Dernières modifications :

Café
diff --git a/biblio/10411506.mdwn b/biblio/10411506.mdwn
new file mode 100644
index 00000000..01e4b47a
--- /dev/null
+++ b/biblio/10411506.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Generation of a widespread Drosophila inversion by a transposable element."]]
+[[!tag variants]]
+
+Cáceres M, Ranz JM, Barbadilla A, Long M, Ruiz A.
+
+Science. 1999 Jul 16;285(5426):415-8. doi:10.1126/science.285.5426.415
+
+Generation of a widespread Drosophila inversion by a transposable element.
+
+[[!pmid 10411506 desc="Target Site Duplication (TSD) sites were exchanged through the recombination of two transposons inserted in opposite directions."]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 5562a25e..5bdf6ae5 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -38,6 +38,10 @@ supported by [[Steinberg and coll in 2012|biblio/22751100]].
 Ectopic recombination of a Galileo element may have caused a recent large-scale
 inversion in _D. buzzati_ ([[Delprat and coll, 2009|biblio/19936241]]).
 
+Flanking an inversion in _D. buzzati_ between two _Galileo_ elements, the
+exchange of Target-Site Duplication sequences was observed by Cáceres and
+coll., [[(1999|biblio/10411506]]). 
+
 [[Kent and coll., 2003|biblio/14500911]] reported 2 inversions per Mbp in
 human/mouse comparisons, median length 814. 
 

Mention AXTCHAIN
diff --git a/tags/alignment.mdwn b/tags/alignment.mdwn
index 6e7a6619..89b1ef03 100644
--- a/tags/alignment.mdwn
+++ b/tags/alignment.mdwn
@@ -2,6 +2,11 @@
 
 _Work in progress_
 
+## Chains and nets
+
+Kent and coll. ([[2003|biblio/14500911]]) computed _chained alignments_ with
+the AXTCHAIN program.
+
 ## LAST
 
 see [[LAST]] for a detailed bibliography.

progressive cactus
diff --git a/biblio/33177663.mdwn b/biblio/33177663.mdwn
new file mode 100644
index 00000000..a709cf61
--- /dev/null
+++ b/biblio/33177663.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Progressive Cactus is a multiple-genome aligner for the thousand-genome era."]]
+[[!tag genome alignment]]
+
+Armstrong J, Hickey G, Diekhans M, Fiddes IT, Novak AM, Deran A, Fang Q, Xie D, Feng S, Stiller J, Genereux D, Johnson J, Marinescu VD, Alföldi J, Harris RS, Lindblad-Toh K, Haussler D, Karlsson E, Jarvis ED, Zhang G, Paten B.
+
+Nature. 2020 Nov;587(7833):246-251. doi: 10.1038/s41586-020-2871-y
+
+Progressive Cactus is a multiple-genome aligner for the thousand-genome era
+
+[[!pmid 33177663 desc="Aligns with cactus 2~5 genomes, in- and out-group, and reconstitutes an ancestral genome.  Recurses the phylogenetic tree progressively.  A ‘best-hit-filtering’ step is added to catch duplications that are not seen in the outgroups.  Also runs a step ‘removing recoverable chains’ to allow for corrections and mitigate error propagation.  Aligning 600 amniotes took ~2 months."]]
diff --git a/tags/alignment.mdwn b/tags/alignment.mdwn
index 2bbe4c8b..6e7a6619 100644
--- a/tags/alignment.mdwn
+++ b/tags/alignment.mdwn
@@ -8,8 +8,12 @@ see [[LAST]] for a detailed bibliography.
 
 ## Cactus
 
- - Paten and coll, ([[March 2011|biblio/21385048]]) describe _cactus_ graphs
+ - Paten and coll., ([[March 2011|biblio/21385048]]) describe _cactus_ graphs
    where nodes are sets of adjascencies and edges are aligned blocks of
    sequences.  A genome can be represented as path in these graphs.
 
+ - Armstrong and coll. ([[2020|biblio/33177663]]) describe _progressive cactus_,
+   an iterative approach where ancestral genomes are reconstituted using 2-5 pairs
+   of in- and out-group comparisons, and then progressively aligned to each other.
+
 [[!inline pages="tagged(alignment)" limit=0]]

Re-fix
diff --git a/biblio/34934012.mdwn b/biblio/34934012.mdwn
index 31d7f286..08757e06 100644
--- a/biblio/34934012.mdwn
+++ b/biblio/34934012.mdwn
@@ -7,4 +7,4 @@ Proc Natl Acad Sci U S A. 2022 Jan 4;119(1):e2113075119. doi:10.1073/pnas.211307
 
 AnchorWave: Sensitive alignment of genomes with high sequence diversity, extensive structural polymorphism, and whole-genome duplication. 
 
-[[!pmid 34934012 desc="Maps a transcriptome to its reference genome.  2) Extracts "anchor" coding sequences.  3) Searches for homologous sequences in the query genome.  4) Realigns the sequences between homologous anchors.  The so-called comparison to LAST is actually a comparison with LAST + AxtChain, that is: it does not use last-split."]]
+[[!pmid 34934012 desc="Maps a transcriptome to its reference genome.  2) Extracts “anchor” coding sequences.  3) Searches for homologous sequences in the query genome.  4) Realigns the sequences between homologous anchors.  The so-called comparison to LAST is actually a comparison with LAST + AxtChain, that is: it does not use last-split."]]

Fix
diff --git a/biblio/34934012.mdwn b/biblio/34934012.mdwn
index cdbb799c..31d7f286 100644
--- a/biblio/34934012.mdwn
+++ b/biblio/34934012.mdwn
@@ -7,4 +7,4 @@ Proc Natl Acad Sci U S A. 2022 Jan 4;119(1):e2113075119. doi:10.1073/pnas.211307
 
 AnchorWave: Sensitive alignment of genomes with high sequence diversity, extensive structural polymorphism, and whole-genome duplication. 
 
-[[!pmid desc=""1) Maps a transcriptome to its reference genome.  2) Extracts "anchor" coding sequences.  3) Searches for homologous sequences in the query genome.  4) Realigns the sequences between homologous anchors.  The so-called comparison to LAST is actually a comparison with LAST + AxtChain, that is: it does not use last-split.]]
+[[!pmid 34934012 desc="Maps a transcriptome to its reference genome.  2) Extracts "anchor" coding sequences.  3) Searches for homologous sequences in the query genome.  4) Realigns the sequences between homologous anchors.  The so-called comparison to LAST is actually a comparison with LAST + AxtChain, that is: it does not use last-split."]]

Cactus
diff --git a/biblio/21385048.mdwn b/biblio/21385048.mdwn
new file mode 100644
index 00000000..77e98664
--- /dev/null
+++ b/biblio/21385048.mdwn
@@ -0,0 +1,13 @@
+[[!meta title="Cactus graphs for genome comparisons."]]
+[[!tag genome alignment]]
+
+Paten B, Diekhans M, Earl D, John JS, Ma J, Suh B, Haussler D.
+
+J Comput Biol. 2011 Mar;18(3):469-81. doi: 10.1089/cmb.2010.0252
+
+Cactus graphs for genome comparisons.
+
+[[!pmid 21385048 desc="Alignments are transformed in sequence graphs where
+nodes are connected by either alignment blocks or adjascencies between blocks,
+and this graph is progressively transformed in a cactus graph where the nodes
+are sets of adjascencies connected together without crossing a block."]]
diff --git a/tags/alignment.mdwn b/tags/alignment.mdwn
index 795e5919..2bbe4c8b 100644
--- a/tags/alignment.mdwn
+++ b/tags/alignment.mdwn
@@ -1,4 +1,15 @@
 [[!meta title="pages tagged alignment"]]
 
-[[!inline pages="tagged(alignment)" actions="no" archive="yes"
-feedshow=10]]
+_Work in progress_
+
+## LAST
+
+see [[LAST]] for a detailed bibliography.
+
+## Cactus
+
+ - Paten and coll, ([[March 2011|biblio/21385048]]) describe _cactus_ graphs
+   where nodes are sets of adjascencies and edges are aligned blocks of
+   sequences.  A genome can be represented as path in these graphs.
+
+[[!inline pages="tagged(alignment)" limit=0]]

Merge branch 'master' of ssh://charles-plessy-org.branchable.com
Work In Progress from last year.
diff --git a/biblio/20331767.mdwn b/biblio/20331767.mdwn
new file mode 100644
index 00000000..6782ce0a
--- /dev/null
+++ b/biblio/20331767.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Multiple marker parallel tag environmental DNA sequencing reveals a highly complex eukaryotic community in marine anoxic water."]]
+[[!tag eDNA]]
+
+Stoeck T, Bass D, Nebel M, Christen R, Jones MD, Breiner HW, Richards TA
+
+Mol Ecol. 2010 Mar;19 Suppl 1:21-31. doi:10.1111/j.1365-294X.2009.04480.x
+
+Multiple marker parallel tag environmental DNA sequencing reveals a highly complex eukaryotic community in marine anoxic water.
+
+[[!pmid 20331767 desc="The TAReuk454FWD1–TAReukREV3 pair (V4) detected more unique tags than the 1391F–EukB pair (V9)."]]
diff --git a/tags/eDNA.mdwn b/tags/eDNA.mdwn
index f15996b4..5b46ea4f 100644
--- a/tags/eDNA.mdwn
+++ b/tags/eDNA.mdwn
@@ -11,6 +11,8 @@
 
  - A Nextflow pipeline: eDNAFlow [[Mousavi‐Derazmahalleh and coll., 2021|biblio/10.1111_1755-0998.13356]].
 
+ - Universal or eukaryote-biased 18S primers targetting the V9 hypervariable region: [[Amaral-Zettler|biblio/19633714]]
+
 ### Published primers
 
 ```
@@ -22,11 +24,25 @@ GGAGCTGGAATTACCGC
 CCCTGCCHTTTGTACACAC
 >18S_1389F universal 10.1371/journal.pone.0006372
 TTGTACACACCGCCC
+>18S_1391F 10.1111/j.1365-294X.2009.04480.x (Lane 1991), S. cerevisiae NCBI GenBank nucleotide database accession # U53879 position 1629-1644)
+GTACACACCGCCCGTC
+>EukB 10.1111/j.1365-294X.2009.04480.x (Medlin et al. 1988), S. cerevisiae position 1774-1797). 
+TGATCCTTCTGCAGGTTCACCTAC
 >18S_1510R eukaryotic 10.1371/journal.pone.0006372
 CCTTCYGCAGGTTCACCTAC
 ```
 https://doi.org/10.1371/journal.pone.0073935
 
