508532]]).
+
 ### Ancestral karyotpyes
 
  - The ancestral mammalian genome has 30 chromosomes ([[Zhou and coll., 2021|biblio/33408411]]).

Now in PubMed.
diff --git a/biblio/10.1101_2020.12.23.423594.mdwn b/biblio/33752599.mdwn
similarity index 94%
rename from biblio/10.1101_2020.12.23.423594.mdwn
rename to biblio/33752599.mdwn
index 77093509..88029aa7 100644
--- a/biblio/10.1101_2020.12.23.423594.mdwn
+++ b/biblio/33752599.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="SLIDR and SLOPPR: Flexible identification of spliced leader trans-splicing and prediction of eukaryotic operons from RNA-Seq data"]]
-[[!tag Oikopleura bioRxiv]]
+[[!tag Oikopleura trans-splicing]]
 
 Marius Wenzel, Berndt Mueller, Jonathan Pettitt
 
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index f30ea46a..b64a39a4 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -319,7 +319,7 @@ Transcriptome
    The SL gene is found downstream of the 5S RNA gene, which is repeated multiple
    times in the genome.  The 3′ acceptor site has a strong UUU(C/U/A)AG consensus.
    Reported intercistronic regions are short: <30 nt ([[Ganot et al., 2004|biblio/15314184]])
-   or ~33 nt ([[Wenzel, Mueller and Pettitt, 2020|biblio/10.1101_2020.12.23.423594]]).
+   or ~33 nt ([[Wenzel, Mueller and Pettitt, 2020|biblio/33752599]]).
  - The splice leader found in the Norwegian strain by ([[Ganot et al., 2004|biblio/15314184]])
    was found indentical in a Japanese strain by ([[Wang and coll., 2015|biblio/26032664]]).
  - A study using CAGE found that 39% of annotated gene models are trans-spliced with the

Trans-splicing.
diff --git a/tags/trans-splicing.mdwn b/tags/trans-splicing.mdwn
index 0a750e29..5cfd6dad 100644
--- a/tags/trans-splicing.mdwn
+++ b/tags/trans-splicing.mdwn
@@ -5,10 +5,14 @@ to be possible in COS cells and HeLa cell extracts by [[Bruzik and Maniatis, 199
 
 Trans-splicing was discovered in tunicates by [[Vandenberghe, Meedel and Hastings, 2001|biblio/11159910]].
 
-The splice leader is 16-nt in C. intestinalis ([[Satou et al, 2006|biblio/16822859]]) and 40-nt in O. dioica ([[Ganot et al., 2004|biblio/15314184]]).
-
 A splice leader was found in the endosymbiotic amoeba _Paulinella
 chromatophora_ by [[Nowack and coll, 2016|biblio/27791007]], and characterised
 by [[Matsuo and coll., 2018|biblio/30024971]].
 
+The splice leader is 16-nt in C. intestinalis ([[Satou et al,
+2006|biblio/16822859]]) and 40-nt in O. dioica ([[Ganot et al.,
+2004|biblio/15314184]]).  The trans-splicing acceptor consensus site in _O.
+dioica_ is `TTT(C/T/A)AGA`, which is the same as the cis-splicing acceptor
+with an extra `A` at the end.
+
 [[!inline pages="tagged(trans-splicing)" actions="no" limit=0]]

Polyadenylation signal.
diff --git a/biblio/15314184.mdwn b/biblio/15314184.mdwn
index cb28db59..8785436b 100644
--- a/biblio/15314184.mdwn
+++ b/biblio/15314184.mdwn
@@ -7,4 +7,4 @@ Mol Cell Biol. 2004 Sep;24(17):7795-805. doi:10.1128/MCB.24.17.7795-7805.2004
 
 Spliced-Leader RNA trans Splicing in a Chordate, Oikopleura dioica, with a Compact Genome.
 
-[[!pmid 15314184 desc="5′ splice leader (SL) found in 90/158 ESTs containing a start codon.  The SL RNA is found downstream of the 5S RNA in at least 40 occurences, and aproximately 2/3 of all the 5S rRNA genes.  Its sequence is ACTCATCCCATTTTTGAGTCCGATTTCGATTGTCTAACAG. O. doica is the first chordate where gene operons have been described.  Intercistronic regions are very short (<30 nt).  “In comparing 52 distinct trans-splice acceptor sites to 605 cis-splice acceptor sites, the same consensus sequence, TTT(C/T/A)AG, was observed at both intron and intercistronic region 3′ ends. A notable difference from cis splicing was that most exons trans spliced to the leader (133 of 145) started with an adenosine, whereas the start of cis-spliced exons did not show any nucleotide preference”"]]
+[[!pmid 15314184 desc="5′ splice leader (SL) found in 90/158 ESTs containing a start codon.  The SL RNA is found downstream of the 5S RNA in at least 40 occurences, and aproximately 2/3 of all the 5S rRNA genes.  Its sequence is `ACTCATCCCATTTTTGAGTCCGATTTCGATTGTCTAACAG`. O. doica is the first chordate where gene operons have been described.  Intercistronic regions are very short (<30 nt).  “In comparing 52 distinct trans-splice acceptor sites to 605 cis-splice acceptor sites, the same consensus sequence, `TTT(C/T/A)AG`, was observed at both intron and intercistronic region 3′ ends. A notable difference from cis splicing was that most exons trans spliced to the leader (133 of 145) started with an adenosine, whereas the start of cis-spliced exons did not show any nucleotide preference.”  In the cycD operon, only the last gene (cycD) has a `AAUAAA` polyadenylation signal."]]

Trans-splicing consensus site.
diff --git a/biblio/15314184.mdwn b/biblio/15314184.mdwn
index 7d63dcd1..cb28db59 100644
--- a/biblio/15314184.mdwn
+++ b/biblio/15314184.mdwn
@@ -7,4 +7,4 @@ Mol Cell Biol. 2004 Sep;24(17):7795-805. doi:10.1128/MCB.24.17.7795-7805.2004
 
 Spliced-Leader RNA trans Splicing in a Chordate, Oikopleura dioica, with a Compact Genome.
 
-[[!pmid 15314184 desc="5′ splice leader (SL) found in 90/158 ESTs containing a start codon.  The SL RNA is found downstream of the 5S RNA in at least 40 occurences, and aproximately 2/3 of all the 5S rRNA genes.  Its sequence is ACTCATCCCATTTTTGAGTCCGATTTCGATTGTCTAACAG. O. doica is the first chordate where gene operons have been described.  Intercistronic regions are very short (<30 nt)."]]
+[[!pmid 15314184 desc="5′ splice leader (SL) found in 90/158 ESTs containing a start codon.  The SL RNA is found downstream of the 5S RNA in at least 40 occurences, and aproximately 2/3 of all the 5S rRNA genes.  Its sequence is ACTCATCCCATTTTTGAGTCCGATTTCGATTGTCTAACAG. O. doica is the first chordate where gene operons have been described.  Intercistronic regions are very short (<30 nt).  “In comparing 52 distinct trans-splice acceptor sites to 605 cis-splice acceptor sites, the same consensus sequence, TTT(C/T/A)AG, was observed at both intron and intercistronic region 3′ ends. A notable difference from cis splicing was that most exons trans spliced to the leader (133 of 145) started with an adenosine, whereas the start of cis-spliced exons did not show any nucleotide preference”"]]

Remove the 'operon' tag in favor of the 'trans-splicing' tag.
diff --git a/biblio/15314184.mdwn b/biblio/15314184.mdwn
index f03ae638..7d63dcd1 100644
--- a/biblio/15314184.mdwn
+++ b/biblio/15314184.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Spliced-Leader RNA trans Splicing in a Chordate, Oikopleura dioica, with a Compact Genome."]]
-[[!tag trans-splicing Oikopleura operon]]
+[[!tag trans-splicing Oikopleura]]
 
 Ganot P, Kallesøe T, Reinhardt R, Chourrout D, Thompson EM.
 
diff --git a/tags/operon.mdwn b/tags/operon.mdwn
deleted file mode 100644
index cbea2bd3..00000000
--- a/tags/operon.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged operon"]]
-
-[[!inline pages="tagged(operon)" actions="no" archive="yes"
-feedshow=10]]

Café
diff --git a/biblio/15826240.mdwn b/biblio/15826240.mdwn
new file mode 100644
index 00000000..79730ecb
--- /dev/null
+++ b/biblio/15826240.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="The caspase family in urochordates: distinct evolutionary fates in ascidians and larvaceans."]]
+[[!tag Oikopleura]]
+
+Weill M, Philips A, Chourrout D, Fort P.
+
+Biol Cell. 2005 Nov;97(11):857-66. doi:10.1042/BC20050018
+
+The caspase family in urochordates: distinct evolutionary fates in ascidians and larvaceans.
+
+[[!pmid 15826240 desc="_O. dioica_ has three caspases, all related to the CSP3/7 family."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 4d10951f..f30ea46a 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -294,6 +294,7 @@ Genes and pathways
    [[Ferrández-Roldán and coll., 2021|biblio/34789899]]).
  - None of the genes encoding Bcl-2 proteins or their BH3-only ligands could be found
    in _O. dioica_ [[Suraweera and coll., 2022|biblio/35409052]].
+ - Three caspases related to the CSP3/7 family were found by [[Weil and coll, 2005|biblio/15826240]].
 
 Epigenome
 ---------
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 2b6a156f..a073079e 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -31,6 +31,9 @@ of 90 rearrangements per MY (_mel_ / _simulans_) and 226–354 per MY (_sim_ / _
 In insects, the Osiris gene family shows conservation of synteny over ~400
 million years ([[Sah and coll., 2012|biblio/22384409]]).
 
+Butterfly chromosome still have synteny with Muller elements ([[Ranz and coll,
+2022|biblio/35042416]]).
+
 The indian munjac has only 3 chromosomes, which are the result of fusions in
 the past ~5 My.  The chinese munjak has undergone much less fusions.  In most
 cases, long-range chromosome structure (Hi-C) is not conserved between theses

alamaison
diff --git a/biblio/35422045.mdwn b/biblio/35422045.mdwn
new file mode 100644
index 00000000..20bd0f45
--- /dev/null
+++ b/biblio/35422045.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Chromosome evolution and the genetic basis of agronomically important traits in greater yam."]]
+[[!tag chromosome repeat centromere]]
+
+Bredeson JV, Lyons JB, Oniyinde IO, Okereke NR, Kolade O, Nnabue I, Nwadili CO, Hřibová E, Parker M, Nwogha J, Shu S, Carlson J, Kariba R, Muthemba S, Knop K, Barton GJ, Sherwood AV, Lopez-Montes A, Asiedu R, Jamnadass R, Muchugi A, Goodstein D, Egesi CN, Featherston J, Asfaw A, Simpson GG, Doležel J, Hendre PS, Van Deynze A, Kumar PL, Obidiegwu JE, Bhattacharjee R, Rokhsar DS.
+
+Nat Commun. 2022 Apr 14;13(1):2001. doi:10.1038/s41467-022-29114-w
+
+Chromosome evolution and the genetic basis of agronomically important traits in greater yam.
+
+[[!pmid 35422045 desc="Very broad peri-centromeric regions containg mostly repeats and confining the genes in the subtelomeric regions."]]

alamaison
diff --git a/tags/centromere.mdwn b/tags/centromere.mdwn
index b1444e75..d5500840 100644
--- a/tags/centromere.mdwn
+++ b/tags/centromere.mdwn
@@ -8,6 +8,8 @@ _Work in progress_
    centromeres ([[Melters and coll., 2013|biblio/23363705]]).
  - In the three-spine stickleback, the centromere sequence of chrX differs from
    the one of chrY ([[Peichel and coll., 2020|biblio/32684159]]).
+ - The pericentromeric regions of _Dioscorea alata_ can comprise most of the
+   chromosome length [[Bredeson and coll., 2022|biblio/35422045]].
 
 ## Visualisation
 

apoptosis
diff --git a/biblio/35409052.mdwn b/biblio/35409052.mdwn
new file mode 100644
index 00000000..f9e738ab
--- /dev/null
+++ b/biblio/35409052.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Metazoans and Intrinsic Apoptosis: An Evolutionary Analysis of the Bcl-2 Family."]]
+[[!tag Oikopleura]]
+
+Suraweera CD, Banjara S, Hinds MG, Kvansakul M.
+
+Int J Mol Sci. 2022 Mar 28;23(7):3691. doi:10.3390/ijms23073691
+
+Metazoans and Intrinsic Apoptosis: An Evolutionary Analysis of the Bcl-2 Family.
+
+[[!pmid 35409052 desc="_Oikopleura dioica_ has lost all the Bcl-2 genes as well as their BH3-only ligands."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 268eb633..4d10951f 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -292,6 +292,8 @@ Genes and pathways
    [[Kienle, Kloepper and Fasshauer, 2016|biblio/27756227]]).
  - _Mesp_, _Ets1/2b_, _Gata4/5/6_, _Mek1/2_,  _Hand-r_ and _Tbx1/10_ (heart development,
    [[Ferrández-Roldán and coll., 2021|biblio/34789899]]).
+ - None of the genes encoding Bcl-2 proteins or their BH3-only ligands could be found
+   in _O. dioica_ [[Suraweera and coll., 2022|biblio/35409052]].
 
 Epigenome
 ---------

Corrections
diff --git a/tags/LAST.mdwn b/tags/LAST.mdwn
index 8157f372..8a7d8a81 100644
--- a/tags/LAST.mdwn
+++ b/tags/LAST.mdwn
@@ -5,7 +5,7 @@ _bibliography in progress..._
  - Whole-genome alignments with reversed sequences as negative controls showed
    that e-value filtering is not enough to remove spurious alignments of tandem
    repeat which therefore need to be masked ([[Frith MC, Hamada M and Horton P.,
-   2011|bilbio/20144198]]).
+   2011|biblio/20144198]]).
 
  - `lastdb` can use various seeding schemes to build its index.  [[Frith and
    Noé (2014)|biblio/24493737]] discuss some of them.  The `RY` seeds are made
@@ -33,7 +33,7 @@ _bibliography in progress..._
    of expansion of tandem repeats, after alignment with `last-split`.
 
  - LAST can align DNA sequences to protein databases using a 64 x 21 substitution
-   matrix [[Yao and Frith, 2020|biblio/10.1101_2021.01.25.428050]].
+   matrix [[Yao and Frith, 2020|biblio/10.1007_978-3-030-74432-8_11]].
 
  - JRA (Joint Read Alignment) uses LAST [[Shrestha and coll., 2018|biblio/29182778]].
 

Café
diff --git a/biblio/20144198.mdwn b/biblio/20144198.mdwn
new file mode 100644
index 00000000..30d63bb9
--- /dev/null
+++ b/biblio/20144198.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Parameters for accurate genome alignment."]]
+[[!tag LAST genome alignment]]
+
+Frith MC, Hamada M, Horton P.
+
+BMC Bioinformatics. 2010 Feb 9;11:80. doi: 10.1186/1471-2105-11-80
+
+Parameters for accurate genome alignment.
+
+[[!pmid 20144198 desc="Aligned genomes after reversing (not reverse-complementing) them as a negative controls.  In these comparisons, all alignments are spurious.  A large number of spurious alignments were found, and this could be reduced by masking tandem repeats.  Spuriously alignments in tandem repeats get abnormally high scores. “Bad” scoring matrices tend to extend alignments with spurious low-quality arms.  The X-drop parameter prevents the aligner from extending alignments too far, but high X-drop values can cause small alignments to be discarded by some software because the score becomes negative."]]
diff --git a/tags/LAST.mdwn b/tags/LAST.mdwn
index f8ec88ea..8157f372 100644
--- a/tags/LAST.mdwn
+++ b/tags/LAST.mdwn
@@ -2,6 +2,11 @@
 
 _bibliography in progress..._
 
+ - Whole-genome alignments with reversed sequences as negative controls showed
+   that e-value filtering is not enough to remove spurious alignments of tandem
+   repeat which therefore need to be masked ([[Frith MC, Hamada M and Horton P.,
+   2011|bilbio/20144198]]).
+
  - `lastdb` can use various seeding schemes to build its index.  [[Frith and
    Noé (2014)|biblio/24493737]] discuss some of them.  The `RY` seeds are made
    of non-overlapping words using the two-letter alphabet `R` = `A|G`, `Y` =

creating tag page tags/damage
diff --git a/tags/damage.mdwn b/tags/damage.mdwn
new file mode 100644
index 00000000..e81411aa
--- /dev/null
+++ b/tags/damage.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged damage"]]
+
+[[!inline pages="tagged(damage)" actions="no" archive="yes"
+feedshow=10]]

Café
diff --git a/biblio/26052046.mdwn b/biblio/26052046.mdwn
new file mode 100644
index 00000000..cc175e38
--- /dev/null
+++ b/biblio/26052046.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Activity-Induced DNA Breaks Govern the Expression of Neuronal Early-Response Genes."]]
+[[!tag neuron damage expression]]
+
+Cell. 2015 Jun 18;161(7):1592-605. doi:10.1016/j.cell.2015.05.032
+
+Madabhushi R, Gao F, Pfenning AR, Pan L, Yamakawa S, Seo J, Rueda R, Phan TX, Yamakawa H, Pao PC, Stott RT, Gjoneska E, Nott A, Cho S, Kellis M, Tsai LH.
+
+Activity-Induced DNA Breaks Govern the Expression of Neuronal Early-Response Genes. 
+
+[[!pmid 26052046 desc="Double-strand breaks (DSBs) caused by the topoisomerase inhibitor etoposide induces early-response genes in neurons.  The radiomimetic drugs neocarzinostatin and bleomycin, and the PARP inhibitor Olaparib did cause induction.  Inhibition of DSB signalling with the ATM (ataxia telangiectasia mutated) inhibitor KU55933 did not suppress the induction.  Knockdown of topoisomerase IIβ suppressed the induction.  CRISPR-Cas9 DNA cleavage micmicked and rescued the induction.  Topoisomerase IIβ and the breaks are enriched near CTCF binding sites.  Tyrosyl DNA phosphodiesterase 2 (TDP2) is also enriched at the promoter of immediate early genes."]]

Black sea
diff --git a/biblio/10.1017_S0025315405011410.mdwn b/biblio/10.1017_S0025315405011410.mdwn
new file mode 100644
index 00000000..78fcf8a9
--- /dev/null
+++ b/biblio/10.1017_S0025315405011410.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Changes in appendicularian Oikopleura dioica abundance caused by invasion of alien ctenophores in the Black Sea"]]
+[[!tag Oikopleura]]
+
+Shiganova, T. (2005).
+
+Journal of the Marine Biological Association of the United Kingdom, 85(3), 477-494. doi:10.1017/S0025315405011410
+
+Changes in appendicularian Oikopleura dioica abundance caused by invasion of alien ctenophores in the Black Sea.
+
+[[!doi 10.1017/S0025315405011410 desc="Comparison of _O. dioica_ populations before and after invasion of the ctenophores _Mnemiopsis leidyi_ and _Beroe ovata_.  In 1957, _O. dioica_ peaked in May in the Western Black sea.  In 1979 in peaked from June to November near Sevastopol.  In 1969 there was one peak in May–June and one in August.  In 1991–6, abundance of _O. dioica_ was strongly reduced while _M. leidyi_ was proliferating.  In 1999 and following years, after _B. ovata_ invastion, _M leidyi_ populations were strongly reduced and _O. dioica_ abundance returned to high levels."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 1e8bc757..268eb633 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -587,6 +587,10 @@ Ecology
    whether the viruses are digested.
  - Houses and fecal pellets of _Oikopleura_ species are consumed by eel larvae
    ([[Mochioka and Iwamizu, 1996|biblio/10.1007_BF00353257]]).
+ - In the Black Sea, invasion of _O. dioica's predator_ _Mnemiopsis leidyi_ (a
+   ctenophore) decimated its population, which was restored to higher levels by the
+   subsequent invasion of the predator's predator _Beroe ovata_. [[Shiganova,
+   2005|biblio/10.1017_S0025315405011410]].
 
 ### Distribution in and near Japan
 
@@ -670,7 +674,8 @@ Ecology
    ([[Berry and coll., 2019|biblio/30735490]])
  - TARA Oceans ([[Vorobev and coll., 2020|biblio/32205368]]),
    [[Delmont and coll., biblio/10.1101_2020.10.15.341214v2]].
- - In the southern Black sea in 2006–2007 ([[Üstün, Bat and Besiktepe, 2016|biblio/PG_0485]]).
+ - In the southern Black sea in 2006–2007 ([[Üstün, Bat and Besiktepe, 2016|biblio/PG_0485]])
+   and in the northern Black sea ([[Shiganova 2005|biblio/10.1017_S0025315405011410]].
 
 ### In the past:
 

Café
diff --git a/biblio/18339653.mdwn b/biblio/18339653.mdwn
new file mode 100644
index 00000000..ca534d93
--- /dev/null
+++ b/biblio/18339653.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Altered miRNA repertoire in the simplified chordate, Oikopleura dioica."]]
+[[!tag Oikopleura miRNA]]
+
+Altered miRNA repertoire in the simplified chordate, _Oikopleura dioica_.
+
+Mol Biol Evol. 2008 Jun;25(6):1067-80. doi:10.1093/molbev/msn060
+
+Fu X, Adamski M, Thompson EM.
+
+[[!pmid desc="miRNA array spotted on N+ membranes.  Confirms the existence of Drosha, DGCR8, Dicer, and 3 AGO proteins. “Five compact clusters containing 15 miRNAs were identified, and the distance between adjacent members was systematically less than 100 bp.” 36% of the miRNAs were long of 22 nucleotides.  “many O. dioica miRNAs were found to be located in the antisense orientation of a protein-coding gene, often opposite the sense strand of an intron.”  “let-7a [...] was not detected during embryogenesis but was observed in the postmetamorphic oikoplastic epithelium.”"]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index a76d2bf7..1e8bc757 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -253,6 +253,8 @@ Genes and pathways
    were found; they might have been created by retrotransposition
    ([[Martí-Solans and coll., 2021|biblio/34179025]]).
  - _Nk4_, _Hand1/2_ and _FoxF_ (heart development, [[Ferrández-Roldán and coll., 2021|biblio/34789899]]).
+ - _O. dioica_ has the miRNA machinery and some miRNAs such as _let-7a_ were detected.  36 % of
+   the miRNAs had a length of 22 nt in [[Fu, Adamski and Thompson, 2008|biblio/18339653]].
 
 ### Lost
 

Café
diff --git a/biblio/31311886.mdwn b/biblio/31311886.mdwn
new file mode 100644
index 00000000..16fd4fef
--- /dev/null
+++ b/biblio/31311886.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Causes and Effects of Loss of Classical Nonhomologous End Joining Pathway in Parasitic Eukaryotes."]]
+[[!tag review repair Oikopleura]]
+
+Nenarokova A, Záhonová K, Krasilnikova M, Gahura O, McCulloch R, Zíková A, Yurchenko V, Lukeš J.
+
+mBio. 2019 Jul 16;10(4):e01541-19. doi:10.1128/mBio.01541-19
+
+Causes and Effects of Loss of Classical Nonhomologous End Joining Pathway in Parasitic Eukaryotes.
+
+[[!pmid 31311886 desc="Reviews possible advantages of losing the C-NHEJ pathway, such as reduction of transposon movement, reduction of genome size and change of genome structure, and insertion of short new sequence in proteins.  Focus on parasites but some facts about Oikopleura are highlighted for comparison purposes."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 3ef6ee5b..a76d2bf7 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -270,6 +270,8 @@ Genes and pathways
    conserved from yeast to mammals) is undetectable ([[Denoeud et al., 2010|biblio/21097902]]).
    An alternative or microhomology (MH)-driven end joining pathway is active
    and triggers microdeletions at the joining site ([[Deng, Henriet and Chourrout, 2018|biblio/30293719]]).
+   Loss of C-NHEJ is often associated with parasitism, which is not the case in
+   _Oikopleura_ (review in [[Nenarokova and coll., 2019|biblio/31311886]]).
  - In line with the above, “There is no H2AX homolog in O. dioica.” (H2AX is
    implicated in DNA repair).  [[Moosmann and coll., 2011|biblio/21756361]]
  - The minor spliceosome could not be found in _Oikopleura_'s genome ([[Marz

updated PO files
diff --git a/Joules.en.po b/Joules.en.po
index b75dae18..bc02163d 100644
--- a/Joules.en.po
+++ b/Joules.en.po
@@ -7,7 +7,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2022-03-03 12:24+0000\n"
+"POT-Creation-Date: 2022-03-10 11:47+0000\n"
 "PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
 "Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
 "Language-Team: LANGUAGE <LL@li.org>\n"
@@ -37,7 +37,7 @@ msgstr ""
 
 #. type: Plain text
 msgid ""
-"Ici je vais tout convertir en [Joules](https://fr.wikipedia.org/wiki/Joule), "
+"Ici je vais tout convertir en [joules](https://fr.wikipedia.org/wiki/Joule), "
 "l'unité du Système International, pour mieux comparer.  Je vais poster "
 "chacun de mes calculs avec le tag [#Joules](https://framapiaf.org/tags/"
 "Joules) sur Framapiaf."
@@ -109,3 +109,27 @@ msgid ""
 "intercontinental (20 000 km) et quatre voyages domestiques entre Okinawa et "
 "Tôkyô (4 × 2000 km).  Donc environ 840 litres par an, donc 2 400 MJ."
 msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"Ma part dans la facture télécoms familiale, internet plus téléphonie mobile, "
+"est d'environ 5000 yens.  Je n'ai aucune idée précise de la quantité "
+"d'énergie utilisée.  Mais on peut estimer une limite supérieure: si cet "
+"argent était entièrement dépensé en électricité par les opérateurs, et "
+"qu'ils la payaient au même prix que nous cela ferait environ 160 kWh, ou "
+"environ 600 MJ.  Dans la pratique, ils ont d'autre coûts, et on se situe "
+"probablement à un dixième ou moins du maximum.  Bien entendu, ces chiffres "
+"ne tiennent pas compte du fait que côté centres de données qui nous "
+"fournissent le « contenu », la dépense énergétique est énorme."
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"Je consomme entre 6 et 7 mètres cubes d'eau par mois pour un prix d'environ "
+"1000 yens, qui include la production et le retraitement.  Un rapport de "
+"l'observatoire de l'eau de la Seine-et-Marne, de 2016, estime entre 1.6 et "
+"16 % la part énergétique de la facture d'eau.  En extrapolant avec ma "
+"facture d'électricité, 100 yens font environ 11 MJ.  L'eau est précieuse et "
+"les effets de son gaspillage sont différents de ceux du gaspillage de "
+"l'énergie."
+msgstr ""

Télécoms et eau.
diff --git a/Joules.md b/Joules.md
index 6f771d73..641b8e72 100644
--- a/Joules.md
+++ b/Joules.md
@@ -8,7 +8,7 @@ contexte: calories pour la nourriture ou kilowatt-heures pour l'électricité, e
 on n'a pas l'habitude d'estimer quelle quantité d'énergie on a retiré d'un
 litre d'essence ou d'un mètre cube de gaz…
 
-Ici je vais tout convertir en [Joules](https://fr.wikipedia.org/wiki/Joule),
+Ici je vais tout convertir en [joules](https://fr.wikipedia.org/wiki/Joule),
 l'unité du Système International, pour mieux comparer.  Je vais poster chacun
 de mes calculs avec le tag [#Joules](https://framapiaf.org/tags/Joules) sur
 Framapiaf.
@@ -61,3 +61,19 @@ Framapiaf.
    intercontinental (20 000 km) et quatre voyages domestiques entre Okinawa et
    Tôkyô (4 × 2000 km).  Donc environ 840 litres par an, donc 2 400 MJ.
 
+ - Ma part dans la facture télécoms familiale, internet plus téléphonie
+   mobile, est d'environ 5000 yens.  Je n'ai aucune idée précise de la quantité
+   d'énergie utilisée.  Mais on peut estimer une limite supérieure: si cet
+   argent était entièrement dépensé en électricité par les opérateurs, et qu'ils
+   la payaient au même prix que nous cela ferait environ
+   160 kWh, ou environ 600 MJ.  Dans la pratique, ils ont d'autre coûts, et on
+   se situe probablement à un dixième ou moins du maximum.  Bien
+   entendu, ces chiffres ne tiennent pas compte du fait que côté centres de
+   données qui nous fournissent le « contenu », la dépense énergétique est énorme.
+
+ - Je consomme entre 6 et 7 mètres cubes d'eau par mois pour un prix d'environ
+   1000 yens, qui include la production et le retraitement.  Un rapport de
+   l'observatoire de l'eau de la Seine-et-Marne, de 2016, estime entre 1.6 et 16 %
+   la part énergétique de la facture d'eau.  En extrapolant avec ma facture
+   d'électricité, 100 yens font environ 11 MJ.  L'eau est précieuse et les effets
+   de son gaspillage sont différents de ceux du gaspillage de l'énergie.

Café
diff --git a/biblio/10.3354_meps301149.mdwn b/biblio/10.3354_meps301149.mdwn
new file mode 100644
index 00000000..e67bca81
--- /dev/null
+++ b/biblio/10.3354_meps301149.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Influence of body mass, food concentration, temperature and filtering activity on the oxygen uptake of the appendicularian Oikopleura dioica"]]
+[[!tag Oikopleura]]
+
+Fabien Lombard, Antoine Sciandra and Gabriel Gorsky
+
+MEPS 301:149-158 (2005) doi:10.3354/meps301149 
+
+Influence of body mass, food concentration, temperature and filtering activity on the oxygen uptake of the appendicularian Oikopleura dioica
+
+[[!doi 10.3354/meps301149 desc="Using the Bergen lab strain.  Culture at 15 ± 1°C.  Fed with _Isochrisis galbana_ and _Thalassiosira pseudonana_.  Food was lyophilised for oxygen measurements, so that it does not respirate.  Animals with new house and empty stomach were used in the experiments.  Animals and food were placed in oxygen-saturated water, and the remaining oxygen was measured with a polaro-graphic oxygen meter at the end of the experiment.  Some animals wer aesthetized with tricaine methanesulfonate (Sandoz MS-222).  Animals receiving more food consume more oxygen, but also become larger.  After correction for body weight, food concentration did not influence respiration.  Anesthesia reduces respiration by 33%.  Animals consume more oxygen at 22°C than at 15°C."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 246fb151..3ef6ee5b 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -487,6 +487,9 @@ Physiology
    (2005)|biblio/10.1111_j.1744-7410.2001.tb00038.x]]).
  - Yellow color can be caused by bacterial infection.  [[Flood (1991)|biblio/24817302]]
    observed rod-shaped bacteria (0.6 or 0.4 µm-wide) in _O. doica_ or _O. vanhoeffeni_.
+ - Oxygen consumption increases with temperature (15°C vs 22°C) and activity (anesthesised
+   vs control animals).  It scales with body weigth, and not with food concentration after
+   correcting for body weight ([[Lombard, Sciandra and Gorsky, 2005|biblio/10.3354_meps301149]]).
 
 House
 -----

Published
diff --git a/biblio/10.1007_978-3-030-74432-8_11.mdwn b/biblio/10.1007_978-3-030-74432-8_11.mdwn
new file mode 100644
index 00000000..56b5705a
--- /dev/null
+++ b/biblio/10.1007_978-3-030-74432-8_11.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Improved DNA-versus-Protein Homology Search for Protein Fossils"]]
+[[!tag LAST repeat]]
+
+Yin Yao, Martin C. Frith
+
+In: Martín-Vide C., Vega-Rodríguez M.A., Wheeler T. (eds) Algorithms for Computational Biology. AlCoB 2021. Lecture Notes in Computer Science, vol 12715. Springer, Cham. DOI:10.1007/978-3-030-74432-8_11
+
+Improved DNA-versus-Protein Homology Search for Protein Fossils
+
+[[!doi 10.1007/978-3-030-74432-8_11 desc="Uses a 64 x 21 substitution matrix and automatically learns the genetic code.  Detected fossils of the polinton and DIRS/Ngaro repeat elements in the human genome.  10 times faster than blastx."]]
diff --git a/biblio/10.1101_2021.01.25.428050.mdwn b/biblio/10.1101_2021.01.25.428050.mdwn
deleted file mode 100644
index b9592bb0..00000000
--- a/biblio/10.1101_2021.01.25.428050.mdwn
+++ /dev/null
@@ -1,10 +0,0 @@
-[[!meta title="Improved DNA-versus-Protein Homology Search for Protein Fossils"]]
-[[!tag bioRxiv LAST repeat]]
-
-Yin Yao, Martin C. Frith
-
-bioRxiv 2021.01.25.428050; doi: https://doi.org/10.1101/2021.01.25.428050
-
-Improved DNA-versus-Protein Homology Search for Protein Fossils
-
-[[!doi 10.1101/2021.01.25.428050 desc="Uses a 64 x 21 substitution matrix and automatically learns the genetic code.  Detected fossils of the polinton and DIRS/Ngaro repeat elements in the human genome.  10 times faster than blastx."]]

Café
diff --git a/biblio/10.1101_2022.03.01.482560.mdwn b/biblio/10.1101_2022.03.01.482560.mdwn
new file mode 100644
index 00000000..52525776
--- /dev/null
+++ b/biblio/10.1101_2022.03.01.482560.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Global ecological and biogeochemical impacts of pelagic tunicates"]]
+[[!tag bioRxiv]]
+
+Jessica Y Luo, Charles A. Stock, Natasha Henschke, John P. Dunne and Todd D. O'Brien
+
+Posted March 04, 2022.
+
+Global ecological and biogeochemical impacts of pelagic tunicates
+
+[[!doi 10.1101/2022.03.01.482560 desc="“Our results suggest that pelagic tunicates play important trophic roles in both directly competing with microzooplankton and indirectly shunting carbon export away from the microbial loop.”"]]

Café
diff --git a/biblio/35239377.mdwn b/biblio/35239377.mdwn
new file mode 100644
index 00000000..2a385643
--- /dev/null
+++ b/biblio/35239377.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Transcriptional neighborhoods regulate transcript isoform lengths and expression levels."]]
+[[!tag yeast synthetic variants]]
+
+Brooks AN, Hughes AL, Clauder-Münster S, Mitchell LA, Boeke JD, Steinmetz LM.
+
+Science. 2022 Mar 4;375(6584):1000-1005. doi: 10.1126/science.abg0162
+
+Transcriptional neighborhoods regulate transcript isoform lengths and expression levels.
+
+[[!pmid 35239377 desc="“a synthetic yeast genome (Sc2.0) was designed to encode a Cre-dependent system known as synthetic chromosome rearrangement and modification by LoxP-mediated evolution (SCRaMbLE), which can generate stochastic genomic rearrangements on demand directly in its genome. These rearrangements occur at 34 base pair (bp)–loxPsym sites inserted 3 bp downstream of the stop codon of all nonessential CDSs.”"]]
diff --git a/tags/synthetic.mdwn b/tags/synthetic.mdwn
index 06d8d9a3..009c3613 100644
--- a/tags/synthetic.mdwn
+++ b/tags/synthetic.mdwn
@@ -8,4 +8,6 @@ Sc3.0 roadmap: [[Dai and coll., 2020|biblio/32791980]].
 
 Example of neochromosome synthesis in yeast: [[Postma and coll., 2021|biblio/33423048]].
 
+Artificial genome scrambling in yeast 2.0 with loxPsym sites: [[Brooks and coll, 2022|biblio/35239377]].
+
 [[!inline pages="tagged(synthethic)" limit=0]]

updated PO files
diff --git a/Joules.en.po b/Joules.en.po
index 54fdea53..b75dae18 100644
--- a/Joules.en.po
+++ b/Joules.en.po
@@ -7,7 +7,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2022-02-27 07:07+0000\n"
+"POT-Creation-Date: 2022-03-03 12:24+0000\n"
 "PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
 "Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
 "Language-Team: LANGUAGE <LL@li.org>\n"
@@ -72,3 +72,40 @@ msgid ""
 "déduis que je consomme environ 300 MJ par mois.  Reste à savoir: l'énergie "
 "dépensée pour me fournir cette nourriture…"
 msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"Pour nous chauffer et nous rafraîchir, pour utiliser nos appareils électro-"
+"ménagers, et nos médias à écrans, nous consommons environ 300 kWh "
+"d'électricité par mois.  Mettons que ça fait 100 pour moi.  Une puissance de "
+"1 Watt, c'est 1 Joule par seconde.  Donc 100 kWh font 360 MJ.  Une grande "
+"partie de cette énergie provient de centrales à charbon et il faut de "
+"l'énergie pour l'extraire et le transporter.  Une partie de l'électricité "
+"produite se dissipe en chaleur dans le réseau électrique.  Ma consommation "
+"réelle est donc supérieure à ce que m'annonce le compteur."
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"Pour cuisiner, chauffer notre eau de lavage, et sécher nos habits, nous "
+"utilisons environ 12 mètres cube de gaz par mois, donc 4 pour ma part.  Il "
+"existe différents types de gaz domestique, et une partie de l'énergie "
+"dégagée par la combustion se perd par l'émission de vapeur d'eau.  Les "
+"chiffres donnés sur Wikipédia sont pour une température ambiante de zéro "
+"degrés, ce qui n'est pas le cas dans notre appartement.  Néanmoins, une "
+"estimation à un chiffre significatif de 40 MJ par mètre cube paraît "
+"acceptable.  Donc 160 MJ pour ma consommation mensuelle.  Et comme pour les "
+"autres énergies, je ne sais pas combien d'énergie supplémentaire il faut "
+"dépenser pour me fournir ce gaz."
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"On estime la consommation des avions modernes entre 2 et 4 litres de "
+"kérosène par 100 kilomètres et par passager.  Son pouvoir calorifique n'est "
+"pas très différent ce celui de l'essence de nos voitures, mettons 34 MJ par "
+"litre (43 MJ/kg pour densité de 0.8).  La différence avec la voiture, c'est "
+"qu'on fait beaucoup plus de kilomètres en avion.  Je fais environ un voyage "
+"intercontinental (20 000 km) et quatre voyages domestiques entre Okinawa et "
+"Tôkyô (4 × 2000 km).  Donc environ 840 litres par an, donc 2 400 MJ."
+msgstr ""

France is in the air...
diff --git a/Joules.md b/Joules.md
index 1515c7d2..6f771d73 100644
--- a/Joules.md
+++ b/Joules.md
@@ -44,12 +44,20 @@ Framapiaf.
 