+
+V4
+```
+>TAReuk454FWD1 (S. cerevisiae position 565-584)
+CCAGCA(G/C)C(C/T)GCGGTAATTCC
+>TAReukREV3 (S. cerevisiae position 964-981)
+ACTTTCGTTCTTGATYRA
+```
+
+
 ```
 >UroCox1-244 F 10.2108/zsj.26.564
 CATTTWTTTTGATTWTTTRGWCATCCNGA

mdwn
diff --git "a/Debian/debi\303\242neries/markdown.en.po" "b/Debian/debi\303\242neries/markdown.en.po"
index 4e96336f..40808c68 100644
--- "a/Debian/debi\303\242neries/markdown.en.po"
+++ "b/Debian/debi\303\242neries/markdown.en.po"
@@ -3,40 +3,38 @@
 # This file is distributed under the same license as the PACKAGE package.
 # FIRST AUTHOR <EMAIL@ADDRESS>, YEAR.
 #
-#, fuzzy
 msgid ""
 msgstr ""
-"Project-Id-Version: PACKAGE VERSION\n"
+"Project-Id-Version: \n"
 "POT-Creation-Date: 2023-01-08 00:53+0000\n"
-"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
-"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
-"Language-Team: LANGUAGE <LL@li.org>\n"
-"Language: \n"
+"PO-Revision-Date: 2023-01-08 09:59+0900\n"
+"Language: en\n"
 "MIME-Version: 1.0\n"
 "Content-Type: text/plain; charset=UTF-8\n"
 "Content-Transfer-Encoding: 8bit\n"
+"Last-Translator: \n"
+"Language-Team: \n"
+"X-Generator: Poedit 2.4.2\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!meta date=\"Sun, 08 Jan 2023 09:18:53 +0900\"]]\n"
-msgstr ""
+msgstr "[[!meta date=\"Sun, 08 Jan 2023 09:18:53 +0900\"]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!meta updated=\"Sun, 08 Jan 2023 09:18:53 +0900\"]]\n"
-msgstr ""
+msgstr "[[!meta updated=\"Sun, 08 Jan 2023 09:18:53 +0900\"]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!tag Debian]]\n"
-msgstr ""
+msgstr "[[!tag Debian]]\n"
 
 #. type: Plain text
 #, no-wrap
-msgid ""
-"[[!meta title=\"Quelqu'un pourrait-il patcher Firefox pour afficher du "
-"Markdown ?\"]]\n"
-msgstr ""
+msgid "[[!meta title=\"Quelqu'un pourrait-il patcher Firefox pour afficher du Markdown ?\"]]\n"
+msgstr "[[!meta title=\"Could somebody patch Firefox to display Markdown files?\"]]\n"
 
 #. type: Plain text
 msgid ""
@@ -45,7 +43,11 @@ msgid ""
 "comme un fichier texte.  Dans le ticket [1319262](), il est proposé "
 "d'afficher les fichiers Markdown par défaut.  Mais il faudrait un patch…"
 msgstr ""
+"When Firefox receives a file with media type _text/markdown_, it prompts "
+"the user to download it, while other browsers display it as plain text.  "
+"In the ticket [1319262](), it is proposed to display Markdown files by "
+"default, but there needs a patch…"
 
 #. type: Plain text
 msgid "[1319262]: https://bugzilla.mozilla.org/show_bug.cgi?id=1319262"
-msgstr ""
+msgstr "[1319262]: https://bugzilla.mozilla.org/show_bug.cgi?id=1319262"

updated PO files
diff --git "a/Debian/debi\303\242neries/markdown.en.po" "b/Debian/debi\303\242neries/markdown.en.po"
new file mode 100644
index 00000000..4e96336f
--- /dev/null
+++ "b/Debian/debi\303\242neries/markdown.en.po"
@@ -0,0 +1,51 @@
+# SOME DESCRIPTIVE TITLE
+# Copyright (C) YEAR Free Software Foundation, Inc.
+# This file is distributed under the same license as the PACKAGE package.
+# FIRST AUTHOR <EMAIL@ADDRESS>, YEAR.
+#
+#, fuzzy
+msgid ""
+msgstr ""
+"Project-Id-Version: PACKAGE VERSION\n"
+"POT-Creation-Date: 2023-01-08 00:53+0000\n"
+"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
+"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
+"Language-Team: LANGUAGE <LL@li.org>\n"
+"Language: \n"
+"MIME-Version: 1.0\n"
+"Content-Type: text/plain; charset=UTF-8\n"
+"Content-Transfer-Encoding: 8bit\n"
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!meta date=\"Sun, 08 Jan 2023 09:18:53 +0900\"]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!meta updated=\"Sun, 08 Jan 2023 09:18:53 +0900\"]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!tag Debian]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid ""
+"[[!meta title=\"Quelqu'un pourrait-il patcher Firefox pour afficher du "
+"Markdown ?\"]]\n"
+msgstr ""
+
+#. type: Plain text
+msgid ""
+"Quand Firefox reçoit un fichier dont le type média est _text/markdown_, il "
+"le propose au téléchargement, alors que les autres navigateurs l'affichent "
+"comme un fichier texte.  Dans le ticket [1319262](), il est proposé "
+"d'afficher les fichiers Markdown par défaut.  Mais il faudrait un patch…"
+msgstr ""
+
+#. type: Plain text
+msgid "[1319262]: https://bugzilla.mozilla.org/show_bug.cgi?id=1319262"
+msgstr ""

Mdwn
diff --git "a/Debian/debi\303\242neries/markdown.mdwn" "b/Debian/debi\303\242neries/markdown.mdwn"
new file mode 100644
index 00000000..7bd4cc65
--- /dev/null
+++ "b/Debian/debi\303\242neries/markdown.mdwn"
@@ -0,0 +1,12 @@
+[[!meta date="Sun, 08 Jan 2023 09:18:53 +0900"]]
+[[!meta updated="Sun, 08 Jan 2023 09:18:53 +0900"]]
+[[!tag Debian]]
+
+[[!meta title="Quelqu'un pourrait-il patcher Firefox pour afficher du Markdown ?"]]
+
+Quand Firefox reçoit un fichier dont le type média est _text/markdown_, il le
+propose au téléchargement, alors que les autres navigateurs l'affichent comme
+un fichier texte.  Dans le ticket [1319262](), il est proposé d'afficher les
+fichiers Markdown par défaut.  Mais il faudrait un patch…
+
+[1319262]: https://bugzilla.mozilla.org/show_bug.cgi?id=1319262

Café
diff --git a/biblio/5456129.mdwn b/biblio/5456129.mdwn
index 104086ee..f5899b0a 100644
--- a/biblio/5456129.mdwn
+++ b/biblio/5456129.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="The diagram, a method for comparing sequences. Its use with amino acid and nucleotide sequences."]]
-[[!tag software method alignment]]
+[[!tag Oxford_plot]]
 
 Gibbs AJ, McIntyre GA.
 
diff --git a/tags/Oxford_plot.mdwn b/tags/Oxford_plot.mdwn
index 39072e90..10e755e8 100644
--- a/tags/Oxford_plot.mdwn
+++ b/tags/Oxford_plot.mdwn
@@ -1,4 +1,19 @@
 [[!meta title="pages tagged Oxford plot"]]
 
-[[!inline pages="tagged(Oxford_plot)" actions="no" archive="yes"
-feedshow=10]]
+## Why are the dot-plots of sequence comparisons also called “Oxford” plots?
+
+*work in progress*
+
+Wikipedia credits [[Gibbs and McIntyre (1970)|biblio/5456129]] for the
+invention of dot-plot graphs to compare two biological sequences.  Gibbs and
+McIntyre are from the University of Canberra, but the dot-plots are sometimes
+called “Oxford” plots or grids.  Is Wikipedia missing a reference?  I screened
+the papers citing Gibbs and McIntyre, and found that [[Maize and Lenk
+(1981)]|biblio/6801656]], from the NIH, also cite other papers: 1) [[Tinoco,
+Uhlenbeck and Levine (1971)|biblio/4927725]] from the University of Berkeley,
+that shows a base pairing matrix, 2) Fitch (1969) (PMID 5364927) from the
+University of Winsconsin, with no dot plot, and McLachlan (1970) (PMID 5167087)
+from the University of Cambridge, with a sequence comparison matrix for
+two proteins.
+
+[[!inline pages="tagged(Oxford_plot)" limit=0]]

creating tag page tags/Oxford_plot
diff --git a/tags/Oxford_plot.mdwn b/tags/Oxford_plot.mdwn
new file mode 100644
index 00000000..39072e90
--- /dev/null
+++ b/tags/Oxford_plot.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged Oxford plot"]]
+
+[[!inline pages="tagged(Oxford_plot)" actions="no" archive="yes"
+feedshow=10]]

Café
diff --git a/biblio/4927725.mdwn b/biblio/4927725.mdwn
new file mode 100644
index 00000000..c2ab013f
--- /dev/null
+++ b/biblio/4927725.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Estimation of secondary structure in ribonucleic acids."]]
+[[!tag Oxford_plot]]
+
+Tinoco I Jr, Uhlenbeck OC, Levine MD.
+
+Nature. 1971 Apr 9;230(5293):362-7. doi:10.1038/230362a0
+
+Estimation of secondary structure in ribonucleic acids.
+
+[[!pmid 4927725 desc="The base pairing matrix in figure 2 looks like an ”Oxford” plot."]]

Café
diff --git a/biblio/5456129.mdwn b/biblio/5456129.mdwn
new file mode 100644
index 00000000..104086ee
--- /dev/null
+++ b/biblio/5456129.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="The diagram, a method for comparing sequences. Its use with amino acid and nucleotide sequences."]]
+[[!tag software method alignment]]
+
+Gibbs AJ, McIntyre GA.
+
+Eur J Biochem. 1970 Sep;16(1):1-11. doi:10.1111/j.1432-1033.1970.tb01046.x
+
+The diagram, a method for comparing sequences. Its use with amino acid and nucleotide sequences.
+
+[[!pmid 5456129 desc="First description of the “Oxford” plot?"]]

en attendant
diff --git a/biblio/29506021.mdwn b/biblio/29506021.mdwn
new file mode 100644
index 00000000..e3cb72ad
--- /dev/null
+++ b/biblio/29506021.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Updating the 97% identity threshold for 16S ribosomal RNA OTUs."]]
+[[!tag eDNA]]
+
+Edgar RC.
+
+Bioinformatics. 2018 Jul 15;34(14):2371-2375. doi:10.1093/bioinformatics/bty113
+
+Updating the 97% identity threshold for 16S ribosomal RNA OTUs.
+
+[[!pmid 29506021 desc="Following a benchmark on V4 regions of the 16S rRNA, proposes to raise the threshold to 99% or to just use sequence variants (also called ZOTUS, Zero-radius OTUs."]]
diff --git a/tags/eDNA.mdwn b/tags/eDNA.mdwn
index f15996b4..10df54d7 100644
--- a/tags/eDNA.mdwn
+++ b/tags/eDNA.mdwn
@@ -11,6 +11,9 @@
 
  - A Nextflow pipeline: eDNAFlow [[Mousavi‐Derazmahalleh and coll., 2021|biblio/10.1111_1755-0998.13356]].
 
+ - Edgar ([[2018|biblio/29506021]] proposes to raise the threshold to 99% or to
+   just use sequence variants (also called ZOTUS, Zero-radius OTUs. 
+
 ### Published primers
 
 ```

Café
diff --git a/biblio/31112549.mdwn b/biblio/31112549.mdwn
new file mode 100644
index 00000000..7f8e38b9
--- /dev/null
+++ b/biblio/31112549.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Extensive loss of cell-cycle and DNA repair genes in an ancient lineage of bipolar budding yeasts."]]
+[[!tag yeast repair]]
+
+Steenwyk JL, Opulente DA, Kominek J, Shen XX, Zhou X, Labella AL, Bradley NP, Eichman BF, Čadež N, Libkind D, DeVirgilio J, Hulfachor AB, Kurtzman CP, Hittinger CT, Rokas A.
+
+PLoS Biol. 2019 May 21;17(5):e3000255. doi:10.1371/journal.pbio.3000255
+
+Extensive loss of cell-cycle and DNA repair genes in an ancient lineage of bipolar budding yeasts.
+
+[[!pmid 31112549 desc="“Compared to other budding yeasts in the subphylum _Saccharomycotina_, we noticed that a lineage in the genus _Hanseniaspora_ exhibited very high evolutionary rates, low Guanine–Cytosine (GC) content, small genome sizes, and lower gene numbers. [...] Our phylogenomic analyses identify two Hanseniaspora lineages, a faster-evolving lineage (FEL), which began diversifying approximately 87 million years ago (mya), and a slower-evolving lineage (SEL), which began diversifying approximately 54 mya.”"]]

yeast
diff --git a/biblio/36334587.mdwn b/biblio/36334587.mdwn
new file mode 100644
index 00000000..58d71954
--- /dev/null
+++ b/biblio/36334587.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Contrasting modes of macro and microsynteny evolution in a eukaryotic subphylum."]]
+[[!tag yeast synteny]]
+
+Li Y, Liu H, Steenwyk JL, LaBella AL, Harrison MC, Groenewald M, Zhou X, Shen XX, Zhao T, Hittinger CT, Rokas A.
+
+Curr Biol. 2022 Dec 19;32(24):5335-5343.e4. doi:10.1016/j.cub.2022.10.025
+
+Contrasting modes of macro and microsynteny evolution in a eukaryotic subphylum.
+
+[[!pmid 36334587 desc="“conservation index is calculated by counting the number of one-to-one orthologous gene pairs whose genes are in homologous chromosomes/scaffolds and dividing it by the number of one-to-one orthologs whose genes reside in non-homologous chromosomes/scaffolds” “we found a faster decay of macrosynteny conservation compared with filamentous fungi and animals, which is corroborated by findings of rapid chromosome structure evolution in budding yeasts” “at the small-scale gene-level of organization, we identified both deeply conserved and lineage-specific instances of conservation of microsynteny across budding yeast genomes.”"]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index bfe0bfdb..d9fd0d0f 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -57,6 +57,9 @@ phenomenon “mesosynteny”.
 Squid chromosomes still have synteny with scallop, but gene order is scrambled
 ([[Albertin and coll., 2022|biblio/35508532]]).
 
+At equal evolutionary distance, yeast microsynteny is lower than in animals,
+but higher than in plants ([[Li and coll., 2022|biblio/36334587]]).
+
 ### Ancestral karyotpyes
 
  - The ancestral mammalian genome has 30 chromosomes ([[Zhou and coll., 2021|biblio/33408411]]).

Café
diff --git a/biblio/35348662.mdwn b/biblio/35348662.mdwn
new file mode 100644
index 00000000..5ad15c7b
--- /dev/null
+++ b/biblio/35348662.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Chromosome-Level Reference Genomes for Two Strains of Caenorhabditis briggsae: An Improved Platform for Comparative Genomics."]]
+[[!tag nematode genome assembly]]
+
+Stevens L, Moya ND, Tanny RE, Gibson SB, Tracey A, Na H, Chitrakar R, Dekker J, Walhout AJM, Baugh LR, Andersen EC.
+
+Genome Biol Evol. 2022 Apr 10;14(4):evac042. doi:10.1093/gbe/evac042
+
+Chromosome-Level Reference Genomes for Two Strains of Caenorhabditis briggsae: An Improved Platform for Comparative Genomics.
+
+[[!pmid 35348662 desc="“the genomes of _C. elegans_ and _C. briggsae_ are more highly rearranged than their outcrossing sister species, _C. inopinata_ and _C. nigoni_ (17.1% of neighboring genes are rearranged in the selfers compared with 15.0% in the outcrossers)”"]]
diff --git a/tags/nematode.mdwn b/tags/nematode.mdwn
index 1d494f1b..001fd69c 100644
--- a/tags/nematode.mdwn
+++ b/tags/nematode.mdwn
@@ -53,4 +53,9 @@
    133 kb that are present in germ line but absent in somatic cells ([[de la
    Rosa and coll., 2021|biblio/33561231]]).
 
+ - “the genomes of _C. elegans_ and _C. briggsae_ are more highly rearranged
+   than their outcrossing sister species, _C. inopinata_ and _C. nigoni_ (17.1%
+   of neighboring genes are rearranged in the selfers compared with 15.0% in the
+   outcrossers)” ([[Stevens and coll., 2022|biblio/35348662]]).
+
 [[!inline pages="tagged(nematode)" limit=0]]

Café
diff --git a/biblio/33168940.mdwn b/biblio/33168940.mdwn
new file mode 100644
index 00000000..9a136950
--- /dev/null
+++ b/biblio/33168940.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Genomic and transcriptomic variation defines the chromosome-scale assembly of Haemonchus contortus, a model gastrointestinal worm."]]
+[[!tag nematode]]
+
+Doyle SR, Tracey A, Laing R, Holroyd N, Bartley D, Bazant W, Beasley H, Beech R, Britton C, Brooks K, Chaudhry U, Maitland K, Martinelli A, Noonan JD, Paulini M, Quail MA, Redman E, Rodgers FH, Sallé G, Shabbir MZ, Sankaranarayanan G, Wit J, Howe KL, Sargison N, Devaney E, Berriman M, Gilleard JS, Cotton JA.
+
+Commun Biol. 2020 Nov 9;3(1):656. doi:10.1038/s42003-020-01377-3
+
+Genomic and transcriptomic variation defines the chromosome-scale assembly of _Haemonchus contortus_, a model gastrointestinal worm.
+
+[[!pmid 33168940 desc="“80% of 7,361 one-to-one orthologous genes are shared on syntenic chromosomes between [_H. contortus_ and _C. elegans_]”  “The distance between ortholog pairs [...] is correlated up to ~100 kbp [...], but is largely lost above 100 kbp ”"]]

café
diff --git a/biblio/33561231.mdwn b/biblio/33561231.mdwn
new file mode 100644
index 00000000..df05d6ec
--- /dev/null
+++ b/biblio/33561231.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="A telomere-to-telomere assembly of Oscheius tipulae and the evolution of rhabditid nematode chromosomes."]]
+[[!tag nematode genome]]
+
+Gonzalez de la Rosa PM, Thomson M, Trivedi U, Tracey A, Tandonnet S, Blaxter M.
+
+G3 (Bethesda). 2021 Jan 18;11(1):jkaa020. doi:10.1093/g3journal/jkaa020
+
+A telomere-to-telomere assembly of Oscheius tipulae and the evolution of rhabditid nematode chromosomes.
+
+[[!pmid 33561231 desc="“subtelomeric extensions rang[ing] from 4 to 133 kb” present in germ line but absent in somatic cells."]]
diff --git a/tags/nematode.mdwn b/tags/nematode.mdwn
index 8d95f5bb..1d494f1b 100644
--- a/tags/nematode.mdwn
+++ b/tags/nematode.mdwn
@@ -49,4 +49,8 @@
    The Hi-C contact map shows strong interaction between the centre of all chromosomes
    ([[Sun and coll., 2020|biblio/33093047]]).
 