  - Pour cuisiner, chauffer notre eau de lavage, et sécher nos habits, nous
    utilisons environ 12 mètres cube de gaz par mois, donc 4 pour ma part.
-   Il existe différents types de gaz domesique, et une partie de l'énergie
-   dégagée par la combusion se perd par l'émission de vapeur d'eau.  Les chiffres
+   Il existe différents types de gaz domestique, et une partie de l'énergie
+   dégagée par la combustion se perd par l'émission de vapeur d'eau.  Les chiffres
    donnés sur Wikipédia sont pour une température ambiante de zéro degrés, ce
-   qui n'est pas le cas dans notre apppartement.  Néanmoins, une estimation à un
+   qui n'est pas le cas dans notre appartement.  Néanmoins, une estimation à un
    chiffre significatif de 40 MJ par mètre cube paraît acceptable.  Donc 160 MJ
    pour ma consommation mensuelle.  Et comme pour les autres énergies, je ne
    sais pas combien d'énergie supplémentaire il faut dépenser pour me fournir
    ce gaz.
 
+ - On estime la consommation des avions modernes entre 2 et 4 litres de
+   kérosène par 100 kilomètres et par passager.  Son pouvoir calorifique n'est
+   pas très différent ce celui de l'essence de nos voitures, mettons 34 MJ par
+   litre (43 MJ/kg pour densité de 0.8).  La différence avec la voiture, c'est
+   qu'on fait beaucoup plus de kilomètres en avion.  Je fais environ un voyage
+   intercontinental (20 000 km) et quatre voyages domestiques entre Okinawa et
+   Tôkyô (4 × 2000 km).  Donc environ 840 litres par an, donc 2 400 MJ.
+

Et le gaz ? -- Lofofora, Holidays in France
diff --git a/Joules.md b/Joules.md
index 07265368..1515c7d2 100644
--- a/Joules.md
+++ b/Joules.md
@@ -42,3 +42,14 @@ Framapiaf.
    dissipe en chaleur dans le réseau électrique.  Ma consommation réelle est donc
    supérieure à ce que m'annonce le compteur.
 
+ - Pour cuisiner, chauffer notre eau de lavage, et sécher nos habits, nous
+   utilisons environ 12 mètres cube de gaz par mois, donc 4 pour ma part.
+   Il existe différents types de gaz domesique, et une partie de l'énergie
+   dégagée par la combusion se perd par l'émission de vapeur d'eau.  Les chiffres
+   donnés sur Wikipédia sont pour une température ambiante de zéro degrés, ce
+   qui n'est pas le cas dans notre apppartement.  Néanmoins, une estimation à un
+   chiffre significatif de 40 MJ par mètre cube paraît acceptable.  Donc 160 MJ
+   pour ma consommation mensuelle.  Et comme pour les autres énergies, je ne
+   sais pas combien d'énergie supplémentaire il faut dépenser pour me fournir
+   ce gaz.
+

Électricité
diff --git a/Joules.md b/Joules.md
index 885a50ce..07265368 100644
--- a/Joules.md
+++ b/Joules.md
@@ -32,3 +32,13 @@ Framapiaf.
    En approximant ça à ma consommation quotidienne, j'en déduis que je consomme
    environ 300 MJ par mois.  Reste à savoir: l'énergie dépensée pour me fournir
    cette nourriture…
+
+ - Pour nous chauffer et nous rafraîchir, pour utiliser nos appareils
+   électro-ménagers, et nos médias à écrans, nous consommons environ 300 kWh
+   d'électricité par mois.  Mettons que ça fait 100 pour moi.  Une puissance de
+   1 Watt, c'est 1 Joule par seconde.  Donc 100 kWh font 360 MJ.  Une grande
+   partie de cette énergie provient de centrales à charbon et il faut de l'énergie
+   pour l'extraire et le transporter.  Une partie de l'électricité produite se
+   dissipe en chaleur dans le réseau électrique.  Ma consommation réelle est donc
+   supérieure à ce que m'annonce le compteur.
+

updated PO files
diff --git a/Joules.en.po b/Joules.en.po
index 4df4876e..54fdea53 100644
--- a/Joules.en.po
+++ b/Joules.en.po
@@ -7,7 +7,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2022-02-26 12:58+0000\n"
+"POT-Creation-Date: 2022-02-27 07:07+0000\n"
 "PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
 "Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
 "Language-Team: LANGUAGE <LL@li.org>\n"
@@ -58,3 +58,17 @@ msgid ""
 "mois, avec une voiture parcourant 25 kilomètres par litre, ça fait 24 litres "
 "par mois, donc environ 800 MJ par mois."
 msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"Je n'ai aucune idée précise de la quantité d'énergie que j'ingère chaque "
+"jour.  Mon pèse-personne, calibré pour une masse corporelle japonaise, me "
+"recommande de manger 1700 kilocalories par jour.  C'est gross-modo mon "
+"métabolisme de base d'après les chiffres résumés par l'ANSES dans on avis "
+"suivant la saisine 2012-SA-0103.  Dans ce même document, les besoins d'un "
+"homme de mon age « modérément actif » sont un peu au dessus de 2500 kcal par "
+"jour.  Une calorie vaut environ 4.2 Joules.  10 000 kJoules valent un peu "
+"moins de 2400 kcal.  En approximant ça à ma consommation quotidienne, j'en "
+"déduis que je consomme environ 300 MJ par mois.  Reste à savoir: l'énergie "
+"dépensée pour me fournir cette nourriture…"
+msgstr ""

Bouf
diff --git a/Joules.md b/Joules.md
index 86213c61..885a50ce 100644
--- a/Joules.md
+++ b/Joules.md
@@ -21,3 +21,14 @@ Framapiaf.
  - Je roule 30 kilomètres par jour pour aller travailler, environ 20 jours par
    mois, avec une voiture parcourant 25 kilomètres par litre, ça fait 24 litres
    par mois, donc environ 800 MJ par mois.
+
+ - Je n'ai aucune idée précise de la quantité d'énergie que j'ingère chaque jour.
+   Mon pèse-personne, calibré pour une masse corporelle japonaise, me recommande de
+   manger 1700 kilocalories par jour.  C'est gross-modo mon métabolisme de base
+   d'après les chiffres résumés par l'ANSES dans on avis suivant la saisine
+   2012-SA-0103.  Dans ce même document, les besoins d'un homme de mon age
+   « modérément actif » sont un peu au dessus de 2500 kcal par jour.  Une calorie
+   vaut environ 4.2 Joules.  10 000 kJoules valent un peu moins de 2400 kcal.
+   En approximant ça à ma consommation quotidienne, j'en déduis que je consomme
+   environ 300 MJ par mois.  Reste à savoir: l'énergie dépensée pour me fournir
+   cette nourriture…

updated PO files
diff --git a/Joules.en.po b/Joules.en.po
index 3ec68754..4df4876e 100644
--- a/Joules.en.po
+++ b/Joules.en.po
@@ -7,7 +7,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2022-02-26 12:05+0000\n"
+"POT-Creation-Date: 2022-02-26 12:58+0000\n"
 "PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
 "Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
 "Language-Team: LANGUAGE <LL@li.org>\n"
@@ -31,19 +31,30 @@ msgstr ""
 msgid ""
 "On estime souvent l'énergie consommée en unités différentes suivant le "
 "contexte: calories pour la nourriture ou kilowatt-heures pour l'électricité, "
-"et on n'a pas l'habiture d'estimer quelle quantité d'énergie on a retiré "
+"et on n'a pas l'habitude d'estimer quelle quantité d'énergie on a retiré "
 "d'un litre d'essence ou d'un mètre cube de gaz…"
 msgstr ""
 
 #. type: Plain text
-msgid "Ici je vais tout convertir en joules, pour mieux comparer."
+msgid ""
+"Ici je vais tout convertir en [Joules](https://fr.wikipedia.org/wiki/Joule), "
+"l'unité du Système International, pour mieux comparer.  Je vais poster "
+"chacun de mes calculs avec le tag [#Joules](https://framapiaf.org/tags/"
+"Joules) sur Framapiaf."
 msgstr ""
 
 #. type: Bullet: ' - '
 msgid ""
 "« _L'énergie contenue dans l'essence est d'environ 33 600 000 joules par "
 "litre, ou 46 700 000 joules par kilogramme (de pouvoir calorifique "
-"supérieur)._ » "
-"([Wikipedia](https://fr.wikipedia.org/wiki/Essence_(hydrocarbure)).  Reste à "
-"savoir: l'énergie consommée pour produire ce litre d'essence…"
+"supérieur)._ » ([Wikipedia](https://fr.wikipedia.org/wiki/"
+"Essence_(hydrocarbure)).  Reste à savoir: l'énergie consommée pour produire "
+"ce litre d'essence…"
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"Je roule 30 kilomètres par jour pour aller travailler, environ 20 jours par "
+"mois, avec une voiture parcourant 25 kilomètres par litre, ça fait 24 litres "
+"par mois, donc environ 800 MJ par mois."
 msgstr ""

En voiture !
diff --git a/Joules.md b/Joules.md
index 0a67e5f1..86213c61 100644
--- a/Joules.md
+++ b/Joules.md
@@ -5,12 +5,19 @@ _(Rédaction en progrès)_
 
 On estime souvent l'énergie consommée en unités différentes suivant le
 contexte: calories pour la nourriture ou kilowatt-heures pour l'électricité, et
-on n'a pas l'habiture d'estimer quelle quantité d'énergie on a retiré d'un
+on n'a pas l'habitude d'estimer quelle quantité d'énergie on a retiré d'un
 litre d'essence ou d'un mètre cube de gaz…
 
-Ici je vais tout convertir en joules, pour mieux comparer.
+Ici je vais tout convertir en [Joules](https://fr.wikipedia.org/wiki/Joule),
+l'unité du Système International, pour mieux comparer.  Je vais poster chacun
+de mes calculs avec le tag [#Joules](https://framapiaf.org/tags/Joules) sur
+Framapiaf.
 
  - « _L'énergie contenue dans l'essence est d'environ 33 600 000 joules par
    litre, ou 46 700 000 joules par kilogramme (de pouvoir calorifique
    supérieur)._ » ([Wikipedia](https://fr.wikipedia.org/wiki/Essence_(hydrocarbure)).
    Reste à savoir: l'énergie consommée pour produire ce litre d'essence…
+
+ - Je roule 30 kilomètres par jour pour aller travailler, environ 20 jours par
+   mois, avec une voiture parcourant 25 kilomètres par litre, ça fait 24 litres
+   par mois, donc environ 800 MJ par mois.

updated PO files
diff --git a/Joules.en.po b/Joules.en.po
new file mode 100644
index 00000000..3ec68754
--- /dev/null
+++ b/Joules.en.po
@@ -0,0 +1,49 @@
+# SOME DESCRIPTIVE TITLE
+# Copyright (C) YEAR Free Software Foundation, Inc.
+# This file is distributed under the same license as the PACKAGE package.
+# FIRST AUTHOR <EMAIL@ADDRESS>, YEAR.
+#
+#, fuzzy
+msgid ""
+msgstr ""
+"Project-Id-Version: PACKAGE VERSION\n"
+"POT-Creation-Date: 2022-02-26 12:05+0000\n"
+"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
+"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
+"Language-Team: LANGUAGE <LL@li.org>\n"
+"Language: \n"
+"MIME-Version: 1.0\n"
+"Content-Type: text/plain; charset=UTF-8\n"
+"Content-Transfer-Encoding: 8bit\n"
+
+#. type: Plain text
+#, no-wrap
+msgid ""
+"Ma consommation énergétique en joules\n"
+"=====================================\n"
+msgstr ""
+
+#. type: Plain text
+msgid "_(Rédaction en progrès)_"
+msgstr ""
+
+#. type: Plain text
+msgid ""
+"On estime souvent l'énergie consommée en unités différentes suivant le "
+"contexte: calories pour la nourriture ou kilowatt-heures pour l'électricité, "
+"et on n'a pas l'habiture d'estimer quelle quantité d'énergie on a retiré "
+"d'un litre d'essence ou d'un mètre cube de gaz…"
+msgstr ""
+
+#. type: Plain text
+msgid "Ici je vais tout convertir en joules, pour mieux comparer."
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"« _L'énergie contenue dans l'essence est d'environ 33 600 000 joules par "
+"litre, ou 46 700 000 joules par kilogramme (de pouvoir calorifique "
+"supérieur)._ » "
+"([Wikipedia](https://fr.wikipedia.org/wiki/Essence_(hydrocarbure)).  Reste à "
+"savoir: l'énergie consommée pour produire ce litre d'essence…"
+msgstr ""

Ma consommation énergétique.
diff --git a/Joules.md b/Joules.md
new file mode 100644
index 00000000..0a67e5f1
--- /dev/null
+++ b/Joules.md
@@ -0,0 +1,16 @@
+Ma consommation énergétique en joules
+=====================================
+
+_(Rédaction en progrès)_
+
+On estime souvent l'énergie consommée en unités différentes suivant le
+contexte: calories pour la nourriture ou kilowatt-heures pour l'électricité, et
+on n'a pas l'habiture d'estimer quelle quantité d'énergie on a retiré d'un
+litre d'essence ou d'un mètre cube de gaz…
+
+Ici je vais tout convertir en joules, pour mieux comparer.
+
+ - « _L'énergie contenue dans l'essence est d'environ 33 600 000 joules par
+   litre, ou 46 700 000 joules par kilogramme (de pouvoir calorifique
+   supérieur)._ » ([Wikipedia](https://fr.wikipedia.org/wiki/Essence_(hydrocarbure)).
+   Reste à savoir: l'énergie consommée pour produire ce litre d'essence…

Merge remote-tracking branch 'refs/remotes/origin/master'
E
diff --git "a/Debian/debi\303\242neries/media-types-2022.en.po" "b/Debian/debi\303\242neries/media-types-2022.en.po"
index f67714cc..e21800fd 100644
--- "a/Debian/debi\303\242neries/media-types-2022.en.po"
+++ "b/Debian/debi\303\242neries/media-types-2022.en.po"
@@ -7,7 +7,7 @@ msgid ""
 msgstr ""
 "Project-Id-Version: \n"
 "POT-Creation-Date: 2022-02-24 13:10+0000\n"
-"PO-Revision-Date: 2022-02-24 22:01+0900\n"
+"PO-Revision-Date: 2022-02-24 22:12+0900\n"
 "Last-Translator: \n"
 "Language-Team: \n"
 "Language: en\n"
@@ -32,25 +32,11 @@ msgid "[[!tag Debian]]\n"
 msgstr "[[!tag Debian]]\n"
 
 #. type: Plain text
-#, fuzzy, no-wrap
-#| msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
+#, no-wrap
 msgid "[[!meta title=\"Types media, cuvée 2022.\"]]\n"
 msgstr "[[!meta title=\"New media types in 2022\"]]\n"
 
 #. type: Plain text
-#, fuzzy
-#| msgid ""
-#| "En début d'année j'ai mis à jour une centaine de [types de media]"
-#| "(https://fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des "
-#| "extensions de nom de fichier dans le fichier `/etc/mine.types`, "
-#| "distribué par le paquet [[!debpkg media-types]].  La plupart des "
-#| "[changements](https://metadata.ftp-master.debian.org/changelogs//main/m/"
-#| "media-types/media-types_5.0.0_changelog)  sont des additions en "
-#| "provenance des déclarations récentes à'[IANA](https://www.iana.org/"
-#| "assignments/media-types).  Les thèmes les plus répendus sont les "
-#| "télécomunications, la sécurité informatique, le commerce, la santé, "
-#| "et l'automatisation industrielle.  L'énorme majorité provient du monde "
-#| "occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
 msgid ""
 "En début d'année j'ai mis à jour une centaine de [types de media](https://fr."
 "wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de nom de "

updated PO files
diff --git "a/Debian/debi\303\242neries/media-types-2022.en.po" "b/Debian/debi\303\242neries/media-types-2022.en.po"
index f67714cc..da6e3db4 100644
--- "a/Debian/debi\303\242neries/media-types-2022.en.po"
+++ "b/Debian/debi\303\242neries/media-types-2022.en.po"
@@ -6,7 +6,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: \n"
-"POT-Creation-Date: 2022-02-24 13:10+0000\n"
+"POT-Creation-Date: 2022-02-24 13:12+0000\n"
 "PO-Revision-Date: 2022-02-24 22:01+0900\n"
 "Last-Translator: \n"
 "Language-Team: \n"
@@ -54,7 +54,7 @@ msgstr "[[!meta title=\"New media types in 2022\"]]\n"
 msgid ""
 "En début d'année j'ai mis à jour une centaine de [types de media](https://fr."
 "wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de nom de "
-"fichier dans le fichier `/etc/mine.types`, distribué par le paquet [[!debpkg "
+"fichier dans le fichier `/etc/mime.types`, distribué par le paquet [[!debpkg "
 "media-types]].  La plupart des [changements](https://metadata.ftp-master."
 "debian.org/changelogs//main/m/media-types/media-types_5.0.0_changelog)  sont "
 "des additions en provenance des déclarations récentes à'[IANA](https://www."

Typo
diff --git "a/Debian/debi\303\242neries/media-types-2022.mdwn" "b/Debian/debi\303\242neries/media-types-2022.mdwn"
index 5e60f21a..9db316d0 100644
--- "a/Debian/debi\303\242neries/media-types-2022.mdwn"
+++ "b/Debian/debi\303\242neries/media-types-2022.mdwn"
@@ -6,7 +6,7 @@
 
 En début d'année j'ai mis à jour une centaine de [types de
 media](https://fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des
-extensions de nom de fichier dans le fichier `/etc/mine.types`, distribué
+extensions de nom de fichier dans le fichier `/etc/mime.types`, distribué
 par le paquet [[!debpkg media-types]].  La plupart des
 [changements](https://metadata.ftp-master.debian.org/changelogs//main/m/media-types/media-types_5.0.0_changelog)
 sont des additions en provenance des déclarations récentes

updated PO files
diff --git "a/Debian/debi\303\242neries/media-types-2022.en.po" "b/Debian/debi\303\242neries/media-types-2022.en.po"
index dd75779f..f67714cc 100644
--- "a/Debian/debi\303\242neries/media-types-2022.en.po"
+++ "b/Debian/debi\303\242neries/media-types-2022.en.po"
@@ -6,7 +6,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: \n"
-"POT-Creation-Date: 2022-02-24 13:02+0000\n"
+"POT-Creation-Date: 2022-02-24 13:10+0000\n"
 "PO-Revision-Date: 2022-02-24 22:01+0900\n"
 "Last-Translator: \n"
 "Language-Team: \n"
@@ -34,7 +34,7 @@ msgstr "[[!tag Debian]]\n"
 #. type: Plain text
 #, fuzzy, no-wrap
 #| msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
-msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
+msgid "[[!meta title=\"Types media, cuvée 2022.\"]]\n"
 msgstr "[[!meta title=\"New media types in 2022\"]]\n"
 
 #. type: Plain text

Espace blanc.
diff --git "a/Debian/debi\303\242neries/media-types-2022.mdwn" "b/Debian/debi\303\242neries/media-types-2022.mdwn"
index 6881159a..5e60f21a 100644
--- "a/Debian/debi\303\242neries/media-types-2022.mdwn"
+++ "b/Debian/debi\303\242neries/media-types-2022.mdwn"
@@ -2,12 +2,12 @@
 [[!meta updated="Thu, 24 Feb 2022 21:32:36 +0900"]]
 [[!tag Debian]]
 
-[[!meta title="Types media, cuvée 2022"]]
+[[!meta title="Types media, cuvée 2022."]]
 
 En début d'année j'ai mis à jour une centaine de [types de
 media](https://fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des
-extensions de nom de fichier dans le fichier `/etc/mine.types`, distribué par
-le paquet [[!debpkg media-types]].  La plupart des
+extensions de nom de fichier dans le fichier `/etc/mine.types`, distribué
+par le paquet [[!debpkg media-types]].  La plupart des
 [changements](https://metadata.ftp-master.debian.org/changelogs//main/m/media-types/media-types_5.0.0_changelog)
 sont des additions en provenance des déclarations récentes
 à'[IANA](https://www.iana.org/assignments/media-types).  Les thèmes les plus

updated PO files
diff --git "a/Debian/debi\303\242neries/media-types-2022.en.po" "b/Debian/debi\303\242neries/media-types-2022.en.po"
index ea368732..dd75779f 100644
--- "a/Debian/debi\303\242neries/media-types-2022.en.po"
+++ "b/Debian/debi\303\242neries/media-types-2022.en.po"
@@ -6,7 +6,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: \n"
-"POT-Creation-Date: 2022-02-24 12:59+0000\n"
+"POT-Creation-Date: 2022-02-24 13:02+0000\n"
 "PO-Revision-Date: 2022-02-24 22:01+0900\n"
 "Last-Translator: \n"
 "Language-Team: \n"
@@ -32,23 +32,36 @@ msgid "[[!tag Debian]]\n"
 msgstr "[[!tag Debian]]\n"
 
 #. type: Plain text
-#, no-wrap
-msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
+#, fuzzy, no-wrap
+#| msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
+msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
 msgstr "[[!meta title=\"New media types in 2022\"]]\n"
 
 #. type: Plain text
+#, fuzzy
+#| msgid ""
+#| "En début d'année j'ai mis à jour une centaine de [types de media]"
+#| "(https://fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des "
+#| "extensions de nom de fichier dans le fichier `/etc/mine.types`, "
+#| "distribué par le paquet [[!debpkg media-types]].  La plupart des "
+#| "[changements](https://metadata.ftp-master.debian.org/changelogs//main/m/"
+#| "media-types/media-types_5.0.0_changelog)  sont des additions en "
+#| "provenance des déclarations récentes à'[IANA](https://www.iana.org/"
+#| "assignments/media-types).  Les thèmes les plus répendus sont les "
+#| "télécomunications, la sécurité informatique, le commerce, la santé, "
+#| "et l'automatisation industrielle.  L'énorme majorité provient du monde "
+#| "occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
 msgid ""
-"En début d'année j'ai mis à jour une centaine de [types de media](https://"
-"fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de "
-"nom de fichier dans le fichier `/etc/mine.types`, distribué par le paquet "
-"[[!debpkg media-types]].  La plupart des [changements](https://metadata.ftp-"
-"master.debian.org/changelogs//main/m/media-types/media-"
-"types_5.0.0_changelog)  sont des additions en provenance des déclarations "
-"récentes à'[IANA](https://www.iana.org/assignments/media-types).  Les "
-"thèmes les plus répendus sont les télécomunications, la sécurité "
-"informatique, le commerce, la santé, et l'automatisation industrielle.  "
-"L'énorme majorité provient du monde occidental.  Le reste du monde a-t-il "
-"décidé d'avancer sans nous ?"
+"En début d'année j'ai mis à jour une centaine de [types de media](https://fr."
+"wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de nom de "
+"fichier dans le fichier `/etc/mine.types`, distribué par le paquet [[!debpkg "
+"media-types]].  La plupart des [changements](https://metadata.ftp-master."
+"debian.org/changelogs//main/m/media-types/media-types_5.0.0_changelog)  sont "
+"des additions en provenance des déclarations récentes à'[IANA](https://www."
+"iana.org/assignments/media-types).  Les thèmes les plus répendus sont les "
+"télécomunications, la sécurité informatique, le commerce, la santé, et "
+"l'automatisation industrielle.  L'énorme majorité provient du monde "
+"occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
 msgstr ""
 "At the beginning of this year I updated a hundred of [media types](https://"
 "en.wikipedia.org/wiki/Media_type) associated with file name extensions in "

Eng
diff --git "a/Debian/debi\303\242neries/media-types-2022.en.po" "b/Debian/debi\303\242neries/media-types-2022.en.po"
index f6d1d003..ea368732 100644
--- "a/Debian/debi\303\242neries/media-types-2022.en.po"
+++ "b/Debian/debi\303\242neries/media-types-2022.en.po"
@@ -7,7 +7,7 @@ msgid ""
 msgstr ""
 "Project-Id-Version: \n"
 "POT-Creation-Date: 2022-02-24 12:59+0000\n"
-"PO-Revision-Date: 2022-02-24 21:46+0900\n"
+"PO-Revision-Date: 2022-02-24 22:01+0900\n"
 "Last-Translator: \n"
 "Language-Team: \n"
 "Language: en\n"
@@ -32,23 +32,11 @@ msgid "[[!tag Debian]]\n"
 msgstr "[[!tag Debian]]\n"
 
 #. type: Plain text
-#, fuzzy, no-wrap
-#| msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
+#, no-wrap
 msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
 msgstr "[[!meta title=\"New media types in 2022\"]]\n"
 
 #. type: Plain text
-#, fuzzy
-#| msgid ""
-#| "En début d'année j'ai mis à jour une centaine de [types de media](https://"
-#| "fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de "
-#| "nom de fichier dans le fichier `/etc/media.types`, distribué par le "
-#| "paquet [[!debpkg media-types]].  La plupart des changements sont des "
-#| "additions en provenance des déclarations récentes à'[IANA](https://www."
-#| "iana.org/assignments/media-types).  Les thèmes les plus répendus sont les "
-#| "télécomunications, la sécurité informatique, le commerce, la santé, et "
-#| "l'automatisation industrielle.  L'énorme majorité provient du monde "
-#| "occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
 msgid ""
 "En début d'année j'ai mis à jour une centaine de [types de media](https://"
 "fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de "
@@ -65,9 +53,10 @@ msgstr ""
 "At the beginning of this year I updated a hundred of [media types](https://"
 "en.wikipedia.org/wiki/Media_type) associated with file name extensions in "
 "the file called `/etc/mime.types`, distributed by the [[!debpkg media-"
-"types]] package.  Most changes are additions originating from recent "
-"submissions to the [IANA](https://www.iana.org/assignments/media-types). "
-"Amon the themes that caught my attention, there are telecommunications, "
-"computer security, commerce, healthcare and industrial automation. The vast "
-"majority of the update come from western provenance.  Did the rest of the "
-"World decide to move ahead without us?"
+"types]] package.  Most [changes](https://metadata.ftp-master.debian.org/"
+"changelogs//main/m/media-types/media-types_5.0.0_changelog) are additions "
+"originating from recent submissions to the [IANA](https://www.iana.org/"
+"assignments/media-types). Amon the themes that caught my attention, there "
+"are telecommunications, computer security, commerce, healthcare and "
+"industrial automation. The vast majority of the update come from western "
+"provenance.  Did the rest of the World decide to move ahead without us?"

updated PO files
diff --git "a/Debian/debi\303\242neries/media-types-2022.en.po" "b/Debian/debi\303\242neries/media-types-2022.en.po"
index e201148d..f6d1d003 100644
--- "a/Debian/debi\303\242neries/media-types-2022.en.po"
+++ "b/Debian/debi\303\242neries/media-types-2022.en.po"
@@ -6,7 +6,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: \n"
-"POT-Creation-Date: 2022-02-24 12:48+0000\n"
+"POT-Creation-Date: 2022-02-24 12:59+0000\n"
 "PO-Revision-Date: 2022-02-24 21:46+0900\n"
 "Last-Translator: \n"
 "Language-Team: \n"
@@ -52,13 +52,15 @@ msgstr "[[!meta title=\"New media types in 2022\"]]\n"
 msgid ""
 "En début d'année j'ai mis à jour une centaine de [types de media](https://"
 "fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de "
-"nom de fichier dans le fichier `/etc/media.types`, distribué par le paquet "
-"[[!debpkg media-types]].  La plupart des changements sont des additions en "
-"provenance des déclarations récentes à'[IANA](https://www.iana.org/"
-"assignments/media-types).  Les thèmes les plus répendus sont les "
-"télécomunications, la sécurité informatique, le commerce, la santé, et "
-"l'automatisation industrielle.  L'énorme majorité provient du monde "
-"occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
+"nom de fichier dans le fichier `/etc/mine.types`, distribué par le paquet "
+"[[!debpkg media-types]].  La plupart des [changements](https://metadata.ftp-"
+"master.debian.org/changelogs//main/m/media-types/media-"
+"types_5.0.0_changelog)  sont des additions en provenance des déclarations "
+"récentes à'[IANA](https://www.iana.org/assignments/media-types).  Les "
+"thèmes les plus répendus sont les télécomunications, la sécurité "
+"informatique, le commerce, la santé, et l'automatisation industrielle.  "
+"L'énorme majorité provient du monde occidental.  Le reste du monde a-t-il "
+"décidé d'avancer sans nous ?"
 msgstr ""
 "At the beginning of this year I updated a hundred of [media types](https://"
 "en.wikipedia.org/wiki/Media_type) associated with file name extensions in "

Correction et lien
diff --git "a/Debian/debi\303\242neries/media-types-2022.mdwn" "b/Debian/debi\303\242neries/media-types-2022.mdwn"
index 9dc8c46c..6881159a 100644
--- "a/Debian/debi\303\242neries/media-types-2022.mdwn"
+++ "b/Debian/debi\303\242neries/media-types-2022.mdwn"
@@ -6,9 +6,10 @@
 
 En début d'année j'ai mis à jour une centaine de [types de
 media](https://fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des
-extensions de nom de fichier dans le fichier `/etc/media.types`, distribué par
-le paquet [[!debpkg media-types]].  La plupart des changements sont des
-additions en provenance des déclarations récentes
+extensions de nom de fichier dans le fichier `/etc/mine.types`, distribué par
+le paquet [[!debpkg media-types]].  La plupart des
+[changements](https://metadata.ftp-master.debian.org/changelogs//main/m/media-types/media-types_5.0.0_changelog)
+sont des additions en provenance des déclarations récentes
 à'[IANA](https://www.iana.org/assignments/media-types).  Les thèmes les plus
 répendus sont les télécomunications, la sécurité informatique, le commerce, la
 santé, et l'automatisation industrielle.  L'énorme majorité provient du monde

updated PO files
diff --git "a/Debian/debi\303\242neries/media-types-2022.en.po" "b/Debian/debi\303\242neries/media-types-2022.en.po"
index e9d52ebc..e201148d 100644
--- "a/Debian/debi\303\242neries/media-types-2022.en.po"
+++ "b/Debian/debi\303\242neries/media-types-2022.en.po"
@@ -6,14 +6,14 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: \n"
-"POT-Creation-Date: 2022-02-24 12:39+0000\n"
+"POT-Creation-Date: 2022-02-24 12:48+0000\n"
 "PO-Revision-Date: 2022-02-24 21:46+0900\n"
+"Last-Translator: \n"
+"Language-Team: \n"
 "Language: en\n"
 "MIME-Version: 1.0\n"
 "Content-Type: text/plain; charset=UTF-8\n"
 "Content-Transfer-Encoding: 8bit\n"
-"Last-Translator: \n"
-"Language-Team: \n"
 "X-Generator: Poedit 2.4.2\n"
 
 #. type: Plain text
@@ -32,21 +32,33 @@ msgid "[[!tag Debian]]\n"
 msgstr "[[!tag Debian]]\n"
 
 #. type: Plain text
-#, no-wrap
-msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
+#, fuzzy, no-wrap
+#| msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
+msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
 msgstr "[[!meta title=\"New media types in 2022\"]]\n"
 
 #. type: Plain text
+#, fuzzy
+#| msgid ""
+#| "En début d'année j'ai mis à jour une centaine de [types de media](https://"
+#| "fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de "
+#| "nom de fichier dans le fichier `/etc/media.types`, distribué par le "
+#| "paquet [[!debpkg media-types]].  La plupart des changements sont des "
+#| "additions en provenance des déclarations récentes à'[IANA](https://www."
+#| "iana.org/assignments/media-types).  Les thèmes les plus répendus sont les "
+#| "télécomunications, la sécurité informatique, le commerce, la santé, et "
+#| "l'automatisation industrielle.  L'énorme majorité provient du monde "
+#| "occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
 msgid ""
-"En début d'année j'ai mis à jour une centaine de [types de media](https://fr."
-"wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de nom de "
-"fichier dans le fichier `/etc/media.types`, distribué par le paquet [[!"
-"debpkg media-types]].  La plupart des changements sont des additions en "
-"provenance des déclarations récentes à'[IANA](https://www.iana.org/"
-"assignments/media-types).  Les thèmes les plus répendus sont les "
-"télécomunications, la sécurité informatique, le commerce, la santé, et "
-"l'automatisation industrielle.  L'énorme majorité provient du monde "
-"occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
+"En début d'année j'ai mis à jour une centaine de [types de media](https://"
+"fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de "
+"nom de fichier dans le fichier `/etc/media.types`, distribué par le paquet "
+"[[!debpkg media-types]].  La plupart des changements sont des additions en "
+"provenance des déclarations récentes à'[IANA](https://www.iana.org/"
+"assignments/media-types).  Les thèmes les plus répendus sont les "
+"télécomunications, la sécurité informatique, le commerce, la santé, et "
+"l'automatisation industrielle.  L'énorme majorité provient du monde "
+"occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
 msgstr ""
 "At the beginning of this year I updated a hundred of [media types](https://"
 "en.wikipedia.org/wiki/Media_type) associated with file name extensions in "

En English
diff --git "a/Debian/debi\303\242neries/media-types-2022.en.po" "b/Debian/debi\303\242neries/media-types-2022.en.po"
index 958fd0fb..e9d52ebc 100644
--- "a/Debian/debi\303\242neries/media-types-2022.en.po"
+++ "b/Debian/debi\303\242neries/media-types-2022.en.po"
@@ -3,48 +3,57 @@
 # This file is distributed under the same license as the PACKAGE package.
 # FIRST AUTHOR <EMAIL@ADDRESS>, YEAR.
 #
-#, fuzzy
 msgid ""
 msgstr ""
-"Project-Id-Version: PACKAGE VERSION\n"
+"Project-Id-Version: \n"
 "POT-Creation-Date: 2022-02-24 12:39+0000\n"
-"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
-"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
-"Language-Team: LANGUAGE <LL@li.org>\n"
-"Language: \n"
+"PO-Revision-Date: 2022-02-24 21:46+0900\n"
+"Language: en\n"
 "MIME-Version: 1.0\n"
 "Content-Type: text/plain; charset=UTF-8\n"
 "Content-Transfer-Encoding: 8bit\n"
+"Last-Translator: \n"
+"Language-Team: \n"
+"X-Generator: Poedit 2.4.2\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!meta date=\"Thu, 24 Feb 2022 21:32:36 +0900\"]]\n"
-msgstr ""
+msgstr "[[!meta date=\"Thu, 24 Feb 2022 21:32:36 +0900\"]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!meta updated=\"Thu, 24 Feb 2022 21:32:36 +0900\"]]\n"
-msgstr ""
+msgstr "[[!meta updated=\"Thu, 24 Feb 2022 21:32:36 +0900\"]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!tag Debian]]\n"
-msgstr ""
+msgstr "[[!tag Debian]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
-msgstr ""
+msgstr "[[!meta title=\"New media types in 2022\"]]\n"
 
 #. type: Plain text
 msgid ""
-"En début d'année j'ai mis à jour une centaine de [types de "
-"media](https://fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des "
-"extensions de nom de fichier dans le fichier `/etc/media.types`, distribué "
-"par le paquet [[!debpkg media-types]].  La plupart des changements sont des "
-"additions en provenance des déclarations récentes "
-"à'[IANA](https://www.iana.org/assignments/media-types).  Les thèmes les plus "
-"répendus sont les télécomunications, la sécurité informatique, le commerce, "
-"la santé, et l'automatisation industrielle.  L'énorme majorité provient du "
-"monde occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
+"En début d'année j'ai mis à jour une centaine de [types de media](https://fr."
+"wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de nom de "
+"fichier dans le fichier `/etc/media.types`, distribué par le paquet [[!"
+"debpkg media-types]].  La plupart des changements sont des additions en "
+"provenance des déclarations récentes à'[IANA](https://www.iana.org/"
+"assignments/media-types).  Les thèmes les plus répendus sont les "
+"télécomunications, la sécurité informatique, le commerce, la santé, et "
+"l'automatisation industrielle.  L'énorme majorité provient du monde "
+"occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
 msgstr ""
+"At the beginning of this year I updated a hundred of [media types](https://"
+"en.wikipedia.org/wiki/Media_type) associated with file name extensions in "
+"the file called `/etc/mime.types`, distributed by the [[!debpkg media-"
+"types]] package.  Most changes are additions originating from recent "
+"submissions to the [IANA](https://www.iana.org/assignments/media-types). "
+"Amon the themes that caught my attention, there are telecommunications, "
+"computer security, commerce, healthcare and industrial automation. The vast "
+"majority of the update come from western provenance.  Did the rest of the "
+"World decide to move ahead without us?"

updated PO files
diff --git "a/Debian/debi\303\242neries/media-types-2022.en.po" "b/Debian/debi\303\242neries/media-types-2022.en.po"
new file mode 100644
index 00000000..958fd0fb
--- /dev/null
+++ "b/Debian/debi\303\242neries/media-types-2022.en.po"
@@ -0,0 +1,50 @@
+# SOME DESCRIPTIVE TITLE
+# Copyright (C) YEAR Free Software Foundation, Inc.
+# This file is distributed under the same license as the PACKAGE package.
+# FIRST AUTHOR <EMAIL@ADDRESS>, YEAR.
+#
+#, fuzzy
+msgid ""
+msgstr ""
+"Project-Id-Version: PACKAGE VERSION\n"
+"POT-Creation-Date: 2022-02-24 12:39+0000\n"
+"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
+"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
+"Language-Team: LANGUAGE <LL@li.org>\n"
+"Language: \n"
+"MIME-Version: 1.0\n"
+"Content-Type: text/plain; charset=UTF-8\n"
+"Content-Transfer-Encoding: 8bit\n"
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!meta date=\"Thu, 24 Feb 2022 21:32:36 +0900\"]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!meta updated=\"Thu, 24 Feb 2022 21:32:36 +0900\"]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!tag Debian]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
+msgstr ""
+
+#. type: Plain text
+msgid ""
+"En début d'année j'ai mis à jour une centaine de [types de "
+"media](https://fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des "
+"extensions de nom de fichier dans le fichier `/etc/media.types`, distribué "
+"par le paquet [[!debpkg media-types]].  La plupart des changements sont des "
+"additions en provenance des déclarations récentes "
+"à'[IANA](https://www.iana.org/assignments/media-types).  Les thèmes les plus "
+"répendus sont les télécomunications, la sécurité informatique, le commerce, "
+"la santé, et l'automatisation industrielle.  L'énorme majorité provient du "
+"monde occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
+msgstr ""

Le type média nouveau est arrivé
diff --git "a/Debian/debi\303\242neries/media-types-2022.mdwn" "b/Debian/debi\303\242neries/media-types-2022.mdwn"
new file mode 100644
index 00000000..9dc8c46c
--- /dev/null
+++ "b/Debian/debi\303\242neries/media-types-2022.mdwn"
@@ -0,0 +1,15 @@
+[[!meta date="Thu, 24 Feb 2022 21:32:36 +0900"]]
+[[!meta updated="Thu, 24 Feb 2022 21:32:36 +0900"]]
+[[!tag Debian]]
+
+[[!meta title="Types media, cuvée 2022"]]
+
+En début d'année j'ai mis à jour une centaine de [types de
+media](https://fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des
+extensions de nom de fichier dans le fichier `/etc/media.types`, distribué par
+le paquet [[!debpkg media-types]].  La plupart des changements sont des
+additions en provenance des déclarations récentes
+à'[IANA](https://www.iana.org/assignments/media-types).  Les thèmes les plus
+répendus sont les télécomunications, la sécurité informatique, le commerce, la
+santé, et l'automatisation industrielle.  L'énorme majorité provient du monde
+occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?