+ - In _Oscheius tipulae_, there are subtelomeric extensions ranging from 4 to
+   133 kb that are present in germ line but absent in somatic cells ([[de la
+   Rosa and coll., 2021|biblio/33561231]]).
+
 [[!inline pages="tagged(nematode)" limit=0]]

Merci PoEdit !
diff --git "a/Debian/debi\303\242neries/grosmot.en.po" "b/Debian/debi\303\242neries/grosmot.en.po"
index b0ab8398..66f89022 100644
--- "a/Debian/debi\303\242neries/grosmot.en.po"
+++ "b/Debian/debi\303\242neries/grosmot.en.po"
@@ -7,7 +7,7 @@ msgid ""
 msgstr ""
 "Project-Id-Version: \n"
 "POT-Creation-Date: 2022-12-16 13:24+0000\n"
-"PO-Revision-Date: 2022-12-16 22:31+0900\n"
+"PO-Revision-Date: 2022-12-16 22:35+0900\n"
 "Language: en\n"
 "MIME-Version: 1.0\n"
 "Content-Type: text/plain; charset=UTF-8\n"
@@ -55,7 +55,7 @@ msgstr "I found it in:"
 
 #. type: Bullet: ' - '
 msgid "le code source de XEmacs ;"
-msgstr "The source code of XEmacs;"
+msgstr "the source code of XEmacs;"
 
 #. type: Bullet: ' - '
 msgid "une liste de gros mots pour policer les conversations dans BZFlag ;"
@@ -67,17 +67,17 @@ msgstr "the random sentence generator PolyGen;"
 
 #. type: Bullet: ' - '
 msgid "le code source du jeu de plateau Tagua ;"
-msgstr "The source code of the board game Tagua;"
+msgstr "the source code of the board game Tagua;"
 
 #. type: Bullet: ' - '
 msgid ""
 "une base de données d'épigrammes vulguaires pour la plateforme éducative "
 "WIMS ;"
-msgstr "A database of offensive fortunes for the educative platform WIMS;"
+msgstr "a database of offensive fortunes for the educative platform WIMS;"
 
 #. type: Bullet: ' - '
 msgid "le jeu de mots croisés parololottero ;"
-msgstr "The crossword game parolottero;"
+msgstr "the crossword game parolottero;"
 
 #. type: Bullet: ' - '
 msgid ""
@@ -98,7 +98,7 @@ msgstr "a source code comment aimed at somebody called Wolf;"
 
 #. type: Bullet: ' - '
 msgid "a collection of rude gestures in the xwrists package."
-msgstr "a collection of rude gestures in the xwrists package;"
+msgstr "a collection of rude gestures in the xwrists package."
 
 #. type: Plain text
 msgid ""

vafa
diff --git "a/Debian/debi\303\242neries/grosmot.en.po" "b/Debian/debi\303\242neries/grosmot.en.po"
index 2aac30ca..b0ab8398 100644
--- "a/Debian/debi\303\242neries/grosmot.en.po"
+++ "b/Debian/debi\303\242neries/grosmot.en.po"
@@ -3,38 +3,38 @@
 # This file is distributed under the same license as the PACKAGE package.
 # FIRST AUTHOR <EMAIL@ADDRESS>, YEAR.
 #
-#, fuzzy
 msgid ""
 msgstr ""
-"Project-Id-Version: PACKAGE VERSION\n"
+"Project-Id-Version: \n"
 "POT-Creation-Date: 2022-12-16 13:24+0000\n"
-"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
-"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
-"Language-Team: LANGUAGE <LL@li.org>\n"
-"Language: \n"
+"PO-Revision-Date: 2022-12-16 22:31+0900\n"
+"Language: en\n"
 "MIME-Version: 1.0\n"
 "Content-Type: text/plain; charset=UTF-8\n"
 "Content-Transfer-Encoding: 8bit\n"
+"Last-Translator: \n"
+"Language-Team: \n"
+"X-Generator: Poedit 2.4.2\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!meta date=\"Fri, 16 Dec 2022 22:00:03 +0900\"]]\n"
-msgstr ""
+msgstr "[[!meta date=\"Fri, 16 Dec 2022 22:00:03 +0900\"]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!meta updated=\"Fri, 16 Dec 2022 22:00:03 +0900\"]]\n"
-msgstr ""
+msgstr "[[!meta updated=\"Fri, 16 Dec 2022 22:00:03 +0900\"]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!tag Debian]]\n"
-msgstr ""
+msgstr "[[!tag Debian]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!meta title=\"Les grots mots dans Debian.\"]]\n"
-msgstr ""
+msgstr "[[!meta title=\"Bad words in Debian.\"]]\n"
 
 #. type: Plain text
 msgid ""
@@ -44,59 +44,66 @@ msgid ""
 "ensuite utilisé <http://codesearch.debian.net> pour étudier plus en détail "
 "son emploi."
 msgstr ""
+"A discussion on the _debian-project_ mailing list caught my attention to an "
+"Italian word meaning something like “would you be so kind to please go "
+"somewhere else?”, but in a more direct and vulgar manner. I then used  "
+"<http://codesearch.debian.net> to study its usage more in detail."
 
 #. type: Plain text
 msgid "Je l'ai trouvé dans :"
-msgstr ""
+msgstr "I found it in:"
 
 #. type: Bullet: ' - '
 msgid "le code source de XEmacs ;"
-msgstr ""
+msgstr "The source code of XEmacs;"
 
 #. type: Bullet: ' - '
 msgid "une liste de gros mots pour policer les conversations dans BZFlag ;"
-msgstr ""
+msgstr "a list of bad words to filter conversations in BZflag;"
 
 #. type: Bullet: ' - '
 msgid "le générateur aléatoire de phrases PolyGen ;"
-msgstr ""
+msgstr "the random sentence generator PolyGen;"
 
 #. type: Bullet: ' - '
 msgid "le code source du jeu de plateau Tagua ;"
-msgstr ""
+msgstr "The source code of the board game Tagua;"
 
 #. type: Bullet: ' - '
 msgid ""
 "une base de données d'épigrammes vulguaires pour la plateforme éducative "
 "WIMS ;"
-msgstr ""
+msgstr "A database of offensive fortunes for the educative platform WIMS;"
 
 #. type: Bullet: ' - '
 msgid "le jeu de mots croisés parololottero ;"
-msgstr ""
+msgstr "The crossword game parolottero;"
 
 #. type: Bullet: ' - '
 msgid ""
 "une base de données d'épigrammes vulguaires pour messages de bienvenue ou "
 "signatures de courriels ;"
 msgstr ""
+"a database of offensive fortunes for login screens and email signatures;"
 
 #. type: Bullet: ' - '
 msgid "des listes de mots de passes trop fréquents ;"
-msgstr ""
+msgstr "a list of (too) frequent passwords;"
 
 #. type: Bullet: ' - '
 msgid ""
 "un commentaire destiné à un déonmmé Wolf dans le code source d'un autre "
 "programme ;"
-msgstr ""
+msgstr "a source code comment aimed at somebody called Wolf;"
 
 #. type: Bullet: ' - '
 msgid "a collection of rude gestures in the xwrists package."
-msgstr ""
+msgstr "a collection of rude gestures in the xwrists package;"
 
 #. type: Plain text
 msgid ""
 "Ce fut une promenade rafraîchissante et récréactive dans l'univers des "
 "paquets Debian."
 msgstr ""
+"That was a refreshing and pleasant recreation in the Debian package "
+"universe."

updated PO files
diff --git "a/Debian/debi\303\242neries/grosmot.en.po" "b/Debian/debi\303\242neries/grosmot.en.po"
new file mode 100644
index 00000000..2aac30ca
--- /dev/null
+++ "b/Debian/debi\303\242neries/grosmot.en.po"
@@ -0,0 +1,102 @@
+# SOME DESCRIPTIVE TITLE
+# Copyright (C) YEAR Free Software Foundation, Inc.
+# This file is distributed under the same license as the PACKAGE package.
+# FIRST AUTHOR <EMAIL@ADDRESS>, YEAR.
+#
+#, fuzzy
+msgid ""
+msgstr ""
+"Project-Id-Version: PACKAGE VERSION\n"
+"POT-Creation-Date: 2022-12-16 13:24+0000\n"
+"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
+"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
+"Language-Team: LANGUAGE <LL@li.org>\n"
+"Language: \n"
+"MIME-Version: 1.0\n"
+"Content-Type: text/plain; charset=UTF-8\n"
+"Content-Transfer-Encoding: 8bit\n"
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!meta date=\"Fri, 16 Dec 2022 22:00:03 +0900\"]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!meta updated=\"Fri, 16 Dec 2022 22:00:03 +0900\"]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!tag Debian]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!meta title=\"Les grots mots dans Debian.\"]]\n"
+msgstr ""
+
+#. type: Plain text
+msgid ""
+"Une conversation sur la list _debian-project_ a attiré mon attention sur un "
+"mot italien signifiant quelque chose comme « auriez-vous la gentillesse "
+"d'aller voir ailleurs ? », mais en version plus directe et vulgaire.  J'ai "
+"ensuite utilisé <http://codesearch.debian.net> pour étudier plus en détail "
+"son emploi."
+msgstr ""
+
+#. type: Plain text
+msgid "Je l'ai trouvé dans :"
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid "le code source de XEmacs ;"
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid "une liste de gros mots pour policer les conversations dans BZFlag ;"
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid "le générateur aléatoire de phrases PolyGen ;"
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid "le code source du jeu de plateau Tagua ;"
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"une base de données d'épigrammes vulguaires pour la plateforme éducative "
+"WIMS ;"
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid "le jeu de mots croisés parololottero ;"
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"une base de données d'épigrammes vulguaires pour messages de bienvenue ou "
+"signatures de courriels ;"
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid "des listes de mots de passes trop fréquents ;"
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"un commentaire destiné à un déonmmé Wolf dans le code source d'un autre "
+"programme ;"
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid "a collection of rude gestures in the xwrists package."
+msgstr ""
+
+#. type: Plain text
+msgid ""
+"Ce fut une promenade rafraîchissante et récréactive dans l'univers des "
+"paquets Debian."
+msgstr ""

vafa
diff --git "a/Debian/debi\303\242neries/grosmot.mdwn" "b/Debian/debi\303\242neries/grosmot.mdwn"
new file mode 100644
index 00000000..1aee2db4
--- /dev/null
+++ "b/Debian/debi\303\242neries/grosmot.mdwn"
@@ -0,0 +1,26 @@
+[[!meta date="Fri, 16 Dec 2022 22:00:03 +0900"]]
+[[!meta updated="Fri, 16 Dec 2022 22:00:03 +0900"]]
+[[!tag Debian]]
+
+[[!meta title="Les grots mots dans Debian."]]
+
+Une conversation sur la list _debian-project_ a attiré mon attention sur un mot
+italien signifiant quelque chose comme « auriez-vous la gentillesse d'aller
+voir ailleurs ? », mais en version plus directe et vulgaire.  J'ai ensuite
+utilisé <http://codesearch.debian.net> pour étudier plus en détail son emploi.
+
+Je l'ai trouvé dans :
+
+ - le code source de XEmacs ;
+ - une liste de gros mots pour policer les conversations dans BZFlag ;
+ - le générateur aléatoire de phrases PolyGen ;
+ - le code source du jeu de plateau Tagua ;
+ - une base de données d'épigrammes vulguaires pour la plateforme éducative WIMS ;
+ - le jeu de mots croisés parololottero ;
+ - une base de données d'épigrammes vulguaires pour messages de bienvenue ou signatures de courriels ;
+ - des listes de mots de passes trop fréquents ;
+ - un commentaire destiné à un déonmmé Wolf dans le code source d'un autre programme ;
+ - a collection of rude gestures in the xwrists package.
+
+Ce fut une promenade rafraîchissante et récréactive dans l'univers des paquets
+Debian.

updated PO files
diff --git a/Joules.en.po b/Joules.en.po
index bc02163d..2183e164 100644
--- a/Joules.en.po
+++ b/Joules.en.po
@@ -7,7 +7,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2022-03-10 11:47+0000\n"
+"POT-Creation-Date: 2022-12-16 12:58+0000\n"
 "PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
 "Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
 "Language-Team: LANGUAGE <LL@li.org>\n"
@@ -127,9 +127,23 @@ msgstr ""
 msgid ""
 "Je consomme entre 6 et 7 mètres cubes d'eau par mois pour un prix d'environ "
 "1000 yens, qui include la production et le retraitement.  Un rapport de "
-"l'observatoire de l'eau de la Seine-et-Marne, de 2016, estime entre 1.6 et "
-"16 % la part énergétique de la facture d'eau.  En extrapolant avec ma "
-"facture d'électricité, 100 yens font environ 11 MJ.  L'eau est précieuse et "
-"les effets de son gaspillage sont différents de ceux du gaspillage de "
-"l'énergie."
+"l'observatoire de l'eau de la Seine-et-Marne sur les enjeux énergétiques de "
+"l'eau potable et de l'assainissement, de 2016, estime entre 1.6 et 16 % la "
+"part énergétique de la facture d'eau.  En extrapolant avec ma facture "
+"d'électricité, 100 yens font environ 11 MJ.  L'eau est précieuse et les "
+"effets de son gaspillage sont différents de ceux du gaspillage de l'énergie."
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"Je travaille sur un campus qui consomme 100 000 000 kWh / an, c'est à dire "
+"360 000 000 MJ / an ou 360 TJ / an.  Cela inclut la consommation des "
+"résidences de quelques centaines d'étudiants et de chercheurs.  Imaginons "
+"qu'une personne consomme 10 000 kWh par an, c'est à dire 36 GJ, ce qui "
+"serait plus que la moyenne au Japon ou en Amérique, on voit que la "
+"consommation résidentielle reste négligeable dans l'équation.  Entre 1000 et "
+"2000 personnes travaillent sur le campus.  On peut donc dire que chacun "
+"d'entre nous consomme de l'ordre de 360 GJ / an en moyenne, et que c'est "
+"probablement un peu surestimé.  En comparaison, je consomme 800 MJ * 12 ~= "
+"10 GJ d'énergie en carburant pour aller travailler."
 msgstr ""

18S primers
diff --git a/biblio/19633714.mdwn b/biblio/19633714.mdwn
new file mode 100644
index 00000000..38e42bad
--- /dev/null
+++ b/biblio/19633714.mdwn
@@ -0,0 +1,17 @@
+[[!meta title="A method for studying protistan diversity using massively parallel sequencing of V9 hypervariable regions of small-subunit ribosomal RNA genes."]]
+[[!tag eDNA]]
+
+Amaral-Zettler LA, McCliment EA, Ducklow HW, Huse SM.
+
+PLoS One. 2009 Jul 27;4(7):e6372. doi:10.1371/journal.pone.0006372
+
+A method for studying protistan diversity using massively parallel sequencing of V9 hypervariable regions of small-subunit ribosomal RNA genes.
+
+[[!pmid 19633714 desc="Primers contain degenerate sequences and are either universal or eukaryote-based.  Samples from Mount Hope Bay, Massachusetts and Palmer Station, Antarctica."]]
+
+    >18S_1380F eukaryotic 10.1371/journal.pone.0006372
+    CCCTGCCHTTTGTACACAC
+    >18S_1389F universal 10.1371/journal.pone.0006372
+    TTGTACACACCGCCC
+    >18S_1510R eukaryotic 10.1371/journal.pone.0006372
+    CCTTCYGCAGGTTCACCTAC
diff --git a/tags/eDNA.mdwn b/tags/eDNA.mdwn
index 48987409..f15996b4 100644
--- a/tags/eDNA.mdwn
+++ b/tags/eDNA.mdwn
@@ -18,6 +18,12 @@
 GCCAGTAGTCATATGCTTGTCT
 >18S_701R 10.1371/journal.pone.0073935
 GGAGCTGGAATTACCGC
+>18S_1380F eukaryotic 10.1371/journal.pone.0006372
+CCCTGCCHTTTGTACACAC
+>18S_1389F universal 10.1371/journal.pone.0006372
+TTGTACACACCGCCC
+>18S_1510R eukaryotic 10.1371/journal.pone.0006372
+CCTTCYGCAGGTTCACCTAC
 ```
 https://doi.org/10.1371/journal.pone.0073935
 

OIST
diff --git a/biblio/35877175.mdwn b/biblio/35877175.mdwn
new file mode 100644
index 00000000..1293e127
--- /dev/null
+++ b/biblio/35877175.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Speed variations of bacterial replisomes."]]
+[[!tag OIST]]
+
+Bhat D, Hauf S, Plessy C, Yokobayashi Y, Pigolotti S.
+
+Elife. 2022 Jul 25;11:e75884. doi:10.7554/eLife.75884
+
+Speed variations of bacterial replisomes.
+
+[[!pmid 35877175 desc="Collaboration with two other units at OIST."]]

Huxley
diff --git a/biblio/108414.mdwn b/biblio/108414.mdwn
new file mode 100644
index 00000000..40bf75e9
--- /dev/null
+++ b/biblio/108414.mdwn
@@ -0,0 +1,12 @@
+[[!meta title="Remarks upon Appendicularia and Doliolum, Two Genera of the Tunicata"]]
+[[!tag Oikopleura]]
+
+Huxley, Thomas Henry.
+
+Philosophical Transactions of the Royal Society of London, vol. 141, 1851, pp. 595–605.
+
+Remarks upon Appendicularia and Doliolum, Two Genera of the Tunicata
+
+<https://www.jstor.org/stable/108414>
+
+Observed appendicularians in New Guinea and in the South Pacific.  Found testis but no ovary.  Sampled animals did not have their house.  Recognised that Appendicularians are Tunicates.
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 5d015f69..29e4869a 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -673,6 +673,8 @@ Ecology
    near Californian and middle American coasts ([[Barham, 1979|biblio/17735049]],
    [[Galt, 1979|bilbio/Fishery_Bulletin_77_2_514]]).
  - Northern Chile: [[Aravena and Palma, 2002|biblio/10.4067_S0716-078X2002000200005]].
+ - Might have been observed by Huxley ([[1851|biblio/108414]]) in New Guinea and the
+   South Pacific.
 
 ### Elsewhere in the World
 

Formatting
diff --git a/biblio/10.1111_j.1439-0426.2005.00657.x.mdwn b/biblio/10.1111_j.1439-0426.2005.00657.x.mdwn
index c202aec5..245baa5f 100644
--- a/biblio/10.1111_j.1439-0426.2005.00657.x.mdwn
+++ b/biblio/10.1111_j.1439-0426.2005.00657.x.mdwn
@@ -1,10 +1,10 @@
-[[!meta title="Appendicularians: an important food supply for the Argentine anchovy _Engraulis anchoita_ in coastal waters"]]
+[[!meta title="Appendicularians: an important food supply for the Argentine anchovy Engraulis anchoita in coastal waters"]]
 [[!tag Oikopleura Fritillaria]]
 
 F. L. Capitanio, M. Pájaro, G. B. Esnal
 
 Journal of Applied Ichthyology Volume 21, Issue 5 p. 414-419. 10 October 2005 doi:10.1111/j.1439-0426.2005.00657.x
 
-Appendicularians: an important food supply for the Argentine anchovy Engraulis anchoita in coastal waters
+Appendicularians: an important food supply for the Argentine anchovy _Engraulis anchoita_ in coastal waters
 
 [[!doi 10.1111/j.1439-0426.2005.00657.x desc="_Oikopleura dioica_ and _O. fusiformis_ found in the stomach of anchovies.  The two _Oikopleura_ and _Fritillaria borealis_ were also found in plankton samples."]]

Appendicularia sicula
diff --git a/biblio/354924.mdwn b/biblio/354924.mdwn
new file mode 100644
index 00000000..1bdbcbe4
--- /dev/null
+++ b/biblio/354924.mdwn
@@ -0,0 +1,17 @@
+[[!meta title="Note sur un nouveau genre d'Appendiculaires."]]
+[[!tag Oikopleura Fritillaria]]
+
+Hermann Fol
+
+Archives de zoologie expérimentale et générale (Notes et revue) 3: XLIX-LIII
+
+Note sur un nouveau genre d'Appendiculaires.
+
+First description of _Appendicularia sicula_.  Not assigned to one of the 3
+tribes defined in 1872 because it shares features with all of them.
+
+Includes corrections to the 1872 paper: Kowalewskaia → Kowalewskia, aplostoma → haplostoma, ectothélium → ectoderme, endothélium → endoderme.
+
+SourceID 354924
+
+Bibliographic reference and link to biodiversity library: https://marinespecies.org/aphia.php?p=sourcedetails&id=354924

Hermann Fol
diff --git a/biblio/10.5962_p.318224.mdwn b/biblio/10.5962_p.318224.mdwn
new file mode 100644
index 00000000..d0b0e529
--- /dev/null
+++ b/biblio/10.5962_p.318224.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Hermann Fol, sa vie et ses travaux, avec un portrait"]]
+[[!tag Oikopleura]]
+
+Maurice Bedot
+
+Revue suisse de zoologie, 2, 1894, pp 1–21
+
+Hermann Fol, sa vie et ses travaux, avec un portrait
+
+[[!doi https://doi.org/10.5962/p.318224 desc="Éloge et bibliographie d'Hermann Fol après sa disparition."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 7acc2bac..5d015f69 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -4,8 +4,9 @@ Oikopleura
 ==========
 
 _Oikopleura dioica_ ([NCBI:txid34765](http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&amp;id=34765))
-is a tunicate larvacean (synonym: urochordate appendicularian) plankton.  Thus,
-it belongs to the same "chordate" phylum as us.  As the name indicates, it is
+is a tunicate larvacean (synonym: urochordate appendicularian) plankton
+discovered by [[Hermann Fol|biblio/10.5962_p.318224]]).
+It belongs to the same "chordate" phylum as us.  As the name indicates, it is
 the only _dioecious_ species of _Oikopleura_ (that is: male and female
 organisms are distinct).  Its reproduction is _semelparous_: the animals die
 afer releasing its gametes.  Each animal secretes a mucus "house" that is used

tu tudu tu tudu
diff --git a/biblio/10.1101_2020.09.08.286724.mdwn b/biblio/10.1101_2020.09.08.286724.mdwn
deleted file mode 100644
index 9cea5b64..00000000
--- a/biblio/10.1101_2020.09.08.286724.mdwn
+++ /dev/null
@@ -1,10 +0,0 @@
-[[!meta title="Cell culture-based shark karyotyping as a resource for chromosome-scale genome analysis"]]
-[[!tag bioRxiv cell_culture karyotype]]
-
-Yoshinobu Uno, Ryo Nozu, Itsuki Kiyatake, Nobuyuki Higashiguchi, Shuji Sodeyama, Kiyomi Murakumo, Keiichi Sato, Shigehiro Kuraku
-
-bioRxiv 2020.09.08.286724; doi: https://doi.org/10.1101/2020.09.08.286724
-
-Cell culture-based shark karyotyping as a resource for chromosome-scale genome analysis
-
-[[!doi 10.1101/2020.09.08.286724 desc="Primary cell culture of fibroblasts and lymphocytes.  Mitogens were used to stimulate lymphocyte growth. “2n = 102 for the whale shark (Rhincodon typus) and zebra shark (Stegostoma fasciatum), and 2n = 106 for the brownbanded bamboo shark (Chiloscyllium punctatum) and whitespotted bamboo shark (C. plagiosum)”.  In comparison with teleost cell culture medium, shark cells needed a higher osmolarity and the medium was supplemented with 333 mM urea, 188 mM NaCl and 54 mM trimethylamine N-oxide."]]
diff --git a/biblio/33159152.mdwn b/biblio/33159152.mdwn
new file mode 100644
index 00000000..bbb40060
--- /dev/null
+++ b/biblio/33159152.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Cell culture-based karyotyping of orectolobiform sharks for chromosome-scale genome analysis."]]
+[[!tag cell_culture karyotype]]
+
+Yoshinobu Uno, Ryo Nozu, Itsuki Kiyatake, Nobuyuki Higashiguchi, Shuji Sodeyama, Kiyomi Murakumo, Keiichi Sato, Shigehiro Kuraku
+
+Commun Biol. 2020 Nov 6;3(1):652. doi:10.1038/s42003-020-01373-7
+
+Cell culture-based karyotyping of orectolobiform sharks for chromosome-scale genome analysis.
+
+[[!pmid 33159152 desc="Primary cell culture of fibroblasts and lymphocytes.  Mitogens were used to stimulate lymphocyte growth. “2n = 102 for the whale shark (Rhincodon typus) and zebra shark (Stegostoma fasciatum), and 2n = 106 for the brownbanded bamboo shark (Chiloscyllium punctatum) and whitespotted bamboo shark (C. plagiosum)”.  In comparison with teleost cell culture medium, shark cells needed a higher osmolarity and the medium was supplemented with 333 mM urea, 188 mM NaCl and 54 mM trimethylamine N-oxide."]]
diff --git a/tags/cell_culture.mdwn b/tags/cell_culture.mdwn
index b387b0ce..f4a0970c 100644
--- a/tags/cell_culture.mdwn
+++ b/tags/cell_culture.mdwn
@@ -8,5 +8,6 @@ A few notes that just scratch the surface of a vast field…
  - [[Marteijn and coll. (2003)|biblio/12474249]] optimised a culture medium using a genetic algorithm.  This methdod
    has been used at least once in invertebrates ([[Munroe and coll. (2019)|biblio/30747414]]).
  - [[Kawamura and coll. (2021)|biblio/33899125]] reported the use of plasmin to establish coral cell lines.
+ - Shark cells need high osmolarity and a supplement of 333 mM urea, 188 mM NaCl and 54 mM trimethylamine N-oxide ([[Uno and coll., 2020|biblio/33159152]]).
 
 [[!inline pages="tagged(cell_culture)" limit=0]]

dnarrange tutorial
diff --git a/biblio/10.1101_2022.05.30.494079.mdwn b/biblio/10.1101_2022.05.30.494079.mdwn
new file mode 100644
index 00000000..85b47e27
--- /dev/null
+++ b/biblio/10.1101_2022.05.30.494079.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Finding rearrangements in nanopore DNA reads with last and dnarrange"]]
+[[!tag bioRxiv LAST]]
+
+Martin C. Frith, Satomi Mitsuhashi
+
+Posted August 15, 2022. doi:10.1101/2022.05.30.494079
+
+Finding rearrangements in nanopore DNA reads with last and dnarrange
+
+[[!doi 10.1101/2022.05.30.494079 desc="Tutorial on how to use `dnarrange`.  Examples of gene conversion, repeat insertion in the reference, pseudogene insertion in the query, etc."]]
diff --git a/tags/LAST.mdwn b/tags/LAST.mdwn
index 8a7d8a81..5a360e45 100644
--- a/tags/LAST.mdwn
+++ b/tags/LAST.mdwn
@@ -37,4 +37,7 @@ _bibliography in progress..._
 
  - JRA (Joint Read Alignment) uses LAST [[Shrestha and coll., 2018|biblio/29182778]].
 
+ - A tutorial for the use of `dnarrange` is published in [[Frith and
+   Mitsuhashi, 2022|biblio/10.1101_2022.05.30.494079]].
+
 [[!inline pages="tagged(LAST)" actions="no" limit=0]]

Correction
diff --git a/biblio/10.1007_s00227-003-1075-y.mdwn b/biblio/10.1007_s00227-003-1075-y.mdwn
index a457c0f8..df72e1c5 100644
--- a/biblio/10.1007_s00227-003-1075-y.mdwn
+++ b/biblio/10.1007_s00227-003-1075-y.mdwn
@@ -1,4 +1,4 @@
-[[!meta title="House formation and feeding behaviour of _Fritillaria borealis_ (Appendicularia: Tunicata)"]]
+[[!meta title="House formation and feeding behaviour of_Fritillaria borealis (Appendicularia: Tunicata)"]]
 [[!tag Fritillaria]]
 
 Flood, P.R.
@@ -7,4 +7,4 @@ Marine Biology 143, 467–475 (2003). doi:10.1007/s00227-003-1075-y
 
 House formation and feeding behaviour of _Fritillaria borealis_ (Appendicularia: Tunicata)
 
-[[!doi 10.1007/s00227-003-1075-y desc="“Suspended particles, between ~0.2 and 30 μm in diameter, are retained”  “most of the Fritillaria borealis organism was located within an acellular, mucous-like feeding structure, about 2 mm wide [...]. Only the posterior (gonadal) part of the animal trunk and the anterior "shoulders" of the tail were exposed to the outside”  “The difference in volume between the inflated and deflated states of this filter section was about eightfold.”  “a water processing capacity of ~10 to 12 ml h−1 or ~250 ml day−1 therefore seems reasonable for an adult.”  “ the sophisticated sleeve-like extension of the tail chamber, enabling F. borealis to swim with its deflated house in position for later reinflation, needs verification in other species.”"]]