Café
diff --git a/biblio/10.1101_817783.mdwn b/biblio/10.1101_817783.mdwn
deleted file mode 100644
index 19aeb21e..00000000
--- a/biblio/10.1101_817783.mdwn
+++ /dev/null
@@ -1,10 +0,0 @@
-[[!meta title="Evolution of multiple CDK1 paralogs towards specializations in late cell cycle events in a lineage with fast developing planktonic embryos."]]
-[[!tag Oikopleura bioRxiv]]
-
-bioRxiv 817783; doi: https://doi.org/10.1101/817783 
-
-Xiaofei Ma. Jan Inge Øvrebø, Eric M Thompson.
-
-Evolution of multiple CDK1 paralogs towards specializations in late cell cycle events in a lineage with fast developing planktonic embryos.
-
-[[!doi 10.1101/817783 desc="“Interspecies clustering of CDK1 paralogs [show] conservation of their intron-exon structures”  “_O. dioica_ CDK1a and b locate on the same autosome whereas CDK1c is present on a different autosome that also contains CDK1e. CDK1d is found on the X chromosome where, at a distance of 5 MB, the CycBa locus is also located.”  “The PSTAIRE helix is modified in all Oikopleura CDK1 paralogs whereas Oikopleura CDK2s retain the canonical PSTAIRE sequence. All of the 17 identified Oikopleura CDK1 sequences share the A48S substitution.”"]]
diff --git a/biblio/35155443.mdwn b/biblio/35155443.mdwn
index 17fb5b87..b72efcd0 100644
--- a/biblio/35155443.mdwn
+++ b/biblio/35155443.mdwn
@@ -7,10 +7,17 @@ Front Cell Dev Biol. 2022 Jan 28;9:770939. doi:10.3389/fcell.2021.770939
 
 Evolution of CDK1 Paralog Specializations in a Lineage With Fast Developing Planktonic Embryos.
 
-[[!pmid desc="The last common ancestors of all oiks probably had only one CDK1
-as _Fritillaria borealis_ also has only 1.  Oiks in general have 3 paralogs
-(_a_, _b_, _c_), and _O. dioica_ has 5 (_a_, _b_, _c_, plus _d_ and _e_ which
-appear to originate from _c_).  They are found on chr1 (_c_, _e_), chr2, (_a_,
-_b_) and the XSR of chr3 (_d_).  CycBa is also found on the XSR, and interacts
-with CDK1d for functions essential to meiosis of oocytes.  In contrary to the
-ancestral CDK1 in other animals, the levels of CDK1d oscillate."]]
+[[!pmid 35155443 desc="The last common ancestors of all oiks probably had only
+one CDK1 as _Fritillaria borealis_ also has only 1.  Oiks in general have 3
+paralogs (_a_, _b_, _c_), and _O. dioica_ has 5 (_a_, _b_, _c_, plus _d_ and
+_e_ which appear to originate from _c_).  They are found on chr1 (_c_, _e_),
+chr2, (_a_, _b_) and the XSR of chr3 (_d_).  CycBa is also found on the XSR,
+and interacts with CDK1d for functions essential to meiosis of oocytes.  In
+contrary to the ancestral CDK1 in other animals, the levels of CDK1d oscillate.
+“Interspecies clustering of CDK1 paralogs [show] conservation of their
+intron-exon structures” “O. dioica CDK1a and b locate on the same autosome
+whereas CDK1c is present on a different autosome that also contains CDK1e.
+CDK1d is found on the X chromosome where, at a distance of 5 MB, the CycBa
+locus is also located.” “The PSTAIRE helix is modified in all Oikopleura CDK1
+paralogs whereas Oikopleura CDK2s retain the canonical PSTAIRE sequence. All of
+the 17 identified Oikopleura CDK1 sequences share the A48S substitution.”"]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index a05e4d9f..246fb151 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -211,7 +211,7 @@ Genes and pathways
    [[Feng & Thompson, 2018|biblio/29969934]]).
  - _O. dioica_ CDK1a and b locate on LG2; CDK1c and is CDK1e on LG1.
    CDK1d is on the X chromosome near CycBa.  In _O. albicans_, CDK1a,b and c are
-   on the same chromosome ([[Ma, Øvrebø and Thompson, 2019|biblio/10.1101_817783]]).
+   on the same chromosome ([[Ma, Øvrebø and Thompson, 2022|biblio/35155443]]),
  - _O. dioica_, like other deuterostomes, has acid-sensing ion channels (ASICs).
    They are expressed in the nervous system ([[Lynagh et al., 2018|biblio/30061402]]).
  - Some muscle genes were duplicated in the _Oikopleura_ stem lineage

Café
diff --git a/biblio/35155443.mdwn b/biblio/35155443.mdwn
new file mode 100644
index 00000000..17fb5b87
--- /dev/null
+++ b/biblio/35155443.mdwn
@@ -0,0 +1,16 @@
+[[!meta title="Evolution of CDK1 Paralog Specializations in a Lineage With Fast Developing Planktonic Embryos."]]
+[[!tag Oikopleura cell_cycle H3S28p]]
+
+Ma X, Øvrebø JI, Thompson EM. 
+
+Front Cell Dev Biol. 2022 Jan 28;9:770939. doi:10.3389/fcell.2021.770939
+
+Evolution of CDK1 Paralog Specializations in a Lineage With Fast Developing Planktonic Embryos.
+
+[[!pmid desc="The last common ancestors of all oiks probably had only one CDK1
+as _Fritillaria borealis_ also has only 1.  Oiks in general have 3 paralogs
+(_a_, _b_, _c_), and _O. dioica_ has 5 (_a_, _b_, _c_, plus _d_ and _e_ which
+appear to originate from _c_).  They are found on chr1 (_c_, _e_), chr2, (_a_,
+_b_) and the XSR of chr3 (_d_).  CycBa is also found on the XSR, and interacts
+with CDK1d for functions essential to meiosis of oocytes.  In contrary to the
+ancestral CDK1 in other animals, the levels of CDK1d oscillate."]]
diff --git a/tags/H3S28p.mdwn b/tags/H3S28p.mdwn
index f906bf6c..1963c8f2 100644
--- a/tags/H3S28p.mdwn
+++ b/tags/H3S28p.mdwn
@@ -40,6 +40,9 @@ punctate centromere staining at ”late prophase“, a stronger signal (but hard
 to resolve) at metaphase, a weaker signal at anaphase and a weaker or no signal
 at telophase.  Table S1, listing the antibodies used, is missing.
 
+In [[Ma, Øvrebø, and Thompson, 2022|biblio/35155443]] Figure S6, the Abcam
+ab10543 antibody makes broad dots from interphase to meta/anaphase in tadpoles.
+
 The rat monoclonal antibody (Abcam ab10543) stains the centromere-attracting
 body in _O. dioica_, Osaka lab. strain. ([[Nishida and coll.,
 2021|biblio/34755656]]), probably by cross-reactivity.

LAST
diff --git a/biblio/33346833.mdwn b/biblio/33346833.mdwn
new file mode 100644
index 00000000..f27e4371
--- /dev/null
+++ b/biblio/33346833.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Minimally-overlapping words for sequence similarity search."]]
+[[!tag LAST method software alignment]]
+
+Frith MC, Noé L, Kucherov G.
+
+Bioinformatics. 2020 Dec 21;36(22-23):5344–50. doi:10.1093/bioinformatics/btaa1054.
+
+Minimally-overlapping words for sequence similarity search.
+
+[[!pmid 33346833 desc="Sparse seeds made of minimally overlapping words improve the speed with a good tradeoff on sensitivity.  Describes the seeds RY4, …, RY32 used in LAST."]]
diff --git a/tags/LAST.mdwn b/tags/LAST.mdwn
index 49e93fcd..f8ec88ea 100644
--- a/tags/LAST.mdwn
+++ b/tags/LAST.mdwn
@@ -2,8 +2,11 @@
 
 _bibliography in progress..._
 
- - `lastdb` can use various seeding schemes to build its index.
-    [[Frith and Noé (2014)|biblio/24493737]] discuss some of them.
+ - `lastdb` can use various seeding schemes to build its index.  [[Frith and
+   Noé (2014)|biblio/24493737]] discuss some of them.  The `RY` seeds are made
+   of non-overlapping words using the two-letter alphabet `R` = `A|G`, `Y` =
+   `C|T`, to increase speed with a good tradeoff in sensitivity
+   ([[Frith MC, Noé L, Kucherov G, 2020|biblio/33346833]]).
 
  - `last-postmask` ([[Frith, 2011|biblio/22205972]]): discards alignments that
    contain a significant amount of lower-case-masked sequences.

Café
diff --git a/biblio/35108053.mdwn b/biblio/35108053.mdwn
new file mode 100644
index 00000000..00ad2619
--- /dev/null
+++ b/biblio/35108053.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Deeply conserved synteny and the evolution of metazoan chromosomes."]]
+[[!tag synteny]]
+
+Simakov O, Bredeson J, Berkoff K, Marletaz F, Mitros T, Schultz DT, O'Connell BL, Dear P, Martinez DE, Steele RE, Green RE, David CN, Rokhsar DS.
+
+Sci Adv. 2022 Feb 4;8(5):eabi5884. doi:10.1126/sciadv.abi5884
+
+Deeply conserved synteny and the evolution of metazoan chromosomes.
+
+[[!pmid 35108053 desc="29 ancestral linkage groups (ALG) or 24 bilaterian linkage groups, containg usually less than 100 genes.  Karyotypes change by insertion, fusion or "fusion with mixing" between chromosomes.  Traces of conserved synteny with unicellular genomes (choanoflagellates, ichtyosporeans) were found.]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 4f928e37..2b6a156f 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -65,6 +65,9 @@ phenomenon “mesosynteny”.
 
  - The ancestral amniote has 49 chromosomes ([[Sacerdot and coll., 2018|biblio/30333059]]).
 
+ - The ancestral bilaterian had 24 linkage groups according to [[Simakov and
+   coll., 2022|biblio/35108053]].
+
 ### Computational aspects
 
  - [[Rocha (2003)|biblio/14585609]] defines a Gene Order Conservation (GOC)

Café
diff --git a/biblio/34815308.mdwn b/biblio/34815308.mdwn
new file mode 100644
index 00000000..8bb38495
--- /dev/null
+++ b/biblio/34815308.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Comprehensive determination of transcription start sites derived from all RNA polymerases using ReCappable-seq."]]
+[[!tag library method]]
+
+Yan B, Tzertzinis G, Schildkraut I, Ettwiller L.
+
+Genome Res. 2021 Nov 23. doi:10.1101/gr.275784.121
+
+Comprehensive determination of transcription start sites derived from all RNA polymerases using ReCappable-seq.
+
+[[!pmid 34815308 desc="5 µg of total RNAs was decapped with the the yeast scavenger decapping enzyme (yDcpS), and recapped with vaccinia capping enzyme (VCE) and a biotinylated guanosine.  Therefore the protocol enriches for capped, triphosphorylated, diphosphorylated, but not monophosphorylated RNAs.  A control library made on RNA dephosphorylated with CIP was used to infer if a TSS is driven by Pol II or Pol III.  The methyl-triphosphate cap of RN7SK resists to the CIP treatement and causes it to be incorrectly classified Pol II."]]

CNEr
diff --git a/biblio/31449516.mdwn b/biblio/31449516.mdwn
new file mode 100644
index 00000000..b23382ea
--- /dev/null
+++ b/biblio/31449516.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="CNEr: A toolkit for exploring extreme noncoding conservation."]]
+[[!tag enhancer software ]]
+
+Tan G, Polychronopoulos D, Lenhard B.
+
+PLoS Comput Biol. 2019 Aug 26;15(8):e1006940.
+
+CNEr: A toolkit for exploring extreme noncoding conservation.
+
+[[!pmid 31449516 desc="Takes genome alignments in Axt format as input."]]
diff --git a/tags/assembly.mdwn b/tags/assembly.mdwn
index bafbfec1..987f4ede 100644
--- a/tags/assembly.mdwn
+++ b/tags/assembly.mdwn
@@ -77,7 +77,8 @@ and coll., 2015|biblio/25940625]], Marie-Nelly and coll., 2014(not read)).
 
 Assemblies can be aligned with [[last-dotplot|LAST]] or, for SVG export and
 interactive browsing with D-GENIES ([[Cabanettes and Klopp
-2018|biblio/29888139]]).
+2018|biblio/29888139]]).  The CNEr package [[Tan, Polychronopoulos and Lenhard, 2019|biblio/31449516]]
+can be used to search for conserved non-coding elements.
 
 BUSCO ([[Simão and coll., 2015|biblio/26059717]], [[Waterhouse and coll.,
 2017|biblio/29220515]]) assesses the presence of evolutionary conserved

Merge branch 'master' of ssh://charles-plessy-org.branchable.com
Café
diff --git a/biblio/18622036.mdwn b/biblio/18622036.mdwn
new file mode 100644
index 00000000..c27891eb
--- /dev/null
+++ b/biblio/18622036.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Chromosomal rearrangement inferred from comparisons of 12 Drosophila genomes."]]
+[[!tag Drosophila synteny]]
+
+Bhutkar A, Schaeffer SW, Russo SM, Xu M, Smith TF, Gelbart WM.
+
+Genetics. 2008 Jul;179(3):1657-80. doi:10.1534/genetics.107.086108
+
+Chromosomal rearrangement inferred from comparisons of 12 Drosophila genomes.
+
+[[!pmid 18622036 desc="“This analysis reveals between 42 (D. sechellia) and 1430 (D. willistoni) syntenic blocks across various species on the basis of the D. melanogaster gene order.”  “Comparison of syntenic blocks across this large genomic data set confirms that genetic elements are largely (95%) localized to the same Muller element across genus Drosophila species and paracentric inversions serve as the dominant mechanism for shuffling the order of genes along a chromosome.”  “When we infer that a breakpoint is reused we mean that two or more breakage events occurred within the nucleotide interval between blocks, but the events are not necessarily coincident within the breakpoint”"]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 4c67537f..150cfa8c 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -1,8 +1,11 @@
 [[!meta title="pages tagged synteny"]]
 
-[[Drosophila 12 Genomes Consortium (2007)|biblio/17994087]] sequenced
-across the _Drosophila_ genus and showed synteny conservation ranging
-between few large blocks with many genes to many small blocks with few genes.
+[[Drosophila 12 Genomes Consortium (2007)|biblio/17994087]] sequenced across
+the _Drosophila_ genus and showed synteny conservation ranging between few
+large blocks with many genes to many small blocks with few genes.  [[Bhuktar
+and coll. (2008)|biblio/18622036]] counted “between 42 (D. sechellia) and 1430
+(D. willistoni) syntenic blocks across various species on the basis of the D.
+melanogaster gene order”.
 
 [[Carbone and coll. (2014)|biblio/25209798]] found 96 gibbon–human synteny
 breakpoints (~30 per Gb), associated with segmental duplication or Alu element

Café
diff --git a/biblio/34934012.mdwn b/biblio/34934012.mdwn
new file mode 100644
index 00000000..cdbb799c
--- /dev/null
+++ b/biblio/34934012.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="AnchorWave: Sensitive alignment of genomes with high sequence diversity, extensive structural polymorphism, and whole-genome duplication."]]
+[[!tag genome alignment software]]
+
+Song B, Marco-Sola S, Moreto M, Johnson L, Buckler ES, Stitzer MC.
+
+Proc Natl Acad Sci U S A. 2022 Jan 4;119(1):e2113075119. doi:10.1073/pnas.2113075119
+
+AnchorWave: Sensitive alignment of genomes with high sequence diversity, extensive structural polymorphism, and whole-genome duplication. 
+
+[[!pmid desc=""1) Maps a transcriptome to its reference genome.  2) Extracts "anchor" coding sequences.  3) Searches for homologous sequences in the query genome.  4) Realigns the sequences between homologous anchors.  The so-called comparison to LAST is actually a comparison with LAST + AxtChain, that is: it does not use last-split.]]

Café
diff --git a/biblio/34755656.mdwn b/biblio/34755656.mdwn
new file mode 100644
index 00000000..ff545856
--- /dev/null
+++ b/biblio/34755656.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Germline development during embryogenesis of the larvacean, Oikopleura dioica."]]
+[[!tag Oikopleura H3S28p]]
+
+Dev Biol. 2022 Jan;481:188-200. doi:10.1016/j.ydbio.2021.10.009
+
+Nishida H, Matsuo M, Konishi S, Ohno N, Manni L, Onuma TA.
+
+Germline development during embryogenesis of the larvacean, _Oikopleura dioica_.
+
+[[!pmid 34755656 desc="Identified a CAB (centrosome-attracting body) “for the following reasons. (1) There was a clear boundary between the CAB-like region and the general cytoplasm, but the membrane structure did not surround the CAB. (2) It contained an electron-dense matrix that resembled a germplasm. (3) The region was devoid of mitochondria but contained ER. (4) It was present beneath the cell membrane, and the cell surface exhibited microvilli. (5) It was present in the germline lineage cells.”  ”The longest diameter of the CAB was approximately 10 ​μm.“  It was observed between the late 8-cell stage and some 1.5-h embryos, but not after 2h.  It was stained by the H3S28p rat monoclonal antibody (Abcam ab10543) but not by DAPI.  The _snail_ mRNA also colocalises with the CAB's H3S28p staining.  A germ body (GB) “appeared [in PGCs] 13 ​min after the 5th cleavage [and] disappeared 1.5 ​h after fertilization at 20 ​°C.  It is discussed whether the GB and the CAB are or are not the same structure."]]
diff --git a/tags/H3S28p.mdwn b/tags/H3S28p.mdwn
index 7d6c92a2..f906bf6c 100644
--- a/tags/H3S28p.mdwn
+++ b/tags/H3S28p.mdwn
@@ -40,4 +40,8 @@ punctate centromere staining at ”late prophase“, a stronger signal (but hard
 to resolve) at metaphase, a weaker signal at anaphase and a weaker or no signal
 at telophase.  Table S1, listing the antibodies used, is missing.
 
+The rat monoclonal antibody (Abcam ab10543) stains the centromere-attracting
+body in _O. dioica_, Osaka lab. strain. ([[Nishida and coll.,
+2021|biblio/34755656]]), probably by cross-reactivity.
+
 [[!inline pages="tagged(H3S28p)" limit=0]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index e4e9fcb0..a05e4d9f 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -397,6 +397,9 @@ Development
    hindbrain, and spinal cord, but not the midbrain.  No expression of
    _pax2/5/8_ is detected between the _otxa_ + _otxb_ and the _hox1_ territories.
    ([[Cañestro et al., 2005|biblio/16111672]]).
+ - A centromere-attracting body is resoponsible for asymetric cell division in
+   primordial germ cells ([[Nishida and coll., 2021|biblio/34755656]]).  The
+   _snail_ mRNA co-localises with it.
  - The _pum1_ and _vas4_ RNAs show localised expression during development. Prior
    hatching, _pum1_ is found outside the embryo ([[Olsen et al., 2018|biblio/29486709]]).
  - Duplicated developmental genes were found by [[Denoeud et al., 2010|biblio/21097902]],

Papa in the air, wohohowoooowooo
diff --git a/biblio/14500911.mdwn b/biblio/14500911.mdwn
new file mode 100644
index 00000000..b0985a4d
--- /dev/null
+++ b/biblio/14500911.mdwn
@@ -0,0 +1,18 @@
+[[!meta title="Evolution's cauldron: duplication, deletion, and rearrangement in the mouse and human genomes."]]
+[[!tag software method synteny genome alignment variants]]
+
+Kent WJ, Baertsch R, Hinrichs A, Miller W, Haussler D.
+
+Proc Natl Acad Sci U S A. 2003 Sep 30;100(20):11484-9. doi:10.1073/pnas.1932072100
+
+Evolution's cauldron: duplication, deletion, and rearrangement in the mouse and human genomes.
+
+[[!pmid 14500911 desc="Primary paper for chains and nets, built with the BLASTZ and AXTCHAIN programs.  Chains are one-to-many alignments and allow skipping over local inversions.  In human/mouse comparisons, 2.0 inversion per Mbp, median length 814.  Double gaps ≥ 100 per Mbp: 398.6, median length 411.  Chains are called “short” when their span is <100,000 bases (span distribution of short chains apparently bimodal).  579 “long” chains (average length 983 kb) cover 32.9% of the bases in the human genome.  Collectively all chains span 96.3% of the human genome and align to 34.6% of it.  The authors note that the observed distribution of gap lengths violate the usual affine model of aligners."]]
+
+“A chained alignment [is] an ordered sequence of traditional pairwise nucleotide alignments (“blocks”) separated by larger gaps, some of which may be simultaneous gaps in both species. [...] intervening DNA in one species that does not align with the other because it is locally inverted or has been inserted in by lineage-specific translocation or duplication is skipped”
+
+“The chains are then put into a list sorted with the highest-scoring chain first. [...] each iteration taking the next chain off of the list, throwing out the parts of the chain that intersect with bases already covered by previously taken chains, and then marking the bases that are left in the chain as covered. [...] If a chain covers bases that are in a gap in a previously taken chain, it is marked as a child of the previous chain. In this way, a hierarchy of chains is formed that we call a net.”
+
+“To be considered syntenic, a chain has to either have a very high score itself or be embedded in a larger chain, on the same chromosome, and come from the same region as the larger chain. Thus, inversions and tandem duplications are considered syntenic.”
+
+“We define the (human) span of a chain to be the distance in bases in the human genome from the first to the last human base in the chain, including gaps, and we define the size of the chain as the number of aligning bases in it, not including gaps.”
diff --git a/tags/assembly.mdwn b/tags/assembly.mdwn
index 24b4f29f..bafbfec1 100644
--- a/tags/assembly.mdwn
+++ b/tags/assembly.mdwn
@@ -92,4 +92,7 @@ by [[Hoff and Stanke, 2018|biblio/30466165]].
 A reference assembly can be used to search for structural variants in a different
 individual, for instance with NanoSV ([[Cretu Stancu and coll., 2017|biblio/29109544]]).
 
+In [[2003, Kent and coll.|biblio/14500911]] aligned the human and mouse genome
+together using the BLASTZ and AXTCHAIN software.
+
 [[!inline pages="tagged(assembly)" actions="no" limit=0]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index bc987514..a44e3cd9 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -69,4 +69,7 @@ phenomenon “mesosynteny”.
    orthologue co-occurs close by in the other genome. It varies between 0 (no
    co-occurrence) and 1 (complete gene order conservation)”.
 
+ - “Chains” and “nets” of pairwise alignements between two genomes are described
+   in [[Kent and coll, 2003|biblio/14500911]].
+
 [[!inline pages="tagged(synteny)" limit=0]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 75e312bd..5562a25e 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -38,6 +38,9 @@ supported by [[Steinberg and coll in 2012|biblio/22751100]].
 Ectopic recombination of a Galileo element may have caused a recent large-scale
 inversion in _D. buzzati_ ([[Delprat and coll, 2009|biblio/19936241]]).
 
+[[Kent and coll., 2003|biblio/14500911]] reported 2 inversions per Mbp in
+human/mouse comparisons, median length 814. 
+
 ### Software
 
  - _NanoSV_ ([[Cretu Stancu and coll., 2017|biblio/29109544]]) uses nanopore long

mesosynteny
diff --git a/biblio/21605470.mdwn b/biblio/21605470.mdwn
new file mode 100644
index 00000000..62caf98e
--- /dev/null
+++ b/biblio/21605470.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="A novel mode of chromosomal evolution peculiar to filamentous Ascomycete fungi."]]
+[[!tag yeast synteny]]
+
+Hane JK, Rouxel T, Howlett BJ, Kema GH, Goodwin SB, Oliver RP.
+
+Genome Biol. 2011;12(5):R45. doi:10.1186/gb-2011-12-5-r45
+
+A novel mode of chromosomal evolution peculiar to filamentous Ascomycete fungi.
+
+[[!pmid 21605470 desc="Defines “mesosynteny” as the phenomonon seen when gene order varies at the scale of whole chromosomes, but gene content of homologous chromosomes does not vary much.  Reports that in fungi, mesosynteny is found in filamentous Ascomycetes but not in other clades such as yeast.  Concludes on the possibility that inversions play a role in mesosynteny."]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 4c67537f..bc987514 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -40,6 +40,11 @@ and are estimated to be of 2 rearrangements/Myr”.  They defined synteny as
 “series of neighboring pairs of orthologs separated by less than 5
 nonneighboring reciprocal best-hits”.
 
+[[Hane and coll, 2011|biblio/21605470]] noted that in filamentous Ascomycetes,
+but not other fungi such as yeast, “genes are conserved within homologous
+chromosomes, but with randomized orders and orientations“ and call that
+phenomenon “mesosynteny”.
+
 ### Ancestral karyotpyes
 
  - The ancestral mammalian genome has 30 chromosomes ([[Zhou and coll., 2021|biblio/33408411]]).

yeaset
diff --git a/biblio/21819944.mdwn b/biblio/21819944.mdwn
new file mode 100644
index 00000000..8c5f03b5
--- /dev/null
+++ b/biblio/21819944.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Comparative study on synteny between yeasts and vertebrates."]]
+[[!tag yeast synteny]]
+
+Drillon G, Fischer G.
+
+C R Biol. 2011 Aug-Sep;334(8-9):629-38. doi:10.1016/j.crvi.2011.05.011
+
+Comparative study on synteny between yeasts and vertebrates.
+
+[[!pmid 21819944 desc="“Synteny blocks were defined as series of neighboring pairs of orthologs separated by less than 5 nonneighboring reciprocal best-hits in the two compared genomes.”  “In vertebrates, the number of synteny blocks increases exponentially with increasing divergence time, varying from a very small number of blocks, 43 between human and chimpanzee, to more than 1900 blocks between dog and zebrafish.”    “In yeasts, the number of synteny blocks is more restrained, varying from 26 between Candida albicans and C. dubliniensis up to 744 between Debaryomyces hansenii and Pichia pastoris. The number of blocks also exponentially increases along with protein divergence but only between 8 and 36% of divergence. At increasing phylogenetic distances, the number of synteny blocks decreases.”  “For both yeast and vertebrate, the average number of shared orthologs per synteny block decreases exponentially with increasing evolutionary distance”"]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 5ec7e063..4c67537f 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -33,6 +33,13 @@ the past ~5 My.  The chinese munjak has undergone much less fusions.  In most
 cases, long-range chromosome structure (Hi-C) is not conserved between theses
 two species [[Mudd and coll, 2020|biblio/32873878]].
 
+[[Drillon and Fischer, 2011|biblio/21819944]] “studied synteny conservation
+between 18 yeast species and 13 vertebrate species” and “show that
+rearrangement rates are on average 3-fold higher in vertebrates than in yeasts,
+and are estimated to be of 2 rearrangements/Myr”.  They defined synteny as
+“series of neighboring pairs of orthologs separated by less than 5
+nonneighboring reciprocal best-hits”.
+
 ### Ancestral karyotpyes
 
  - The ancestral mammalian genome has 30 chromosomes ([[Zhou and coll., 2021|biblio/33408411]]).

Café
diff --git a/tags/Drosophila.mdwn b/tags/Drosophila.mdwn
index 3e2143f9..ac722da8 100644
--- a/tags/Drosophila.mdwn
+++ b/tags/Drosophila.mdwn
@@ -46,4 +46,9 @@ to the Arrhenius law in [[Crapse and coll., 2021|biblio/34414660]].
 Ectopic recombination of a Galileo element may have caused a recent large-scale
 inversion in _D. buzzati_ ([[Delprat and coll, 2009|biblio/19936241]]).
 
+_Drosophila_ polytene chromosomes are in Rabl confirmation in interphase:
+chromosome arms form independent topological domains, centromeres cluster on
+the nuclear envelopped, and telomeres tend to be found on the opposite
+direction ([[Mathog and coll., 1984|biblio/6424026]]).
+
 [[!inline pages="tagged(Drosophila)" limit=0]]

Café
diff --git a/biblio/6424026.mdwn b/biblio/6424026.mdwn
new file mode 100644
index 00000000..fbb1dd9f
--- /dev/null
+++ b/biblio/6424026.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Characteristic folding pattern of polytene chromosomes in Drosophila salivary gland nuclei."]]
+[[!tag Drosophila chromosome]]
+
+Mathog D, Hochstrasser M, Gruenbaum Y, Saumweber H, Sedat J.
+
+Nature. 1984 Mar 29-Apr 4;308(5958):414-21. doi:10.1038/308414a0
+
+Characteristic folding pattern of polytene chromosomes in Drosophila salivary gland nuclei. 
+
+[[!pmid 6424026 desc="_Drosophila_ polytene chromosome arms form isolated topoplogical domains in interphase.  Centromeres are clustered near the nuclear enveloppe and telomeres tend to be on the opposite side (the Rabl conformation)."]]

Café
diff --git a/biblio/19936241.mdwn b/biblio/19936241.mdwn
new file mode 100644
index 00000000..4691eb18
--- /dev/null
+++ b/biblio/19936241.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="The transposon Galileo generates natural chromosomal inversions in Drosophila by ectopic recombination."]]
+[[!tag Drosophila repeat variants]]
+
+Delprat A, Negre B, Puig M, Ruiz A.
+
+PLoS One. 2009 Nov 18;4(11):e7883. doi:10.1371/journal.pone.0007883
+
+The transposon Galileo generates natural chromosomal inversions in Drosophila by ectopic recombination.
+
+[[!pmid 19936241 desc="In _D. buzzatii_, the 2z(3) inversion is flanked by several transposable elements, among which two Galileo repeats (cut-and-paste mechanism, members of the P element family), that “(i) are inserted in opposite orientation; (ii) present exchanged target site duplications; and (iii) are both chimeric”, suggesting ectopic recombination."]]
diff --git a/tags/Drosophila.mdwn b/tags/Drosophila.mdwn
index b4ecf0d4..3e2143f9 100644
--- a/tags/Drosophila.mdwn
+++ b/tags/Drosophila.mdwn
@@ -43,4 +43,7 @@ See also [[Muller elements|muller_element]].
 _D. melanogaster_'s development time course at different temperatures was fitted
 to the Arrhenius law in [[Crapse and coll., 2021|biblio/34414660]].
 
+Ectopic recombination of a Galileo element may have caused a recent large-scale
+inversion in _D. buzzati_ ([[Delprat and coll, 2009|biblio/19936241]]).
+
 [[!inline pages="tagged(Drosophila)" limit=0]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 9bc58e57..75e312bd 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -35,6 +35,9 @@ vicinity.  [[Donelly and coll., 2010|biblio/20116045]] gave a radically lower
 time estimate of 13,600 to 108,400 years, but an ancient origin was again
 supported by [[Steinberg and coll in 2012|biblio/22751100]].
 
+Ectopic recombination of a Galileo element may have caused a recent large-scale
+inversion in _D. buzzati_ ([[Delprat and coll, 2009|biblio/19936241]]).
+
 ### Software
 
  - _NanoSV_ ([[Cretu Stancu and coll., 2017|biblio/29109544]]) uses nanopore long

ahem
diff --git a/biblio/22751100.mdwn b/biblio/22751100.mdwn
new file mode 100644
index 00000000..d0af8f66
--- /dev/null
+++ b/biblio/22751100.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Structural diversity and African origin of the 17q21.31 inversion polymorphism."]]
+[[!tag variants]]
+
+Steinberg KM, Antonacci F, Sudmant PH, Kidd JM, Campbell CD, Vives L, Malig M, Scheinfeldt L, Beggs W, Ibrahim M, Lema G, Nyambo TB, Omar SA, Bodo JM, Froment A, Donnelly MP, Kidd KK, Tishkoff SA, Eichler EE.
+
+Nat Genet. 2012 Jul 1;44(8):872-80. doi:10.1038/ng.2335
+
+Structural diversity and African origin of the 17q21.31 inversion polymorphism.
+
+[[!pmid 22751100 desc="“In conclusion, we propose that the ancestral H2′ haplotype arose in eastern or central Africa and spread to southern Africa before the emergence of anatomically modern humans (Fig. 6). Approximately 2.3 million years ago, the inversion rearranged to what we now refer as the direct orientation haplotype (H1′).”"]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 98eb189d..9bc58e57 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -32,7 +32,8 @@ suppress crossovers not only inside the inversion but also close to it (within 1
 genome and calculated that it appeared ~3 million years ago, before the
 speciation of _Homo sapiens_.  Low-copy repeated sequences were found in the
 vicinity.  [[Donelly and coll., 2010|biblio/20116045]] gave a radically lower
-time estimate of 13,600 to 108,400 years.
+time estimate of 13,600 to 108,400 years, but an ancient origin was again
+supported by [[Steinberg and coll in 2012|biblio/22751100]].
 
 ### Software
 

ahem
diff --git a/biblio/20116045.mdwn b/biblio/20116045.mdwn
new file mode 100644
index 00000000..c8987b9c
--- /dev/null
+++ b/biblio/20116045.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="The distribution and most recent common ancestor of the 17q21 inversion in humans."]]
+[[!tag variants]]
+
+Donnelly MP, Paschou P, Grigorenko E, Gurwitz D, Mehdi SQ, Kajuna SL, Barta C, Kungulilo S, Karoma NJ, Lu RB, Zhukova OV, Kim JJ, Comas D, Siniscalco M, New M, Li P, Li H, Manolopoulos VG, Speed WC, Rajeevan H, Pakstis AJ, Kidd JR, Kidd KK.
+
+Am J Hum Genet. 2010 Feb 12;86(2):161-71. doi:10.1016/j.ajhg.2010.01.007
+
+The distribution and most recent common ancestor of the 17q21 inversion in humans.
+
+[[!pmid 20116045 desc="“Short tandem repeat polymorphism data indicate a very recent date for the most recent common ancestor, with dates ranging from 13,600 to 108,400 years, depending on assumptions and estimation methods”"]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index ad55feba..98eb189d 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -31,7 +31,8 @@ suppress crossovers not only inside the inversion but also close to it (within 1
 [[Stefansson and coll, 2005||biblio/15654335]] found an inversion in the human
 genome and calculated that it appeared ~3 million years ago, before the
 speciation of _Homo sapiens_.  Low-copy repeated sequences were found in the
-vicinity.
+vicinity.  [[Donelly and coll., 2010|biblio/20116045]] gave a radically lower
+time estimate of 13,600 to 108,400 years.
 
 ### Software
 

Café
diff --git a/biblio/15654335.mdwn b/biblio/15654335.mdwn
new file mode 100644
index 00000000..e5eaa6cf
--- /dev/null
+++ b/biblio/15654335.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="A common inversion under selection in Europeans."]]
+[[!tag variants]]
+
+Stefansson H, Helgason A, Thorleifsson G, Steinthorsdottir V, Masson G, Barnard J, Baker A, Jonasdottir A, Ingason A, Gudnadottir VG, Desnica N, Hicks A, Gylfason A, Gudbjartsson DF, Jonsdottir GM, Sainz J, Agnarsson K, Birgisdottir B, Ghosh S, Olafsdottir A, Cazier JB, Kristjansson K, Frigge ML, Thorgeirsson TE, Gulcher JR, Kong A, Stefansson K.
+
+Nat Genet. 2005 Feb;37(2):129-37. doi:10.1038/ng1508
+
+A common inversion under selection in Europeans.
+
+[[!pmid 15654335 desc="A 900-kb inversion polymorphism on 17q21.31 that has diverged ~3 million years ago.  One allele is rare exept in Europe, where it is positively selected.  Low-copy repeat sequences were found in the vicinity of the inversion."]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index a89e12e0..ad55feba 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -28,6 +28,11 @@ In the _Drosophila pseudoobscura / persimilis_ species complex, chromosomal inve
 suppress crossovers not only inside the inversion but also close to it (within 1–2 Mb)”
 ([[Machado, Haselkorn and Noor (2007)|biblio/17179068])].
 