+[[!doi 10.1007/s00227-003-1075-y desc="“Suspended particles, between ~0.2 and 30 μm in diameter, are retained”  “most of the Fritillaria borealis organism was located within an acellular, mucous-like feeding structure, about 2 mm wide [...]. Only the posterior (gonadal) part of the animal trunk and the anterior “shoulders” of the tail were exposed to the outside”  “The difference in volume between the inflated and deflated states of this filter section was about eightfold.”  “a water processing capacity of ~10 to 12 ml h−1 or ~250 ml day−1 therefore seems reasonable for an adult.”  “ the sophisticated sleeve-like extension of the tail chamber, enabling F. borealis to swim with its deflated house in position for later reinflation, needs verification in other species.”"]]

anchovies
diff --git a/biblio/10.1111_j.1439-0426.2005.00657.x.mdwn b/biblio/10.1111_j.1439-0426.2005.00657.x.mdwn
new file mode 100644
index 00000000..c202aec5
--- /dev/null
+++ b/biblio/10.1111_j.1439-0426.2005.00657.x.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Appendicularians: an important food supply for the Argentine anchovy _Engraulis anchoita_ in coastal waters"]]
+[[!tag Oikopleura Fritillaria]]
+
+F. L. Capitanio, M. Pájaro, G. B. Esnal
+
+Journal of Applied Ichthyology Volume 21, Issue 5 p. 414-419. 10 October 2005 doi:10.1111/j.1439-0426.2005.00657.x
+
+Appendicularians: an important food supply for the Argentine anchovy Engraulis anchoita in coastal waters
+
+[[!doi 10.1111/j.1439-0426.2005.00657.x desc="_Oikopleura dioica_ and _O. fusiformis_ found in the stomach of anchovies.  The two _Oikopleura_ and _Fritillaria borealis_ were also found in plankton samples."]]
diff --git a/tags/Fritillaria.mdwn b/tags/Fritillaria.mdwn
index 511cd92a..ed9d0dc3 100644
--- a/tags/Fritillaria.mdwn
+++ b/tags/Fritillaria.mdwn
@@ -11,4 +11,8 @@ _in progress_
  - Admirality bay, King George island, Antarctica, where the two most abundant appendicularians
    were _F. borealis_ and _O. gaussica_ ([[Panasiuk and Kalarus, 2021|biblio/10.3390_d13120675]).
 
+## South Atlantic
+
+ - _Fritillaria borealis_ (and _O. dioica_ and _O. fusiformis_) was found near Argentina by Capitanio, Pájaro and Esnal [[(2005)|10.1111_j.1439-0426.2005.00657.x]].
+
 [[!inline pages="tagged(Fritillaria)" limit=0]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 990895ba..7acc2bac 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -610,6 +610,8 @@ Ecology
    whether the viruses are digested.
  - Houses and fecal pellets of _Oikopleura_ species are consumed by eel larvae
    ([[Mochioka and Iwamizu, 1996|biblio/10.1007_BF00353257]]).
+ - _O. dioica_ and _O. fusiformis_ are eaten by anchovies ([[Capitanio, Pájaro and Esnal,
+    2005|biblio/10.1111_j.1439-0426.2005.00657.x]]).
  - In the Black Sea, invasion of _O. dioica's predator_ _Mnemiopsis leidyi_ (a
    ctenophore) decimated its population, which was restored to higher levels by the
    subsequent invasion of the predator's predator _Beroe ovata_. [[Shiganova,
@@ -683,6 +685,7 @@ Ecology
    most abundant in summer ([[Viñas and coll.,
    2013|biblio/10.1080_17451000.2012.745003]]), Caravelas river estuary and
    adjascent costal areas ([[Carvalho and Bonecker, 2010|biblio/10.1590_S1516-89132010000100020]]).
+ - Found near Argentina ([[Capitanio, Pájaro and Esnal, 2005|biblio/10.1111_j.1439-0426.2005.00657.x]]).
  - Southen sea of Cortez (Mexico), near Isla El Paradito (water temperature =
    30 °C; night dives), _O. dioica_ was found but not as abundant as other
    larvaceans ([[Galt, Grober and Sykes, 1985|biblio/10.2307_1541178]]).

Fritillaria
diff --git a/biblio/10.1007_s00227-003-1075-y.mdwn b/biblio/10.1007_s00227-003-1075-y.mdwn
new file mode 100644
index 00000000..a457c0f8
--- /dev/null
+++ b/biblio/10.1007_s00227-003-1075-y.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="House formation and feeding behaviour of _Fritillaria borealis_ (Appendicularia: Tunicata)"]]
+[[!tag Fritillaria]]
+
+Flood, P.R.
+
+Marine Biology 143, 467–475 (2003). doi:10.1007/s00227-003-1075-y
+
+House formation and feeding behaviour of _Fritillaria borealis_ (Appendicularia: Tunicata)
+
+[[!doi 10.1007/s00227-003-1075-y desc="“Suspended particles, between ~0.2 and 30 μm in diameter, are retained”  “most of the Fritillaria borealis organism was located within an acellular, mucous-like feeding structure, about 2 mm wide [...]. Only the posterior (gonadal) part of the animal trunk and the anterior "shoulders" of the tail were exposed to the outside”  “The difference in volume between the inflated and deflated states of this filter section was about eightfold.”  “a water processing capacity of ~10 to 12 ml h−1 or ~250 ml day−1 therefore seems reasonable for an adult.”  “ the sophisticated sleeve-like extension of the tail chamber, enabling F. borealis to swim with its deflated house in position for later reinflation, needs verification in other species.”"]]
diff --git a/tags/Fritillaria.mdwn b/tags/Fritillaria.mdwn
index 25be5e48..511cd92a 100644
--- a/tags/Fritillaria.mdwn
+++ b/tags/Fritillaria.mdwn
@@ -2,6 +2,8 @@
 
 _in progress_
 
+ - _Fritillaria borealis_ can swim with its house deflated ([[Flood, 2003|biblio/10.1007_s00227-003-1075-y]]).
+
 # Found in:
 
 ## Antarctica

Antarctica
diff --git a/biblio/10.3390_d13120675.mdwn b/biblio/10.3390_d13120675.mdwn
new file mode 100644
index 00000000..e62a315f
--- /dev/null
+++ b/biblio/10.3390_d13120675.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Appendicularia (Tunicata) in an Antarctic Glacial Fjord–Chaotic Fjordic Structure Community or Good Indicators of Oceanic Water Masses?"]]
+[[!tag Oikopleura Fritillaria]]
+
+Anna Panasiuk and Marcin Kalarus
+
+Diversity 2021, 13(12), 675. doi:10.3390/d13120675 
+
+Appendicularia (Tunicata) in an Antarctic Glacial Fjord–Chaotic Fjordic Structure Community or Good Indicators of Oceanic Water Masses?
+
+[[!doi 10.3390/d13120675 desc="_Fritillaria borealis_ was the most abundant and found mainly in summer, _Oikopleura gaussica_ was the second most abundant and found mainly in winter.  _F. antartica_, _F. aberrans_, _O. fusiformis_ and _O. parva_ were also found."]]
diff --git a/tags/Fritillaria.mdwn b/tags/Fritillaria.mdwn
index 42550b12..25be5e48 100644
--- a/tags/Fritillaria.mdwn
+++ b/tags/Fritillaria.mdwn
@@ -1,4 +1,12 @@
 [[!meta title="pages tagged Fritillaria"]]
 
-[[!inline pages="tagged(Fritillaria)" actions="no" archive="yes"
-feedshow=10]]
+_in progress_
+
+# Found in:
+
+## Antarctica
+
+ - Admirality bay, King George island, Antarctica, where the two most abundant appendicularians
+   were _F. borealis_ and _O. gaussica_ ([[Panasiuk and Kalarus, 2021|biblio/10.3390_d13120675]).
+
+[[!inline pages="tagged(Fritillaria)" limit=0]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 7e2cd656..990895ba 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -705,6 +705,11 @@ Ecology
  - Fossils in China: [[Zhang Aiyun, 1987|biblio/10.1360_yb1987-30-8-888]].
    Body rich in vanadium but not the house.
 
+### Not found in:
+
+ - Admirality bay, King George island, Antarctica, where the two most abundant appendicularians
+   were _F. borealis_ and _O. gaussica_ ([[Panasiuk and Kalarus, 2021|biblio/10.3390_d13120675]).
+
 Laboratory culture
 ------------------
 

Add PMID
diff --git a/biblio/31937756.mdwn b/biblio/31937756.mdwn
index 6fe6ecc4..af798cf4 100644
--- a/biblio/31937756.mdwn
+++ b/biblio/31937756.mdwn
@@ -9,4 +9,4 @@ Nat Commun. 2020 Jan 14;11(1):254. doi: 10.1038/s41467-019-14105-1.
 
 Environmental DNA reveals seasonal shifts and potential interactions in a marine community.
 
-[[!pmid desc="Found Oikopleura 18S sequences in MiSeq run SRR8473276."]]
+[[!pmid 31937756 desc="Found Oikopleura 18S sequences in MiSeq run SRR8473276."]]

Café
diff --git a/biblio/36324505.mdwn b/biblio/36324505.mdwn
new file mode 100644
index 00000000..748975e9
--- /dev/null
+++ b/biblio/36324505.mdwn
@@ -0,0 +1,37 @@
+[[!meta title="Improved Nanopore full-length cDNA sequencing by PCR-suppression."]]
+[[!tag Nanopore amplification PCR]]
+
+Bayega A, Oikonomopoulos S, Wang YC, Ragoussis J.
+
+Front Genet. 2022 Oct 17;13:1031355. doi:10.3389/fgene.2022.1031355.
+
+Improved Nanopore full-length cDNA sequencing by PCR-suppression.
+
+[[!pmid 36324505 desc="“We observed [a range of 2.2 to 8.3-fold increase in yield] of amplicons from the Panhandle method compared to the ONT method.”  “Further, the cDNA profile of samples from Panhandle protocol showed a significantly reduced amount of molecules below 600 bp compared to ONT protocol.”   “Reads generated with the ONT protocol showed a marked 3′ bias with only about 40–50% of reads showing full-length coverage of the genes”"]]
+
+
+for each sample total RNA was added together with
+
+RNA +
+1 μL of 10 μm oligo (dT) primer +
+1 μL of 10 mm dNTPs +
+Final volume: 11.6 μL pre-RT reaction.
+
+the reaction was incubated at 72°C 3 min. 4°C 10 min, 25°C 1 min, then held at 4°C.
+
+A 10.4μL reverse transcription (RT) reaction containing
+1 X Maxima H Buffer,
+1 μL RNaseOut (NEB),
+2 μL of 100 μm TSO,
+2 μL of 5M Betaine (Sigma-Aldrich),
+and 1 μL of Maxima H reverse transcriptase was added to the pre-RT reaction and the reaction incubated as shown in Supplementary Protocol.
+
+Following reverse transcription,
+
+5 μL of cDNA was used
+in a 50 μL PCR reaction containing
+1 μL of 10 μm PCR primer and
+25 μL of 2x LongAmp Taq Master mix (NEB).
+
+PCR was performed as shown in Supplementary Protocol. 20 PCR cycles were used. Following PCR, 1 μL of exonuclease (NEB) was added to each reaction and incubated for 15 min at 37°C followed by 15 min at 80°C and the samples were purified using 1x AMPure XP beads (Beckman Coulter).
+
diff --git a/tags/amplification.mdwn b/tags/amplification.mdwn
index 7c8520fe..c2b6bb67 100644
--- a/tags/amplification.mdwn
+++ b/tags/amplification.mdwn
@@ -18,6 +18,11 @@ concentration and annealing temperature) were investigated by [[Dai and coll.,
 complex sample, relatively long ITR (compared to primer length), high
 [annealing temperature], and high concentration of primer should be used.”.
 
+Suppression PCR was used to prepare transcriptome library for Oxford Nanopore
+Technologies sequencers ([[Bayega and coll., 2022|biblo/36324505]]).
+Transcript coverage and amplicon length were improved.  Surprisingly, yield was
+also higher.
+
 ## Other methods
 
  - Primary Template-directed Amplification (PTA), a kind of MDA with terminators

Fièvre
diff --git a/biblio/36379955.mdwn b/biblio/36379955.mdwn
new file mode 100644
index 00000000..796db0f7
--- /dev/null
+++ b/biblio/36379955.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Muscle5: High-accuracy alignment ensembles enable unbiased assessments of sequence homology and phylogeny."]]
+[[!tag alignment software]]
+
+Nat Commun. 2022 Nov 15;13(1):6968. doi:10.1038/s41467-022-34630-w
+
+Edgar RC.
+
+Muscle5: High-accuracy alignment ensembles enable unbiased assessments of sequence homology and phylogeny.
+
+[[!pmid 36379955 desc="Random variations of HMM parameters and guide trees in different replicates to explore systematic biases and remove them by averaging the replicates.  “Unlike typical conservation-based metrics, a column with many gaps or with biochemically dissimilar amino acids will be assigned high [confidence] if it is consistently reproduced.”"]]

Café
diff --git a/biblio/10.1017_S0025315409991627.mdwn b/biblio/10.1017_S0025315409991627.mdwn
new file mode 100644
index 00000000..f701044e
--- /dev/null
+++ b/biblio/10.1017_S0025315409991627.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Fritillaria ragusina sp. nov., a new species of Appendicularia (Tunicata) from the Adriatic Sea."]]
+[[!tag Fritillaria]]
+
+Garić, R., & Batistić, M.
+
+Journal of the Marine Biological Association of the United Kingdom, 2011, 91(2), 555-559. doi:10.1017/S0025315409991627
+
+Fritillaria ragusina sp. nov., a new species of Appendicularia (Tunicata) from the Adriatic Sea.
+