+[[Stefansson and coll, 2005||biblio/15654335]] found an inversion in the human
+genome and calculated that it appeared ~3 million years ago, before the
+speciation of _Homo sapiens_.  Low-copy repeated sequences were found in the
+vicinity.
+
 ### Software
 
  - _NanoSV_ ([[Cretu Stancu and coll., 2017|biblio/29109544]]) uses nanopore long

Encore pseudoobscura
diff --git a/biblio/J1A1AAAAMAAJ.mdwn b/biblio/J1A1AAAAMAAJ.mdwn
new file mode 100644
index 00000000..a4dbe07a
--- /dev/null
+++ b/biblio/J1A1AAAAMAAJ.mdwn
@@ -0,0 +1,26 @@
+[[!meta title="Contributions to the Genetics, Taxonomy, and Ecology of Drosophila pseudoobscura and its relatives"]]
+[[!tag Drosophila]]
+
+Theodosius Dobzhansky and Carl Epling
+
+Carnegie Institution of Washington publicatino 554, Washington,	D. C., March 31st, 1944
+
+Contributions to the Genetics, Taxonomy, and Ecology of _Drosophila pseudoobscura_ and its relatives.
+
+“It is certain that if any kind of structural difference had been known between
+_D. pseudoobscura_ and _D. persimilis_, they would have been classed as species
+from the start. Calling them races, and designating them by the letters A and B
+instead of by Latin names, was an attempt to appease conservative taxonomists
+who continue to adhere to the purely morphological concepts of species and
+race. Such a course is neither scientifically consistent nor practically sound.
+The species is the stage in the process of evolutionary divergence at which an
+array of populations once actually interbreeding or capable of interbreeding
+has become split into two or more reproductively isolated arrays. Species exist
+in nature regardless of whether we can or cannot distinguish them by their
+structural characters.  There is no doubt that the great majority of animal and
+plant species differ structurally, and that they can be conveniently, and in
+most cases readily, recognized and delimited by their morphology alone. But it
+does not follow that any and all species are recognizable by their externally
+visible structures.”
+
+<https://books.google.com/books?id=J1A1AAAAMAAJ>
diff --git a/tags/Drosophila.mdwn b/tags/Drosophila.mdwn
index 43bf95af..b4ecf0d4 100644
--- a/tags/Drosophila.mdwn
+++ b/tags/Drosophila.mdwn
@@ -20,9 +20,10 @@ describe them as a network of successive large-scale inversions.  They also
 showed that the gene order of the X2 chromosome of _D. miranda_ is homologoues
 to the one of the hypothetical ancestor of chromosome 3 in _D. Pseudoobscura_.
 
-"Race B" of _D. pseudoobscura_ is now called "D. persimilis".  For some time
-it was thought that there are no morphological differences, but it was
-later found that the size of their penis differs ([[Rizki MT, 1951|biblio/14808171]]).
+"Race B" of _D. pseudoobscura_ is now called "D. persimilis" ([[Dobzhansky and
+Epling, 1944|biblio/J1A1AAAAMAAJ]]).  For some time it was thought that there
+are no morphological differences, but it was later found that the size of their
+penis differs ([[Rizki MT, 1951|biblio/14808171]]).
 
 ### Other
 

oops
diff --git a/biblio/16545148.mdwn b/biblio/16545148.mdwn
deleted file mode 100644
index d2383fc8..00000000
--- a/biblio/16545148.mdwn
+++ /dev/null
@@ -1,10 +0,0 @@
-[[!meta title="A recombinational portrait of the Drosophila pseudoobscura genome."]]
-[[!tag Drosophila variants]]
-
-Ortiz-Barrientos D, Chang AS, Noor MA.
-
-Genet Res. 2006 Feb;87(1):23-31. doi:10.1017/S0016672306007932
-
-A recombinational portrait of the _Drosophila pseudoobscura_ genome.
-
-[[!pmid 16545148 desc="“suppression of crossovers in inversion heterozygotes also extends to loci located outside the inversion but close to it (within 1–2 Mb)”"]]

oops
diff --git a/biblio/17179068.mdwn b/biblio/17179068.mdwn
new file mode 100644
index 00000000..f90cd25a
--- /dev/null
+++ b/biblio/17179068.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Evaluation of the genomic extent of effects of fixed inversion differences on intraspecific variation and interspecific gene flow in Drosophila pseudoobscura and D. persimilis."]]
+[[!tag Drosophila variants]]
+
+Machado CA, Haselkorn TS, Noor MA.
+
+Genetics. 2007 Mar;175(3):1289-306. doi:10.1534/genetics.106.064758
+
+Evaluation of the genomic extent of effects of fixed inversion differences on intraspecific variation and interspecific gene flow in _Drosophila pseudoobscura_ and _D. persimilis_.
+
+[[!pmid 17179068 desc="“suppression of crossovers in inversion heterozygotes also extends to loci located outside the inversion but close to it (within 1–2 Mb)”"]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 9b75127b..a89e12e0 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -26,7 +26,7 @@ Sturtevant|biblio/17246876]] in _D. pseudoobscura_.
 
 In the _Drosophila pseudoobscura / persimilis_ species complex, chromosomal inversions
 suppress crossovers not only inside the inversion but also close to it (within 1–2 Mb)”
-([[Ortiz-Barrientos, Chang and Noor (2006)|biblio/16545148])]
+([[Machado, Haselkorn and Noor (2007)|biblio/17179068])].
 
 ### Software
 

Encore pseudoobscura
diff --git a/biblio/16545148.mdwn b/biblio/16545148.mdwn
new file mode 100644
index 00000000..d2383fc8
--- /dev/null
+++ b/biblio/16545148.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="A recombinational portrait of the Drosophila pseudoobscura genome."]]
+[[!tag Drosophila variants]]
+
+Ortiz-Barrientos D, Chang AS, Noor MA.
+
+Genet Res. 2006 Feb;87(1):23-31. doi:10.1017/S0016672306007932
+
+A recombinational portrait of the _Drosophila pseudoobscura_ genome.
+
+[[!pmid 16545148 desc="“suppression of crossovers in inversion heterozygotes also extends to loci located outside the inversion but close to it (within 1–2 Mb)”"]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 02a2d4fd..9b75127b 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -24,6 +24,9 @@ A collection of gene arrangements where each pair is related is related by a
 single large-scale inversion was found by [[Dobzhansky and
 Sturtevant|biblio/17246876]] in _D. pseudoobscura_.
 
+In the _Drosophila pseudoobscura / persimilis_ species complex, chromosomal inversions
+suppress crossovers not only inside the inversion but also close to it (within 1–2 Mb)”
+([[Ortiz-Barrientos, Chang and Noor (2006)|biblio/16545148])]
 
 ### Software
 

Encore pseudoobscura
diff --git a/biblio/14808171.mdwn b/biblio/14808171.mdwn
new file mode 100644
index 00000000..4e21b8d5
--- /dev/null
+++ b/biblio/14808171.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Morphological differences between two sibling species; Drosophila pseudoobscura and Drosophila persimilis"]]
+[[!tag Drosophila]]
+
+Rizki MT
+
+Proc Natl Acad Sci U S A. 1951 Mar;37(3):156-9. doi:10.1073/pnas.37.3.156
+
+Morphological differences between two sibling species; _Drosophila pseudoobscura_ and _Drosophila persimilis_.
+
+[[!pmid 14808171 desc="The first morphological difference that distinguishes _D. persimilis_ from _D. pseudoobscura_: penis size."]]
diff --git a/tags/Drosophila.mdwn b/tags/Drosophila.mdwn
index 7f1fa583..43bf95af 100644
--- a/tags/Drosophila.mdwn
+++ b/tags/Drosophila.mdwn
@@ -2,6 +2,8 @@
 
 **  Work in progress **
 
+### _pseudoobscura_
+
 Analysis of Cox2 sequences of _Drosophila_ species by [[Beckenbach, Wei and Liu
 (1993)|biblio/8393127]] are most compatible with a speciation of _D.
 melanogaster_ and _D. pseudoobscura_ ~35 My ago.  Sequence divergence between
@@ -18,6 +20,12 @@ describe them as a network of successive large-scale inversions.  They also
 showed that the gene order of the X2 chromosome of _D. miranda_ is homologoues
 to the one of the hypothetical ancestor of chromosome 3 in _D. Pseudoobscura_.
 
+"Race B" of _D. pseudoobscura_ is now called "D. persimilis".  For some time
+it was thought that there are no morphological differences, but it was
+later found that the size of their penis differs ([[Rizki MT, 1951|biblio/14808171]]).
+
+### Other
+
 The ITS2 sequence of Drosophila species diverged at the speed of 1.2 % per million
 year ([[Schlötterer and coll., 1994|biblio/8015444]]).
 

Café
diff --git a/biblio/17246876.mdwn b/biblio/17246876.mdwn
new file mode 100644
index 00000000..d1e9ad3a
--- /dev/null
+++ b/biblio/17246876.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Inversions in the Chromosomes of Drosophila Pseudoobscura."]]
+[[!tag Drosophila variants]]
+
+Dobzhansky T, Sturtevant AH
+
+Genetics. 1938 Jan;23(1):28-64. doi:10.1093/genetics/23.1.28
+
+Inversions in the Chromosomes of Drosophila Pseudoobscura.
+
+[[!pmid 17246876 desc="Observation of polytene chromosomes in salivary glands of hybrid _D. pseudoobscura_ crossed form different populations showed lage-scale inversions in the 3rd chromosome.  The collection of haplotypes can be represented as a graph linking single inversion events.  Multiple haplotypes may coexist in the same geographical region."]]
diff --git a/tags/Drosophila.mdwn b/tags/Drosophila.mdwn
index ca999b86..7f1fa583 100644
--- a/tags/Drosophila.mdwn
+++ b/tags/Drosophila.mdwn
@@ -12,6 +12,12 @@ and Nei  (1995)|biblio/7739381]]) suggests that D. mel and D. pseudoobscura
 diverged 24.9 +/- 2.88 My ago, based on the assumption that D. picticornis and
 D. silvestris diverged 5.1 My ago.
 
+Variations of the gene order in the chromosome 3 of _D. Pseudoobscura_ were
+reported by [[Dobzhansky and Sturtevant|biblio/17246876]] in 1938, who could
+describe them as a network of successive large-scale inversions.  They also
+showed that the gene order of the X2 chromosome of _D. miranda_ is homologoues
+to the one of the hypothetical ancestor of chromosome 3 in _D. Pseudoobscura_.
+
 The ITS2 sequence of Drosophila species diverged at the speed of 1.2 % per million
 year ([[Schlötterer and coll., 1994|biblio/8015444]]).
 
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 3b21c19f..02a2d4fd 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -15,11 +15,16 @@ selection and increased genetic load in inversions and other types of variants
 [[Hämälä and coll., 2021|biblio/34408075]].
 
 ~1100 small-scale inversions are estimated to have happened between _S.
-cerevisiae_ and _C. albicans_ ([[|biblio/11087826]]).  The authors propose that
+cerevisiae_ and _C. albicans_ ([[Seoighe and coll., 2000|biblio/11087826]]).  The authors propose that
 “successive multigene inversions” have “distrupted” the “precise arrangement”
 of “genes that are adjacent in one species are in the same neighborhood”.  A
 “bias toward small inversions” is reported.
 
+A collection of gene arrangements where each pair is related is related by a
+single large-scale inversion was found by [[Dobzhansky and
+Sturtevant|biblio/17246876]] in _D. pseudoobscura_.
+
+
 ### Software
 
  - _NanoSV_ ([[Cretu Stancu and coll., 2017|biblio/29109544]]) uses nanopore long

Kiwi
diff --git a/biblio/34320186.mdwn b/biblio/34320186.mdwn
new file mode 100644
index 00000000..4a4d3a37
--- /dev/null
+++ b/biblio/34320186.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="BUSCO Update: Novel and Streamlined Workflows along with Broader and Deeper Phylogenetic Coverage for Scoring of Eukaryotic, Prokaryotic, and Viral Genomes."]]
+[[!tag annotation software]]
+
+Manni M, Berkeley MR, Seppey M, Simão FA, Zdobnov EM.
+
+Mol Biol Evol. 2021 Sep 27;38(10):4647-4654. doi:10.1093/molbev/msab199
+
+BUSCO Update: Novel and Streamlined Workflows along with Broader and Deeper Phylogenetic Coverage for Scoring of Eukaryotic, Prokaryotic, and Viral Genomes. 
+
+[[!pmid 34320186 desc="Based on OrthoDB v10.  Uses MetaEuk by default on eukaryotes, but AUGUSTUS is still available."]]
diff --git a/tags/assembly.mdwn b/tags/assembly.mdwn
index 0ed2af28..24b4f29f 100644
--- a/tags/assembly.mdwn
+++ b/tags/assembly.mdwn
@@ -80,12 +80,14 @@ interactive browsing with D-GENIES ([[Cabanettes and Klopp
 2018|biblio/29888139]]).
 
 BUSCO ([[Simão and coll., 2015|biblio/26059717]], [[Waterhouse and coll.,
-2017|biblio/29220515]]) assesses the presence of evolutionary conserved single-copy
-genes in the assemblies.  Seppey, Manni and Zdobnov EM ([[2019|biblio/31020564]])
-wrote a good introduction in _Methods Mol Biol_.
-
-BUSCO uses AUGUSTUS, and AUGUSTUS can be trained for a new species with
-transcriptome data, as explained by [[Hoff and Stanke, 2018|biblio/30466165]].
+2017|biblio/29220515]]) assesses the presence of evolutionary conserved
+single-copy genes in the assemblies.  Seppey, Manni and Zdobnov EM
+([[2019|biblio/31020564]]) wrote a good introduction in _Methods Mol Biol_.
+BUSCO v5 is based on OrthoDB v10, and support MetaEuk (default) and AUGUSTUS
+for eukaryotes [[Manni and coll., 2021|biblio/34320186]].
+
+AUGUSTUS can be trained for a new species with transcriptome data, as explained
+by [[Hoff and Stanke, 2018|biblio/30466165]].
 
 A reference assembly can be used to search for structural variants in a different
 individual, for instance with NanoSV ([[Cretu Stancu and coll., 2017|biblio/29109544]]).

Café
diff --git a/tags/Ciona.mdwn b/tags/Ciona.mdwn
index 62966202..2ac8eea9 100644
--- a/tags/Ciona.mdwn
+++ b/tags/Ciona.mdwn
@@ -42,6 +42,15 @@ were F1 and of _C. int_ maternal origin.  [[Ohta and coll,
 (CA) and _C. int_ from Woods Hole (MA), but viability was reduced, especially
 when maternal or grand-maternal origin was _C. int_.
 
+Non-read papers related to the _rob_-_int_ speciation: Primary Genetic Linkage
+Maps of the Ascidian, Ciona intestinalis. Shungo Kano, Nori Satoh, Paolo
+Sordino. Zoological Science, 23(1):31-39 (2006).
+https://doi.org/10.2108/zsj.23.31; Symmetrical Reproductive Compatibility of
+Two Species in the Ciona intestinalis (Ascidiacea) Species Complex, a Model for
+Marine Genomics and Developmental Biology. Atsuko Sato, Sebastian M. Shimeld,
+John D. D. Bishop. Zoological Science, 31(6):369-374 (2014).
+https://doi.org/10.2108/zs130249 
+
 _C. roulei_ can cross-hybridise easily with _C. intestinalis_, suggesting
 that they are the same species ([[Malfant, Darras and Viart, 2018|biblio/29367599]]).
 

Café
diff --git a/biblio/32518083.mdwn b/biblio/32518083.mdwn
new file mode 100644
index 00000000..318d4c32
--- /dev/null
+++ b/biblio/32518083.mdwn
@@ -0,0 +1,25 @@
+[[!meta title="Asymmetric Fitness of Second-Generation Interspecific Hybrids Between _Ciona robusta_ and _Ciona intestinalis_."]]
+[[!tag Ciona speciation]]
+
+Ohta N, Kaplan N, Ng JT, Gravez BJ, Christiaen L.
+
+G3 (Bethesda). 2020 Aug 5;10(8):2697-2711. doi:10.1534/g3.120.401427
+
+Asymmetric Fitness of Second-Generation Interspecific Hybrids Between _Ciona robusta_ and _Ciona intestinalis_.
+
+[[!pmid 32518083 desc="Comprehensive introduction on _intestinalis_-_robusta_ taxonomic situation.  Conclusions weakened by the the absence of homotypic F2 _C. intestinalis animals_ caused by the failure of _C. intestinalis_ to reproduce in the culture system.  The viability and fertility hybrids born from _intestinalis_ oocytes or _robusta_ (sperm) x _intestinalis_ (oocytes) oocytes is reduced."]]
+
+“Wild-type Ciona robusta (C. intestinalis type A) and Ciona intestinalis (C. intestinalis type B) adults were collected in San Diego (CA) and Woods Hole (MA)”.  “Sea water (Bio-Actif Salt, Tropic Marin) was controlled by bio-balls (Biomate, Lifegard Aquatics) seeded with bacteria (BioDigest, Prodibio)”.  “We obtained hundreds of swimming larvae from each cross [..] this contrasts with previous studies, which suggested that C. robusta oocytes were largely refractory to fertilization by C. intestinalis sperm”.  “there were no significant differences in the survival rate between F1 RxI and IxR hybrids”.  “By 50 dpf, half of the C. robusta individuals were producing sperm, whereas that proportion dropped significantly for the other groups of animals.”
+
+”For both RxI and IxR hybrids, the majority of animals had [orange pigment organ] at the tip of the sperm duct, in agreement with a previous report (Sato et al. 2014), thus indicating that [orange pigment organ] formation is a dominant trait.”
+
+”C. intestinalis has yellow and orange pigmentation around the tip of siphons that is lacking in C. robusta [...] the majority of RxI and IxR hybrids displayed a bright red pigmentation at the rim of oral and atrial siphons, also consistent with a previous report (Sato et al. 2014). The observation that siphon pigmentation displays an overdominant phenotype in hybrids is consistent with its lack of reliability for taxonomic purposes.“
+
+“the sperm of F1 RxI hybrid appeared less potent to fertilize C. robusta eggs than that of F1 IxR hybrids, which is reminiscent of previously reported difficulties in using C. robusta eggs in interspecific fertilizations.”  “Both BC1 (RxI)xR and (IxR)xR hybrids had lower survival rates than F2 C. robusta animals, while an ANOVA did not show significant differences in survival rate on 28 and 50 dpf between (RxI)xR and (IxR)xR hybrids.”
+
+“We obtained sperm from 7 and 10 individuals, and eggs from 7 and 11 F1 RxI and IxR mature animals, respectively, and used them for within-type fertilizations. Fertilization rates were significantly higher for IxR hybrids than for RxI hybrids” 
+
+“Finally, F2 IxR hybrids grew and matured to produce sperm and eggs (Table 5 and Supplemental table S3). The sperm and eggs could fertilize each other to produce F3 IxR hybrids, which survived at least 28 dpf, after which we stopped observations.”
+
+“simple quantitative traits, such as body size, showed an increased variability in F2 hybrids as expected for polygenic traits following allele segregation.”
+
diff --git a/tags/Ciona.mdwn b/tags/Ciona.mdwn
index f8d5002c..62966202 100644
--- a/tags/Ciona.mdwn
+++ b/tags/Ciona.mdwn
@@ -37,7 +37,10 @@ Hybrids were infertile and a _C. rob_ - _C. int_ cross from two sympatric
 strains from Plymouth did not develop beyond cleavage ([[Caputi and coll.,
 2007|biblio/17517633]]).  In line with this, the only hybdids found by the SNP
 analysis of wild animals of ([[Bouchemousse and coll., 2016|biblio/27662427]])
-were F1 and of _C. int_ maternal origin.
+were F1 and of _C. int_ maternal origin.  [[Ohta and coll,
+2020|bilbio/32518083]] reported fertile hybrids between _C. rob_ from San Diego
+(CA) and _C. int_ from Woods Hole (MA), but viability was reduced, especially
+when maternal or grand-maternal origin was _C. int_.
 