+[[!doi 10.1017/S0025315409991627 desc="“Samples were collected by vertical tows in the southern Adriatic on 18 and 19 February 2008[...] at the 1200-, 300-, and 150-m stations. None was found at the 100-m station” “Water temperature in the layers in which F. ragusina was found ranged from 13.67 to 14.23°C and salinity ranged from 38.48 to 38.77 psu.”  “[Trunk] length ranges from 204 to 445 µm and is about three times longer than wide.”  “The distinguishing features of F. ragusina are its multiple fusiform amphichordal cells along the lateral edges of the tail musculature, a broad trunk–tail connection that results from a wide tail fin at the initial part of the tail, and a tail musculature that ends at approximately 5/6 of the total tail length while the notochord proceeds past that point half-way to the tip of the tail.”  “Fritillaria ragusina is among the smaller appendicularians thus far discovered.”"]]

Fritillaria
diff --git a/biblio/10.1017_S0025315405011598.mdwn b/biblio/10.1017_S0025315405011598.mdwn
new file mode 100644
index 00000000..fb1d116a
--- /dev/null
+++ b/biblio/10.1017_S0025315405011598.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="New mesopelagic larvaceans in the genus Fritillaria from Monterey Bay, California"]]
+[[!tag Fritillaria]]
+
+Russell R. Hopcroft and Bruce H. Robison
+
+Journal of the Marine Biological Association of the United Kingdom , Volume 85 , Issue 3 , June 2005 , pp. 665-678 doi:10.1017/S0025315405011598
+
+New mesopelagic larvaceans in the genus _Fritillaria_ from Monterey Bay, California
+
+[[!doi 10.1017/S0025315405011598 desc="Primary paper for _Fritillaria rex_, _Fritillaria amphigonadis_ and _Fritillaria lucifer_."]]

creating tag page tags/Fritillaria
diff --git a/tags/Fritillaria.mdwn b/tags/Fritillaria.mdwn
new file mode 100644
index 00000000..42550b12
--- /dev/null
+++ b/tags/Fritillaria.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged Fritillaria"]]
+
+[[!inline pages="tagged(Fritillaria)" actions="no" archive="yes"
+feedshow=10]]

Fritillariawq
diff --git a/biblio/10.1007_s00227-003-1029-4.mdwn b/biblio/10.1007_s00227-003-1029-4.mdwn
new file mode 100644
index 00000000..34d485c1
--- /dev/null
+++ b/biblio/10.1007_s00227-003-1029-4.mdwn
@@ -0,0 +1,11 @@
+[[!meta title="The highly specialised gut of Fritillariidae (Appendicularia: Tunicata)."]]
+[[!tag Fritillaria]]
+
+Brena, C., Cima, F. & Burighel, P.
+
+Marine Biology 143, 57–71 (2003). doi:10.1007/s00227-003-1029-4
+
+The highly specialised gut of Fritillariidae (Appendicularia: Tunicata).
+
+[[!pmid desc="Electron microscopy analysis of the gut of _Fritillaria
+pellucida_ and _F. formica_."]]
diff --git a/biblio/10.1093_plankt_fbu092.mdwn b/biblio/10.1093_plankt_fbu092.mdwn
index d70b96f0..7a22457a 100644
--- a/biblio/10.1093_plankt_fbu092.mdwn
+++ b/biblio/10.1093_plankt_fbu092.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Interannual patterns during spring and late summer of larvaceans and pteropods in the coastal Gulf of Alaska, and their relationship to pink salmon survival"]]
-[[!tag Oikopleura]]
+[[!tag Fritillaria Oikopleura]]
 
 Ayla J. Doubleday, Russell R. Hopcroft
 
diff --git a/biblio/30880010.mdwn b/biblio/30880010.mdwn
index 58784652..dae1b41b 100644
--- a/biblio/30880010.mdwn
+++ b/biblio/30880010.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Massive Changes of Genome Size Driven by Expansions of Non-autonomous Transposable Elements."]]
-[[!tag Oikopleura repeat]]
+[[!tag Fritillaria Oikopleura repeat]]
 
 Naville M, Henriet S, Warren I, Sumic S, Reeve M, Volff JN, Chourrout D.
 
diff --git a/biblio/31543449.mdwn b/biblio/31543449.mdwn
index 7c5363bb..a1bd588b 100644
--- a/biblio/31543449.mdwn
+++ b/biblio/31543449.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Evolution of the U2 Spliceosome for Processing Numerous and Highly Diverse Non-canonical Introns in the Chordate Fritillaria borealis."]]
-[[!tag Oikopleura intron]]
+[[!tag Fritillaria Oikopleura intron]]
 
 Curr Biol. 2019 Oct 7;29(19):3193-3199.e4. doi:10.1016/j.cub.2019.07.092
 
diff --git a/biblio/36307829.mdwn b/biblio/36307829.mdwn
index 97183c44..4598663c 100644
--- a/biblio/36307829.mdwn
+++ b/biblio/36307829.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Laboratory study of Fritillaria lifecycle reveals key morphogenetic events leading to genus-specific anatomy."]]
-[[!tag Oikopleura]]
+[[!tag Fritillaria Oikopleura]]
 
 Simon Henriet, Anne Elin Aasjord, Daniel Marc Chourrout
 

Published
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index a81e4dc6..7e2cd656 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -719,7 +719,7 @@ Culture protocols (incomplete list):
  - Thompson lab protocol: [[Bouquet and coll., 2009|biblio/19461862]].
  - Cañestro lab protocol: [[Martí-Solans and coll., 2015|biblio/25044679]].
  - OIST's culture protocol: [[Masunaga and coll., 2020|biblio/32628172]].
- - Report of _Fritilaria_ being cultured: [[Henriet, Aasjord and Chourrout, 2022|biblio/10.1101_2022.05.25.493221]].
+ - Report of _Fritilaria_ being cultured: [[Henriet, Aasjord and Chourrout, 2022|biblio/36307829]].
 
 Food tested in laboratory (totally incomplete list):
 

Fritillaria
diff --git a/biblio/10.1101_2022.05.25.493221.mdwn b/biblio/10.1101_2022.05.25.493221.mdwn
deleted file mode 100644
index 5ff4aa22..00000000
--- a/biblio/10.1101_2022.05.25.493221.mdwn
+++ /dev/null
@@ -1,14 +0,0 @@
-[[!meta title="Laboratory study of Fritillaria lifecycle reveals larvacean commonalities and key morphogenetic events leading to taxon-specific anatomy"]]
-[[!tag bioRxiv Oikopleura]]
-
-Simon Henriet, Anne Elin Aasjord, Daniel Marc Chourrout
-
-bioRxiv https://doi.org/10.1101/2022.05.25.493221 May 25, 2022.
-
-Laboratory study of Fritillaria lifecycle reveals larvacean commonalities and key morphogenetic events leading to taxon-specific anatomy
-
-[[!doi 10.1101/2022.05.25.493221 desc="Possibly parasited by _Sphaeripara_ or
-_Oodinium_.  Fed with _Micromonas_, _Phaeocystis_ and _Synechococcus_ in
-culture. 4 chromosomes are visible in oocytes by DAPI staining.
-Self-fertilization was never observed.  Cellulose-producing cells identified by
-staining with a carbohydrate-binding-module (CBM)."]]
diff --git a/biblio/36307829.mdwn b/biblio/36307829.mdwn
new file mode 100644
index 00000000..97183c44
--- /dev/null
+++ b/biblio/36307829.mdwn
@@ -0,0 +1,16 @@
+[[!meta title="Laboratory study of Fritillaria lifecycle reveals key morphogenetic events leading to genus-specific anatomy."]]
+[[!tag Oikopleura]]
+
+Simon Henriet, Anne Elin Aasjord, Daniel Marc Chourrout
+
+Front Zool. 2022 Oct 28;19(1):26. doi:10.1186/s12983-022-00471-y
+
+Laboratory study of Fritillaria lifecycle reveals key morphogenetic events leading to genus-specific anatomy.
+
+[[!pmid 36307829 desc="Possibly parasited by a Syndiniale from the genus
+_Sphaeripara_ and _Oodinium_.  Fed with _Micromonas_, _Phaeocystis_ and
+_Synechococcus_ in culture. 4 chromosomes are visible in oocytes by DAPI
+staining.  Self-fertilization was never observed.  In vitro fertilized oocytes
+frequently aborted development when left in vessels without water flow.
+Embryos hatch between 4 and 6 h at 15 °C. Cellulose-producing cells identified
+by staining with a carbohydrate-binding-module (CBM)."]]

Typo
diff --git a/biblio/16120641.mdwn b/biblio/16120641.mdwn
index 15f19e59..37397929 100644
--- a/biblio/16120641.mdwn
+++ b/biblio/16120641.mdwn
@@ -7,4 +7,4 @@ Development. 2005 Oct;132(19):4259-72. doi:10.1242/dev.01973
 
 The evolutionary history of placodes: a molecular genetic investigation of the larvacean urochordate _Oikopleura dioica_.
 
-[[!pmid 16120641 desc="Animals fed with algal concentrates.  _O. dioica_ has one orthologue of _eyes absent_, _Eya_, and one orthologue of the vertebrate _Pitx_ genes, with multiple promoters and alternative splice sites, and lacking an OAR domain.  It has three _sine oculis_ orthologues, _Six1/2_, _Six3/6a_ and _Six3/6b.  They are not clustered like vertebrate genes, but the two _Six3/6_ share an intron position in their homeodomain.  Expression pattern of these genes support the hypothesis that _O. dioica_ has a placode that is homologous to the vertebrate olfactory placode."]]
+[[!pmid 16120641 desc="Animals fed with algal concentrates.  _O. dioica_ has one orthologue of _eyes absent_, _Eya_, and one orthologue of the vertebrate _Pitx_ genes, with multiple promoters and alternative splice sites, and lacking an OAR domain.  It has three _sine oculis_ orthologues, _Six1/2_, _Six3/6a_ and _Six3/6b_.  They are not clustered like vertebrate genes, but the two _Six3/6_ share an intron position in their homeodomain.  Expression pattern of these genes support the hypothesis that _O. dioica_ has a placode that is homologous to the vertebrate olfactory placode."]]

Café
diff --git a/biblio/16120641.mdwn b/biblio/16120641.mdwn
new file mode 100644
index 00000000..15f19e59
--- /dev/null
+++ b/biblio/16120641.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="The evolutionary history of placodes: a molecular genetic investigation of the larvacean urochordate Oikopleura dioica."]]
+[[!tag Oikopleura olfaction]]
+
+Bassham S, Postlethwait JH.
+
+Development. 2005 Oct;132(19):4259-72. doi:10.1242/dev.01973
+
+The evolutionary history of placodes: a molecular genetic investigation of the larvacean urochordate _Oikopleura dioica_.
+
+[[!pmid 16120641 desc="Animals fed with algal concentrates.  _O. dioica_ has one orthologue of _eyes absent_, _Eya_, and one orthologue of the vertebrate _Pitx_ genes, with multiple promoters and alternative splice sites, and lacking an OAR domain.  It has three _sine oculis_ orthologues, _Six1/2_, _Six3/6a_ and _Six3/6b.  They are not clustered like vertebrate genes, but the two _Six3/6_ share an intron position in their homeodomain.  Expression pattern of these genes support the hypothesis that _O. dioica_ has a placode that is homologous to the vertebrate olfactory placode."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 0bc923fe..a81e4dc6 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -258,6 +258,8 @@ Genes and pathways
  - _O. dioica_ has the miRNA machinery and some miRNAs such as _let-7a_ were detected.  36 % of
    the miRNAs had a length of 22 nt in [[Fu, Adamski and Thompson, 2008|biblio/18339653]].
  - 6 FGF genes were detected by Oulion, Bertrand and Escriva ([[2012|biblio/22919541]]).
+ - _Eya_, _Pitx_, _Six1/2_, _Six3/6a_ and _Six3/6b_, with expression patterns supporting
+   homology of larvacean and vertebrate placodes ([[Bassham and Postlethwait, 2005|biblio/16120641]]).
 
 ### Lost
 


diff --git a/biblio/11732199.mdwn b/biblio/11732199.mdwn
index 90ac70f7..33f30cfe 100644
--- a/biblio/11732199.mdwn
+++ b/biblio/11732199.mdwn
@@ -7,4 +7,4 @@ Protoplasma. 2001;216(1-2):71-4.
 
 Cellulose in the house of the appendicularian Oikopleura rufescens.
 
-[[!pmid 11732199 desc="Electron diffraction analysis found highly crystalline cellulose I."]]
+[[!pmid 11732199 desc="Electron diffraction analysis found highly crystalline cellulose Iβ."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 9da2caef..0bc923fe 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -200,7 +200,7 @@ Genes and pathways
    found by [[Sagane et al. (2010)|biblio/20335363]] and [[Nakashima et al.
    (2011)|biblio/20972815]].  They are used to produce different crystalline forms
    of cellulose ([[Nakashima et al., 2011|biblio/20972815]]).  Crystalline
-   cellulose I was also found in _O. rufescens by_ [[Kimura and coll
+   cellulose Iβ was also found in _O. rufescens by_ [[Kimura and coll
    (2001)|biblio/11732199]]. The CesA gene is trans-spliced in the ascidian _Ciona
    intestinalis_ ([[Matthysse and coll., 2004|biblio/14722352]]).
  - A GH6 (glycosyl hydrolase family 6) domain is found in the CesA genes,
diff --git a/tags/cellulose.mdwn b/tags/cellulose.mdwn
index 93981ed3..d8fe5a8c 100644
--- a/tags/cellulose.mdwn
+++ b/tags/cellulose.mdwn
@@ -26,4 +26,7 @@ of _Od-CesA1_ and _Od-CesA2_ respectively.  ([[Sagane and coll.,
 expression of _Od-CesA2_ might be cyclic ([[Nakashima and coll.,
 2011|biblio/20972815]]).
 
+The house of _O. rufescens_ is also made of cellulose Iβ ([[Kimura and coll.,
+2001|biblio/11732199]]).
+
 [[!inline pages="tagged(cellulose)" limit=0]]

Café
diff --git a/biblio/30143642.mdwn b/biblio/30143642.mdwn
new file mode 100644
index 00000000..88a403a2
--- /dev/null