 _C. roulei_ can cross-hybridise easily with _C. intestinalis_, suggesting
 that they are the same species ([[Malfant, Darras and Viart, 2018|biblio/29367599]]).

heart
diff --git a/biblio/34789899.mdwn b/biblio/34789899.mdwn
new file mode 100644
index 00000000..8200ef1a
--- /dev/null
+++ b/biblio/34789899.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Cardiopharyngeal deconstruction and ancestral tunicate sessility."]]
+[[!tag Oikopleura]]
+
+Ferrández-Roldán A, Fabregà-Torrus M, Sánchez-Serna G, Duran-Bello E, Joaquín-Lluís M, Bujosa P, Plana-Carmona M, Garcia-Fernàndez J, Albalat R, Cañestro C.
+
+Nature. 2021 Nov;599(7885):431-435. doi:10.1038/s41586-021-04041-w
+
+Cardiopharyngeal deconstruction and ancestral tunicate sessility.
+
+[[!pmid 34789899 desc="Mesp, Ets1/2b, Gata4/5/6, Mek1/2, Hand-r and Tbx1/10 are absent from appendicularian genomes.   Nk4, Hand1/2 and FoxF were found."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index c5a59666..e4e9fcb0 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -252,6 +252,7 @@ Genes and pathways
  - 8 Wnt genes were found, belonging to 4 families.  Intronless _Wnt11_ genes
    were found; they might have been created by retrotransposition
    ([[Martí-Solans and coll., 2021|biblio/34179025]]).
+ - _Nk4_, _Hand1/2_ and _FoxF_ (heart development, [[Ferrández-Roldán and coll., 2021|biblio/34789899]]).
 
 ### Lost
 
@@ -285,7 +286,8 @@ Genes and pathways
  - _Nodal_ is not found in _O. dioica_'s genome ([[Onuma and coll., 2020|biblio/32029598]]).
  - Peroxysomes and genes related to them ([[Žárský and Tachezy, 2015|biblio/26700421]];
    [[Kienle, Kloepper and Fasshauer, 2016|biblio/27756227]]).
-
+ - _Mesp_, _Ets1/2b_, _Gata4/5/6_, _Mek1/2_,  _Hand-r_ and _Tbx1/10_ (heart development,
+   [[Ferrández-Roldán and coll., 2021|biblio/34789899]]).
 
 Epigenome
 ---------
@@ -457,7 +459,9 @@ Anatomy
    Electron microscopy shows a large perikaryon, cisternas and a cilium which is inserted
    in the central canal ([[Holmberg and Olsson, 1984|biblio/reissner_oik]]).
  - In contrary to Kowalevskiidae, ([[Brena, Cima and Burighel, 2003|biblio/10.1002_jmor.10145]]),
-   _Oikopleura_ do have a heart.
+   _Oikopleura_ do have a heart.  The genes _Mesp_, _Ets1/2b_, _Gata4/5/6_, _Mek1/2_,
+   _Hand-r_ and _Tbx1/10_, which are essential to heart development in other chordates
+   are lost in appendicularians ([[Ferrández-Roldán and coll., 2021|biblio/34789899]]).
  - A 3D reconstitution of hatchlings and jufeniles was done by SEM tomography by
    [[Nishida and coll., 2021|biblio/33649401]].
 

Café
diff --git a/biblio/34593604.mdwn b/biblio/34593604.mdwn
new file mode 100644
index 00000000..e411c73c
--- /dev/null
+++ b/biblio/34593604.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="DNA repair inhibition leads to active export of repetitive sequences to the cytoplasm triggering an inflammatory response."]]
+[[!tag repeat repair brain]]
+
+Song X, Aw JTM, Ma F, Cheung MF, Leung D, Herrup K.
+
+J Neurosci. 2021 Sep 28:JN-RM-0845-21. doi:10.1523/JNEUROSCI.0845-21.2021.
+
+DNA repair inhibition leads to active export of repetitive sequences to the cytoplasm triggering an inflammatory response. 
+
+[[!pmid 34593604 desc="Microglial cells accumulate cytoplasmic DNA by damage or inhibition of repair.  Blocking DNA export reduces accumulation of cytoplasmic DNA and inflamation.  Transcriptionally inactive sequences, AT-rich regions and repeated elements are enriched in the cytoplasmic DNA fraction."]]

Café
diff --git a/biblio/11087826.mdwn b/biblio/11087826.mdwn
new file mode 100644
index 00000000..4bf8aa81
--- /dev/null
+++ b/biblio/11087826.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Prevalence of small inversions in yeast gene order evolution"]]
+[[!tag variants yeast]]
+
+Proc Natl Acad Sci U S A. 2000 Dec 19;97(26):14433-7. doi:10.1073/pnas.240462997
+
+Seoighe C, Federspiel N, Jones T, Hansen N, Bivolarovic V, Surzycki R, Tamse R, Komp C, Huizar L, Davis RW, Scherer S, Tait E, Shaw DJ, Harris D, Murphy L, Oliver K, Taylor K, Rajandream MA, Barrell BG, Wolfe KH.
+
+Prevalence of small inversions in yeast gene order evolution
+
+[[!pmid 11087826 desc="Classifies pairs of gene orientations as ”parallel”, “convergent”, “divergent” and “alternative parallel” and studies combinations of these orientations in 298 adjacent gene paris from the _S. cerevisiae_ and the _C. albicans_ genomes, and the number of inversions they imply.  “We estimate that about 1,100 single-gene inversions have occurred since the divergence between these species”  (divergence happened ~200 million years ago)  “Our results suggest that successive random small inversions frequently cause a gene's chromosomal position and orientation to drift during its evolution. This process would alter gene order and orientation without moving any genes very far from their starting points.”"]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index a4ea2c03..3b21c19f 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -5,6 +5,8 @@ _in progress_
 Long read sequencing data from 3,622 Icelanders identified a median of 22,636
 SVs per individual (insertios: 13,353; deletions: 9,474) [[Beyter and coll, 2021|biblio/33972781]].
 
+### Inversions
+
 SNP analysis in >1400 seaweed flies identified known and candidate genomic inversions
 ([[Mérot and coll, 2021|biblio/33963409]]).
 
@@ -12,6 +14,12 @@ SV analysis of 31 diploid assemblies of _Theobroma cacao_ showed relaxed
 selection and increased genetic load in inversions and other types of variants
 [[Hämälä and coll., 2021|biblio/34408075]].
 
+~1100 small-scale inversions are estimated to have happened between _S.
+cerevisiae_ and _C. albicans_ ([[|biblio/11087826]]).  The authors propose that
+“successive multigene inversions” have “distrupted” the “precise arrangement”
+of “genes that are adjacent in one species are in the same neighborhood”.  A
+“bias toward small inversions” is reported.
+
 ### Software
 
  - _NanoSV_ ([[Cretu Stancu and coll., 2017|biblio/29109544]]) uses nanopore long

Café
diff --git a/biblio/PG_0485.mdwn b/biblio/PG_0485.mdwn
new file mode 100644
index 00000000..bf66a36c
--- /dev/null
+++ b/biblio/PG_0485.mdwn
@@ -0,0 +1,12 @@
+[[!meta title="Distribution of Oikopleura (Vexillaria) Dioica Fol, 1872 (Class: Appendicularia) in the southern Black sea in 2006-2007"]]
+[[!tag Oikopleura]]
+
+Funda Üstün, Levent Bat and Sengül Besiktepe
+
+Rapp. Comm. int. Mer Médit., 41, 2016, p485
+
+Distribution of Oikopleura (Vexillaria) Dioica Fol, 1872 (Class: Appendicularia) in the southern Black sea in 2006-2007
+
+https://ciesm.org/online/archives/abstracts/pdf/41/#
+
+O. dioica found in June 2006, October 2006 and May 2007, in 4 size classes infour size class (<0.5, 0.5-1, 1-2 and 2-3 mm).
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index d0ab666a..c5a59666 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -656,6 +656,7 @@ Ecology
    ([[Berry and coll., 2019|biblio/30735490]])
  - TARA Oceans ([[Vorobev and coll., 2020|biblio/32205368]]),
    [[Delmont and coll., biblio/10.1101_2020.10.15.341214v2]].
+ - In the southern Black sea in 2006–2007 ([[Üstün, Bat and Besiktepe, 2016|biblio/PG_0485]]).
 
 ### In the past:
 

creating tag page tags/plankton
diff --git a/tags/plankton.mdwn b/tags/plankton.mdwn
new file mode 100644
index 00000000..3f06dbfe
--- /dev/null
+++ b/tags/plankton.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged plankton"]]
+
+[[!inline pages="tagged(plankton)" actions="no" archive="yes"
+feedshow=10]]

Café
diff --git a/biblio/34011609.mdwn b/biblio/34011609.mdwn
new file mode 100644
index 00000000..07969fdf
--- /dev/null
+++ b/biblio/34011609.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Three genomes in the algal genus Volvox reveal the fate of a haploid sex-determining region after a transition to homothallism"]]
+[[!tag chromosome sex plankton]]
+
+Yamamoto K, Hamaji T, Kawai-Toyooka H, Matsuzaki R, Takahashi F, Nishimura Y, Kawachi M, Noguchi H, Minakuchi Y, Umen JG, Toyoda A, Nozaki H.
+
+Proc Natl Acad Sci U S A. 2021 May 25;118(21):e2100712118. doi:10.1073/pnas.2100712118
+
+Three genomes in the algal genus Volvox reveal the fate of a haploid sex-determining region after a transition to homothallism
+
+[[!pmid 34011609 desc="_Volvox_ has a sex-determining region (SDR) of ~1 Mb.  The homothallic species _Volvox africanus_ has a SDR-like region ressembling the female one, and a multicopy array of the male-determining gene (MID) at a different location."]]

creating tag page tags/replication
diff --git a/tags/replication.mdwn b/tags/replication.mdwn
new file mode 100644
index 00000000..9bffe547
--- /dev/null
+++ b/tags/replication.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged replication"]]
+
+[[!inline pages="tagged(replication)" actions="no" archive="yes"
+feedshow=10]]

Café
diff --git a/biblio/32561741.mdwn b/biblio/32561741.mdwn
new file mode 100644
index 00000000..a0c32e83
--- /dev/null
+++ b/biblio/32561741.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Direct observation of independently moving replisomes in Escherichia coli."]]
+[[!tag bacteria replication]]
+
+Japaridze A, Gogou C, Kerssemakers JWJ, Nguyen HM, Dekker C.
+
+Nat Commun. 2020 Jun 19;11(1):3109. doi:10.1038/s41467-020-16946-7
+
+Direct observation of independently moving replisomes in _Escherichia coli_.
+
+[[!pmid 32561741 desc="Replisomes were visualised with labelling the the β-clamp (DnaN).  The chromosome was labelled by attaching a mYpet fluorescent tag to the HU protein.  A temperature-sensitive DnaC allele was used to synchronise the cell cycles and to elongate the cells.  A MreB mutation was used to generate wider cells."]]

Café
diff --git a/biblio/10.2989_025776198784126476.mdwn b/biblio/10.2989_025776198784126476.mdwn
new file mode 100644
index 00000000..79451098
--- /dev/null
+++ b/biblio/10.2989_025776198784126476.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="The role of beak shape in octopodid taxonomy"]]
+[[!tag taxonomy]]
+
+R. S. Ogden , A. L. Allcock , P. C. Wats & J. P. Thorpe
+
+South African Journal of Marine Science, 1998, 20:1, 29-36, doi:10.2989/025776198784126476
+
+The role of beak shape in octopodid taxonomy
+
+[[!doi 10.2989/025776198784126476 desc="PCA and discriminant analysis on morphological measurments of beak shape in octopolids.  Geneera could be distinguished but not species."]]

In GR
diff --git a/biblio/10.1101_2020.03.14.992248v3.mdwn b/biblio/32801147.mdwn
similarity index 74%
rename from biblio/10.1101_2020.03.14.992248v3.mdwn
rename to biblio/32801147.mdwn
index 5dc046eb..32b67e78 100644
--- a/biblio/10.1101_2020.03.14.992248v3.mdwn
+++ b/biblio/32801147.mdwn
@@ -1,13 +1,13 @@
 [[!meta title="HiCanu: accurate assembly of segmental duplications, satellites, and allelic variants from high-fidelity long reads"]]
-[[!tag bioRxiv genome assembly chromosome]]
+[[!tag genome assembly chromosome]]
 
 Sergey Nurk, Brian P Walenz, Arang Rhie, Mitchell R Vollger, Glennis A Logsdon, Robert Grothe, Karen H Miga, Evan E Eichler, Adam M Phillippy, Sergey Koren
 
-bioRxiv 2020.03.14.992248; doi: https://doi.org/10.1101/2020.03.14.992248 
+Genome Res. 2020 Sep;30(9):1291-1305. doi:10.1101/gr.263566.120
 
 HiCanu: accurate assembly of segmental duplications, satellites, and allelic variants from high-fidelity long reads
 
-[[!doi 10.1101/2020.03.14.992248v3 desc="“HiCanu modifies the input reads by
+[[!pmid  32801147 desc="“HiCanu modifies the input reads by
 compressing every homopolymer to a single nucleotide.”  “Outputs contigs as
 “pseudo-haplotypes” that preserve local allelic phasing but may switch between
 haplotypes”"]]
diff --git a/tags/assembly.mdwn b/tags/assembly.mdwn
index 7c18baab..0ed2af28 100644
--- a/tags/assembly.mdwn
+++ b/tags/assembly.mdwn
@@ -23,6 +23,10 @@ fast. Shasta assemblies tend to be more fragmented, but have less disagreement
 with the reference.  Shasta also comes with polishing modules similar to Racon
 and Medaka, but also  to be faster. 
 
+The HiCanu assembler ([[Nurk, Walenz and coll., 2020|biblio/32801147]]) can
+take advantage of high-accuracy sequences such as the ones of the PacBio HiFi
+platform, to assemble multiple variants of the same locus.
+
 Some genome assemblers produce a graph file that can be visualised
 with tools such as Bandage [[Wick and coll., 2015|biblio/26099265]].
 

oburo
diff --git a/biblio/34255842.mdwn b/biblio/34255842.mdwn
new file mode 100644
index 00000000..d7daba71
--- /dev/null
+++ b/biblio/34255842.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="capCLIP: a new tool to probe translational control in human cells through capture and identification of the eIF4E-mRNA interactome."]]
+[[!tag cap method library]]
+
+Jensen KB, Dredge BK, Toubia J, Jin X, Iadevaia V, Goodall GJ, Proud CG.
+
+Nucleic Acids Res. 2021 Oct 11;49(18):e105. doi:10.1093/nar/gkab604
+
+capCLIP: a new tool to probe translational control in human cells through capture and identification of the eIF4E-mRNA interactome.
+
+[[!pmid 34255842 desc="eIF4E flagged via CRISPR/Cas9 gene editing.  mRNAs were crosslinked to eIF4E and immunoprecipitated with anti-flag antibodies.  First-strand cDNAs primed via a linker ligated in 3′.  This method (capCLIP) was used to study the effect of rapamycin treatment and eIF4E phosphorylation."]]
diff --git a/tags/cap.mdwn b/tags/cap.mdwn
index 552aa76d..175d7267 100644
--- a/tags/cap.mdwn
+++ b/tags/cap.mdwn
@@ -63,6 +63,11 @@ in the [[template_switching]] tag page.
    biotinylated forward primers, so that the 5′ end can be recovered after
    mechanical fragmentation.
 
+ - capCLIP ([[Jensen and coll., 2021|biblio/34255842]]): eIF4E is flagged by
+   gene editing, mRNA crosslinked to eIF4E and the whole is immunoprecipitated.
+   This circumvents the problem of access to good eIF4E antibodies for
+   immunoprecipitation.
+
 Atypical caps (work in progress)
 --------------------------------
 

Remove tag.
diff --git a/biblio/34385692.mdwn b/biblio/34385692.mdwn
index 7a7102b5..7b6fa118 100644
--- a/biblio/34385692.mdwn
+++ b/biblio/34385692.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Multiplexed direct detection of barcoded protein reporters on a nanopore array"]]
-[[!tag bioRxiv nanopore]]
+[[!tag nanopore]]
 
 Nat Biotechnol. 2021 Aug 12. doi:10.1038/s41587-021-01002-6.
 

TARA Oceans
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 5bbe5de5..d0ab666a 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -654,7 +654,8 @@ Ecology
    (with oral gland cells and ~8 to 14 subchordal cells).
  - Indian ocean near Australia: detected in eDNA sequencing of 18S rRNA
    ([[Berry and coll., 2019|biblio/30735490]])
- - TARA Oceans ([[Vorobev and coll., 2020|biblio/32205368]]).
+ - TARA Oceans ([[Vorobev and coll., 2020|biblio/32205368]]),
+   [[Delmont and coll., biblio/10.1101_2020.10.15.341214v2]].
 
 ### In the past:
 

Peer-reviewed.
diff --git a/biblio/10.1101_837542.mdwn b/biblio/34385692.mdwn
similarity index 55%
rename from biblio/10.1101_837542.mdwn
rename to biblio/34385692.mdwn
index df5c2c40..7a7102b5 100644
--- a/biblio/10.1101_837542.mdwn
+++ b/biblio/34385692.mdwn
@@ -1,10 +1,10 @@
 [[!meta title="Multiplexed direct detection of barcoded protein reporters on a nanopore array"]]
 [[!tag bioRxiv nanopore]]
 
-Posted November 11, 2019.
+Nat Biotechnol. 2021 Aug 12. doi:10.1038/s41587-021-01002-6.
 
-Nicolas Cardozo, Karen Zhang, Katie Doroschak, Aerilynn Nguyen, Zoheb Siddiqui, Karin Strauss, Luis Ceze and Jeff Nivala.
+Nicolas Cardozo, Karen Zhang, Katie Doroschak, Aerilynn Nguyen, Zoheb Siddiqui, Nicholas Bogard, Karin Strauss, Luis Ceze and Jeff Nivala.
 
 Multiplexed direct detection of barcoded protein reporters on a nanopore array
 
-[[!doi 10.1101/837542 desc="Detection of peptide barcodes in Nanopore flow cells."]]
+[[!pmid 34385692 desc="Detection of peptide barcodes in Nanopore flow cells."]]