+++ b/biblio/30143642.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Chitin-based barrier immunity and its loss predated mucus-colonization by indigenous gut microbiota."]]
+[[!tag cellulose tunicate Ciona]]
+
+Nakashima K, Kimura S, Ogawa Y, Watanabe S, Soma S, Kaneko T, Yamada L, Sawada H, Tung CH, Lu TM, Yu JK, Villar-Briones A, Kikuchi S, Satoh N.
+
+Nat Commun. 2018 Aug 24;9(1):3402. doi:10.1038/s41467-018-05884-0
+
+Chitin-based barrier immunity and its loss predated mucus-colonization by indigenous gut microbiota.
+
+[[!pmid 30143642 desc="The gut cells of _Ciona robusta_ are protected by a membrane made of cellulose and chitin, that bacteria can not cross.  The three most abundant proteins in this membrane are Ci-MACPF1, related to perforins, variable region-containing chitin-binding protein (VCBP), and Ci-GFM1, a gel-forming mucin.  Thus, the tunicate gut has features related to insects (chitin barrier) and vertebrates (mucin barrier)."]]
diff --git a/tags/Ciona.mdwn b/tags/Ciona.mdwn
index 9ac123bc..6fa03c8e 100644
--- a/tags/Ciona.mdwn
+++ b/tags/Ciona.mdwn
@@ -102,4 +102,8 @@ with respcet to _C. roulei_ ([[Nydam and Harrison, 2010|biblio/20403444]]).
 Blood cells of _C intestinalis_ (_robusta_?) contain vanadium ([[Michibata,
 1996|biblio/10.2108_zsj.13.489]]).
 
+The gut barrier of _Ciona robusta_ is made of chitin, cellulose, perforins,
+chitin-binding proteins and mucins ([[Nakashima and coll.,
+2018|biblio/30143642]]).
+
 [[!inline pages="tagged(Ciona)" actions="no" limit=0]]

Typo
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 498e8bb8..9da2caef 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -39,7 +39,7 @@ Parasites: _Oodinium pouchetii_, microsporidia (on _O. gracilis_ ([[Savelieva
 Phylogeny
 ---------
 
- - Huxley ([[1851|bilbio/10.1098_rstl.1851.0028]]) identified appendicularians
+ - Huxley ([[1851|biblio/10.1098_rstl.1851.0028]]) identified appendicularians
    as tunicates.
  - 18S rDNA phylogenies of [[Wada and Satoh, 1994|biblio/8127885]],
    [[Wada 1998|biblio/9729883]] and [[Swalla and coll., 2000|biblio/12116483]]

Syntax
diff --git a/biblio/10.1098_rstl.1851.0028.mdwn b/biblio/10.1098_rstl.1851.0028.mdwn
index a2cb8044..746a4df2 100644
--- a/biblio/10.1098_rstl.1851.0028.mdwn
+++ b/biblio/10.1098_rstl.1851.0028.mdwn
@@ -9,4 +9,4 @@ Remarks upon Appendicularia and Doliolum, Two Genera of the Tunicata
 
 https://www.jstor.org/stable/108414
 
-[[!doi 10.1098/rstl.1851.0028 desc="One of the appendicularian species found in the Bering Sea was called _Appendicularia flagellum_ by Chamisso (1821), _Oikopleura Chamissonis_ by Mertens (1830) and _Oikopleura bifurcata_ by Quoy and Gaimard.  Huxley id not see houses, even when keeping the animals in vessels for multiple hours.  He identified appendicularia as tunicates, and notes “... so does _Appendicularia_ typify, in the larval state of the Ascidians.” ”In young specimens the testis is greenish, and contains nothing but small pale circular cells; but in adults it assumes a deep orange red-colour“  “The animal has an ovoid or flask like body, one- fourth of an inch in length, to which is attached a long curved lanceolat tail.”"
+[[!doi 10.1098/rstl.1851.0028 desc="One of the appendicularian species found in the Bering Sea was called _Appendicularia flagellum_ by Chamisso (1821), _Oikopleura Chamissonis_ by Mertens (1830) and _Oikopleura bifurcata_ by Quoy and Gaimard.  Huxley id not see houses, even when keeping the animals in vessels for multiple hours.  He identified appendicularia as tunicates, and notes “... so does _Appendicularia_ typify, in the larval state of the Ascidians.” ”In young specimens the testis is greenish, and contains nothing but small pale circular cells; but in adults it assumes a deep orange red-colour“  “The animal has an ovoid or flask like body, one- fourth of an inch in length, to which is attached a long curved lanceolat tail.”"]]

More café
diff --git a/biblio/10.1098_rstl.1851.0028.mdwn b/biblio/10.1098_rstl.1851.0028.mdwn
index 2ff09de9..a2cb8044 100644
--- a/biblio/10.1098_rstl.1851.0028.mdwn
+++ b/biblio/10.1098_rstl.1851.0028.mdwn
@@ -9,4 +9,4 @@ Remarks upon Appendicularia and Doliolum, Two Genera of the Tunicata
 
 https://www.jstor.org/stable/108414
 
-[[!doi 10.1098/rstl.1851.0028 desc="One of the appendicularian species found in the Bering Sea was called _Appendicularia flagellum_ by Chamisso (1821), _Oikopleura Chamissonis_ by Mertens (1830) and _Oikopleura bifurcata_ by Quoy and Gaimard.  Huxley id not see houses, even when keeping the animals in vessels for multiple hours.  He identified appendicularia as tunicates, and notes “... so does _Appendicularia_ typify, in the larval state of the Ascidians.”"
+[[!doi 10.1098/rstl.1851.0028 desc="One of the appendicularian species found in the Bering Sea was called _Appendicularia flagellum_ by Chamisso (1821), _Oikopleura Chamissonis_ by Mertens (1830) and _Oikopleura bifurcata_ by Quoy and Gaimard.  Huxley id not see houses, even when keeping the animals in vessels for multiple hours.  He identified appendicularia as tunicates, and notes “... so does _Appendicularia_ typify, in the larval state of the Ascidians.” ”In young specimens the testis is greenish, and contains nothing but small pale circular cells; but in adults it assumes a deep orange red-colour“  “The animal has an ovoid or flask like body, one- fourth of an inch in length, to which is attached a long curved lanceolat tail.”"

Café
diff --git a/biblio/10.1098_rstl.1851.0028.mdwn b/biblio/10.1098_rstl.1851.0028.mdwn
new file mode 100644
index 00000000..2ff09de9
--- /dev/null
+++ b/biblio/10.1098_rstl.1851.0028.mdwn
@@ -0,0 +1,12 @@
+[[!meta title="Remarks upon Appendicularia and Doliolum, Two Genera of the Tunicata"]]
+[[!tag Oikopleura]]
+
+Thomas Henry Huxley
+
+Philosophical Transactions of the Royal Society of London Vol. 141 (1851), pp. 595-605 doi:10.1098/rstl.1851.0028
+
+Remarks upon Appendicularia and Doliolum, Two Genera of the Tunicata
+
+https://www.jstor.org/stable/108414
+
+[[!doi 10.1098/rstl.1851.0028 desc="One of the appendicularian species found in the Bering Sea was called _Appendicularia flagellum_ by Chamisso (1821), _Oikopleura Chamissonis_ by Mertens (1830) and _Oikopleura bifurcata_ by Quoy and Gaimard.  Huxley id not see houses, even when keeping the animals in vessels for multiple hours.  He identified appendicularia as tunicates, and notes “... so does _Appendicularia_ typify, in the larval state of the Ascidians.”"
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index f5f35937..498e8bb8 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -39,6 +39,8 @@ Parasites: _Oodinium pouchetii_, microsporidia (on _O. gracilis_ ([[Savelieva
 Phylogeny
 ---------
 
+ - Huxley ([[1851|bilbio/10.1098_rstl.1851.0028]]) identified appendicularians
+   as tunicates.
  - 18S rDNA phylogenies of [[Wada and Satoh, 1994|biblio/8127885]],
    [[Wada 1998|biblio/9729883]] and [[Swalla and coll., 2000|biblio/12116483]]
    place larvaceans sister to all tunicates.

One more typo.
diff --git a/tags/cellulose.mdwn b/tags/cellulose.mdwn
index fcc39088..93981ed3 100644
--- a/tags/cellulose.mdwn
+++ b/tags/cellulose.mdwn
@@ -7,7 +7,7 @@ weavable fibers for wearable sensors ([[Cho and coll., 2019|biblio/31369239]]).
 
 CesA from _C savignyi_ can rescue _A. tumefaciens_ mutants ([[Matthysse and coll., 2004|biblio/14722352]]).
 
-Sasakura and coll. ([[2016|biblio/28003446]] have proposed that the GC-rich
+Sasakura and coll. ([[2016|biblio/28003446]]) have proposed that the GC-rich
 genome of actinobacteria might have provided an AP-2 binding site promoting
 expression in the epidermis.
 

Typo
diff --git a/tags/cellulose.mdwn b/tags/cellulose.mdwn
index 3f5cdb9e..fcc39088 100644
--- a/tags/cellulose.mdwn
+++ b/tags/cellulose.mdwn
@@ -22,8 +22,8 @@ GHC6-1 lacks a conserved catalytic aspartate ([[Li and coll., 2020|biblio/328237
 In _Oikopleura_, the structure of cellulose fibers is triclinic I(α) in larval
 stages and monoclinic I(β) in the house.  This correlates with the expression
 of _Od-CesA1_ and _Od-CesA2_ respectively.  ([[Sagane and coll.,
-2010|biblio/20335363]], [[Nakashima and coll., 2011|biblo/20972815]]).  The
+2010|biblio/20335363]], [[Nakashima and coll., 2011|biblio/20972815]]).  The
 expression of _Od-CesA2_ might be cyclic ([[Nakashima and coll.,
-2011|biblo/20972815]]).
+2011|biblio/20972815]]).
 
 [[!inline pages="tagged(cellulose)" limit=0]]

cellulose
diff --git a/tags/cellulose.mdwn b/tags/cellulose.mdwn
index f8e8870f..3f5cdb9e 100644
--- a/tags/cellulose.mdwn
+++ b/tags/cellulose.mdwn
@@ -21,7 +21,9 @@ GHC6-1 lacks a conserved catalytic aspartate ([[Li and coll., 2020|biblio/328237
 
 In _Oikopleura_, the structure of cellulose fibers is triclinic I(α) in larval
 stages and monoclinic I(β) in the house.  This correlates with the expression
-of _Od-CesA1_ and _Od-CesA2_ respectively.  The expression of _Od-CesA2_ might
-be cyclic ([[Nakashima and coll., 2011|biblo/20972815]]).
+of _Od-CesA1_ and _Od-CesA2_ respectively.  ([[Sagane and coll.,
+2010|biblio/20335363]], [[Nakashima and coll., 2011|biblo/20972815]]).  The
+expression of _Od-CesA2_ might be cyclic ([[Nakashima and coll.,
+2011|biblo/20972815]]).
 
 [[!inline pages="tagged(cellulose)" limit=0]]

More about cellulose in Oiks.
diff --git a/tags/cellulose.mdwn b/tags/cellulose.mdwn
index f29f5376..f8e8870f 100644
--- a/tags/cellulose.mdwn
+++ b/tags/cellulose.mdwn
@@ -19,4 +19,9 @@ gene is found as an independent copy and as a domain of _CesA_ in Tunicates
 ([[Inoue, Nakashima and Satoh, 2019|biblio/30974905]]).  In _Oikopleura_,
 GHC6-1 lacks a conserved catalytic aspartate ([[Li and coll., 2020|biblio/32823766]]).
 
+In _Oikopleura_, the structure of cellulose fibers is triclinic I(α) in larval
+stages and monoclinic I(β) in the house.  This correlates with the expression
+of _Od-CesA1_ and _Od-CesA2_ respectively.  The expression of _Od-CesA2_ might
+be cyclic ([[Nakashima and coll., 2011|biblo/20972815]]).
+
 [[!inline pages="tagged(cellulose)" limit=0]]

Café
diff --git a/biblio/22919541.mdwn b/biblio/22919541.mdwn
new file mode 100644
index 00000000..79fd2a4e
--- /dev/null
+++ b/biblio/22919541.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Evolution of the FGF Gene Family."]]
+[[!tag Oikopleura]]
+
+Oulion S, Bertrand S, Escriva H.
+
+Int J Evol Biol. 2012;2012:298147. doi:10.1155/2012/298147
+
+Evolution of the FGF Gene Family.
+
+[[!pmid 22919541 desc="“In another urochordate, the larvacean _Oikopleura dioica_, we found six FGF coding genes, among which two can be assigned to the FGF11/12/13/14 subfamily, and one to the FGF9/16/20 subfamily”"]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index e50d170d..f5f35937 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -255,6 +255,7 @@ Genes and pathways
  - _Nk4_, _Hand1/2_ and _FoxF_ (heart development, [[Ferrández-Roldán and coll., 2021|biblio/34789899]]).
  - _O. dioica_ has the miRNA machinery and some miRNAs such as _let-7a_ were detected.  36 % of
    the miRNAs had a length of 22 nt in [[Fu, Adamski and Thompson, 2008|biblio/18339653]].
+ - 6 FGF genes were detected by Oulion, Bertrand and Escriva ([[2012|biblio/22919541]]).
 
 ### Lost
 

Café
diff --git a/tags/mitochondrion.mdwn b/tags/mitochondrion.mdwn
index c31a6fd1..4844f53e 100644
--- a/tags/mitochondrion.mdwn
+++ b/tags/mitochondrion.mdwn
@@ -92,4 +92,6 @@ detrimental ([[Wanrooij and coll., 2020|biblio/32513727]]).
 
 The presence of mtDNA concatemers in nuclear genomes was postulated by [[Balciuniene and Balciunas (2019)|biblio/31244882]].
 
+The Vertebrate Genome Project has a tool to remove NUMTs ([[Rhie and coll., 2021|biblio/30402909]]).
+
 [[!inline pages="tagged(mitochondrion)" limit=0]]

Published
diff --git a/biblio/10.1101_2020.05.22.110833.mdwn b/biblio/10.1101_2020.05.22.110833.mdwn
deleted file mode 100644
index d459d3ff..00000000
--- a/biblio/10.1101_2020.05.22.110833.mdwn
+++ /dev/null
@@ -1,10 +0,0 @@
-[[!meta title="Towards complete and error-free genome assemblies of all vertebrate species"]]
-[[!tag bioRxiv assembly]]
-
-Rhle and many collaborators.
-
-bioRxiv 2020.05.22.110833; doi: https://doi.org/10.1101/2020.05.22.110833
-
-Towards complete and error-free genome assemblies of all vertebrate species
-
-[[!doi 10.1101/2020.05.22.110833 desc="Presents the Vertebrate Genome Project (VGP) pipeline for PacBio and 10X Genomics linked reads.  Contains a module to sort out NUMPs from Mitochondrial DNA."]]
diff --git a/biblio/33911273.mdwn b/biblio/33911273.mdwn
new file mode 100644
index 00000000..4798e0fa
--- /dev/null
+++ b/biblio/33911273.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Towards complete and error-free genome assemblies of all vertebrate species"]]
+[[!tag mitochondrion assembly]]
+
+Rhle and many collaborators.
+
+Nature. 2021 Apr;592(7856):737-746. doi:10.1038/s41586-021-03451-0
+
+Towards complete and error-free genome assemblies of all vertebrate species
+
+[[!pmid 33911273 desc="Presents the Vertebrate Genome Project (VGP) pipeline for PacBio and 10X Genomics linked reads.  Contains a module to sort out NUMTs from Mitochondrial DNA."]]

creating tag page tags/cephalopod
diff --git a/tags/cephalopod.mdwn b/tags/cephalopod.mdwn
new file mode 100644
index 00000000..d1913788
--- /dev/null
+++ b/tags/cephalopod.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged cephalopod"]]
+
+[[!inline pages="tagged(cephalopod)" actions="no" archive="yes"
+feedshow=10]]

Café
diff --git a/biblio/10.1101_2022.09.25.509396.mdwn b/biblio/10.1101_2022.09.25.509396.mdwn
new file mode 100644
index 00000000..e61e4e1a
--- /dev/null
+++ b/biblio/10.1101_2022.09.25.509396.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="RNA recoding in cephalopods tailors microtubule motor protein function"]]
+[[!tag bioRxiv editing cephalopod]]
+
+Kavita J Rangan, Samara L Reck-Peterson
+
+bioRxiv 2022.09.25.509396; doi: https://doi.org/10.1101/2022.09.25.509396
+
+RNA recoding in cephalopods tailors microtubule motor protein function
+
+[[!doi 10.1101/2022.09.25.509396 desc="Editing increases at lower temperatures.  Could that be an adaptation to keep protein flexibility temperature-independant by replacing bulky amino acids with G?"]]

Café
diff --git a/biblio/35880393.mdwn b/biblio/35880393.mdwn
new file mode 100644
index 00000000..65a32373
--- /dev/null
+++ b/biblio/35880393.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Production of retinoic acid by engineered Saccharomyces cerevisiae using an endogenous aldehyde dehydrogenase."]]
+[[!tag synthetic yeast]]
+
+Hu Q, Yu H, Ye L.
+
+Biotechnol Bioeng. 2022 Jul 26. doi:10.1002/bit.28192
+
+Production of retinoic acid by engineered Saccharomyces cerevisiae using an endogenous aldehyde dehydrogenase.
+
+[[!pmid 35880393 desc="Screen for the most efficient aldehyde dehydrogenases to produce retinoic acid in S. cerevisiae strain Y03 identified MmAldh, which was used to scan the yeast genome for an endogenous replacement.  Hfd1 was found, and increasing its copy number lead to the best yields."]]
diff --git a/tags/synthetic.mdwn b/tags/synthetic.mdwn
index 009c3613..120fc94d 100644
--- a/tags/synthetic.mdwn
+++ b/tags/synthetic.mdwn
@@ -2,6 +2,8 @@
 
 _in progress_
 
+## Genomes
+
 Sc3.0 roadmap: [[Dai and coll., 2020|biblio/32791980]].
 
 “Biosynthesis of medicinal tropane alkaloids in yeast”: [[Srinivasan and Smolke and coll., 2020|biblio/32879484]]
@@ -10,4 +12,8 @@ Example of neochromosome synthesis in yeast: [[Postma and coll., 2021|biblio/334
 
 Artificial genome scrambling in yeast 2.0 with loxPsym sites: [[Brooks and coll, 2022|biblio/35239377]].
 
+## Pathway
+
+Increasing the copy number of the endogenous aldehyde dehydrogenase Hfd1 allowed [[Hu, Yu and Ye, 2022|biblio/35880393]] to obtain the best yield of conversion of retinol to retinoic acid..
+
 [[!inline pages="tagged(synthethic)" limit=0]]

cleanup
diff --git a/tags/culture.mdwn b/tags/culture.mdwn
deleted file mode 100644
index 5fab9196..00000000
--- a/tags/culture.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged culture"]]
-
-[[!inline pages="tagged(culture)" actions="no" archive="yes"
-feedshow=10]]

Polyamines
diff --git a/biblio/25096480.mdwn b/biblio/25096480.mdwn
new file mode 100644
index 00000000..8743841d
--- /dev/null
+++ b/biblio/25096480.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="An inverse small molecule screen to design a chemically defined medium supporting long-term growth of Drosophila cell lines."]]
+[[!tag cell_culture method screen]]
+
+Burnette M, Brito-Robinson T, Li J, Zartman J.
+
+Mol Biosyst. 2014 Oct;10(10):2713-23. doi:10.1039/c4mb00155a
+
+An inverse small molecule screen to design a chemically defined medium supporting long-term growth of Drosophila cell lines.
+
+[[!pmid 25096480 desc="“Using this approach we developed an intermediate “ZO Fortified” medium, made up of ZO media supplemented with insulin (5 μg mL−1), trehalose (26.4 mM), l-alanyl-l-glutamine (ala-gln, 12 μM), and l-ascorbic acid 2-phosphate sesquimagnesium salt hydrate (A2P, 0.08 μM), with pH adjusted to 6.75.”  410 compounds were screened.  “All of the repeated positive hits were polyamines (spermine, spermidine, and putrescine)”"]]
diff --git a/tags/cell_culture.mdwn b/tags/cell_culture.mdwn
index 53cadb57..b387b0ce 100644
--- a/tags/cell_culture.mdwn
+++ b/tags/cell_culture.mdwn
@@ -4,7 +4,7 @@ A few notes that just scratch the surface of a vast field…
 
  - [[Echalier and Ohanessian (1969)|biblio/4976834]] reported a culture of _Drosophila_ cells that spontaneously transformed.
  - [[Schneider's (1972)|biblio/4625067]] report of the establishment of the S2 cell line.
- - Polyamines are needed for the long-term passaging of some cell lines ([[Mitsuhashi 1998|biblio/9769143]]).
+ - Polyamines are needed for the long-term passaging of some cell lines ([[Mitsuhashi 1998|biblio/9769143]], [[Burnette and coll., 2014|biblio/25096480]]).
  - [[Marteijn and coll. (2003)|biblio/12474249]] optimised a culture medium using a genetic algorithm.  This methdod
    has been used at least once in invertebrates ([[Munroe and coll. (2019)|biblio/30747414]]).
  - [[Kawamura and coll. (2021)|biblio/33899125]] reported the use of plasmin to establish coral cell lines.

updated PO files
diff --git a/biblio.en.po b/biblio.en.po
index cd30a8bb..1d1f1ffb 100644
--- a/biblio.en.po
+++ b/biblio.en.po
@@ -23,7 +23,7 @@ msgstr ""
 
 #. type: Plain text
 #, no-wrap
-msgid "[[!img wordcloud.png size=\"50%\"]]\n"
+msgid "[[!img wordcloud.png]]\n"
 msgstr ""
 
 #. type: Plain text

Je laisse tomber.
diff --git a/biblio.mdwn b/biblio.mdwn
index f2246934..410cc2ef 100644
--- a/biblio.mdwn
+++ b/biblio.mdwn
@@ -1,7 +1,7 @@
 Bibliographie à la volée.
 =========================
 
-[[!img wordcloud.png size="50%"]]
+[[!img wordcloud.png]]
 
 [[!pagestats pages="tags/*" among="biblio/*"]]
 [[!inline

updated PO files
diff --git a/biblio.en.po b/biblio.en.po
index 623c7a23..cd30a8bb 100644
--- a/biblio.en.po
+++ b/biblio.en.po
@@ -1,7 +1,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2022-09-15 06:27+0000\n"
+"POT-Creation-Date: 2022-09-15 06:28+0000\n"
 "PO-Revision-Date: 2011-01-10 00:08+0900\n"
 "Last-Translator: Charles Plessy <https://launchpad.net/~plessy>\n"
 "Language-Team: Hopla\n"
@@ -23,7 +23,7 @@ msgstr ""
 
 #. type: Plain text
 #, no-wrap
-msgid "[[!img wordcloud.png hspace=\"50%\"]]\n"
+msgid "[[!img wordcloud.png size=\"50%\"]]\n"
 msgstr ""
 
 #. type: Plain text

Dernier essai.
diff --git a/biblio.mdwn b/biblio.mdwn
index 10267344..f2246934 100644
--- a/biblio.mdwn
+++ b/biblio.mdwn
@@ -1,7 +1,7 @@
 Bibliographie à la volée.
 =========================
 
-[[!img wordcloud.png hspace="50%"]]
+[[!img wordcloud.png size="50%"]]
 
 [[!pagestats pages="tags/*" among="biblio/*"]]
 [[!inline

updated PO files
diff --git a/biblio.en.po b/biblio.en.po
index 76afe944..623c7a23 100644
--- a/biblio.en.po
+++ b/biblio.en.po
@@ -1,7 +1,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2022-09-15 06:26+0000\n"
+"POT-Creation-Date: 2022-09-15 06:27+0000\n"
 "PO-Revision-Date: 2011-01-10 00:08+0900\n"
 "Last-Translator: Charles Plessy <https://launchpad.net/~plessy>\n"
 "Language-Team: Hopla\n"
@@ -23,7 +23,7 @@ msgstr ""
 
 #. type: Plain text
 #, no-wrap
-msgid "[[!img wordcloud.png hspace=\"100%\"]]\n"
+msgid "[[!img wordcloud.png hspace=\"50%\"]]\n"
 msgstr ""
 
 #. type: Plain text

Plus petite ?
diff --git a/biblio.mdwn b/biblio.mdwn
index a4e4d7cd..10267344 100644
--- a/biblio.mdwn
+++ b/biblio.mdwn
@@ -1,7 +1,7 @@
 Bibliographie à la volée.
 =========================
 
-[[!img wordcloud.png hspace="100%"]]
+[[!img wordcloud.png hspace="50%"]]
 
 [[!pagestats pages="tags/*" among="biblio/*"]]
 [[!inline

updated PO files
diff --git a/biblio.en.po b/biblio.en.po
index 41cf3baf..76afe944 100644
--- a/biblio.en.po
+++ b/biblio.en.po
@@ -1,7 +1,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2022-09-15 06:17+0000\n"
+"POT-Creation-Date: 2022-09-15 06:26+0000\n"
 "PO-Revision-Date: 2011-01-10 00:08+0900\n"
 "Last-Translator: Charles Plessy <https://launchpad.net/~plessy>\n"
 "Language-Team: Hopla\n"
@@ -23,7 +23,7 @@ msgstr ""
 
 #. type: Plain text
 #, no-wrap
-msgid "[[!img wordcloud.png]]\n"
+msgid "[[!img wordcloud.png hspace=\"100%\"]]\n"
 msgstr ""
 
 #. type: Plain text
@@ -37,7 +37,7 @@ msgstr "[[!pagestats  pages=\"tags/*\" among=\"biblio/*\"]]\n"
 #| "\tpages=\"biblio/* and !biblio/template and !biblio/tous\"\n"
 #| "\tfeeds=\"no\"]]\n"
 msgid ""
-"\tpages=\"biblio/ and !biblio/template and !biblio/tous\"\n"
+"\tpages=\"biblio/* and !biblio/template and !biblio/tous\"\n"
 "\tfeeds=\"no\"]]\n"
 msgstr ""
 "\tpages=\"biblio/* and !biblio/template and !biblio/tous\"\n"

Étoile manquante. Essai de changer la taille de l'image.
diff --git a/biblio.mdwn b/biblio.mdwn
index 30faef47..a4e4d7cd 100644
--- a/biblio.mdwn
+++ b/biblio.mdwn
@@ -1,11 +1,11 @@
 Bibliographie à la volée.
 =========================
 
-[[!img wordcloud.png]]
+[[!img wordcloud.png hspace="100%"]]
 
 [[!pagestats pages="tags/*" among="biblio/*"]]
 [[!inline
-	pages="biblio/ and !biblio/template and !biblio/tous"
+	pages="biblio/* and !biblio/template and !biblio/tous"
 	feeds="no"]]
 
 Voir [[tous les articles|biblio/tous]].

updated PO files
diff --git a/biblio.en.po b/biblio.en.po
index 3ffa4f02..41cf3baf 100644
--- a/biblio.en.po
+++ b/biblio.en.po
@@ -1,7 +1,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2022-09-15 06:13+0000\n"
+"POT-Creation-Date: 2022-09-15 06:17+0000\n"
 "PO-Revision-Date: 2011-01-10 00:08+0900\n"
 "Last-Translator: Charles Plessy <https://launchpad.net/~plessy>\n"
 "Language-Team: Hopla\n"
@@ -23,7 +23,7 @@ msgstr ""
 
 #. type: Plain text
 #, no-wrap
-msgid "[[!img biblio/wordcloud.png]]\n"
+msgid "[[!img wordcloud.png]]\n"
 msgstr ""
 
 #. type: Plain text
@@ -37,7 +37,7 @@ msgstr "[[!pagestats  pages=\"tags/*\" among=\"biblio/*\"]]\n"
 #| "\tpages=\"biblio/* and !biblio/template and !biblio/tous\"\n"
 #| "\tfeeds=\"no\"]]\n"
 msgid ""
-"\tpages=\"biblio/*.mdwn and !biblio/template and !biblio/tous\"\n"
+"\tpages=\"biblio/ and !biblio/template and !biblio/tous\"\n"
 "\tfeeds=\"no\"]]\n"
 msgstr ""
 "\tpages=\"biblio/* and !biblio/template and !biblio/tous\"\n"

On essaye encore de ne pas montrer de lien vers l'image.
diff --git a/biblio.mdwn b/biblio.mdwn
index e5683ec5..30faef47 100644
--- a/biblio.mdwn
+++ b/biblio.mdwn
@@ -1,11 +1,11 @@
 Bibliographie à la volée.
 =========================
 
-[[!img biblio/wordcloud.png]]
+[[!img wordcloud.png]]
 
 [[!pagestats pages="tags/*" among="biblio/*"]]
 [[!inline
-	pages="biblio/*.mdwn and !biblio/template and !biblio/tous"
+	pages="biblio/ and !biblio/template and !biblio/tous"
 	feeds="no"]]
 
 Voir [[tous les articles|biblio/tous]].
diff --git a/biblio/wordcloud.png b/wordcloud.png
similarity index 100%
rename from biblio/wordcloud.png
rename to wordcloud.png

updated PO files
diff --git a/biblio.en.po b/biblio.en.po
index 1c22933e..3ffa4f02 100644
--- a/biblio.en.po
+++ b/biblio.en.po
@@ -1,7 +1,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2022-09-15 06:11+0000\n"
+"POT-Creation-Date: 2022-09-15 06:13+0000\n"
 "PO-Revision-Date: 2011-01-10 00:08+0900\n"
 "Last-Translator: Charles Plessy <https://launchpad.net/~plessy>\n"
 "Language-Team: Hopla\n"
@@ -32,9 +32,12 @@ msgid "[[!pagestats pages=\"tags/*\" among=\"biblio/*\"]]\n"
 msgstr "[[!pagestats  pages=\"tags/*\" among=\"biblio/*\"]]\n"
 
 #. type: Plain text
-#, no-wrap
+#, fuzzy, no-wrap
+#| msgid ""
+#| "\tpages=\"biblio/* and !biblio/template and !biblio/tous\"\n"
+#| "\tfeeds=\"no\"]]\n"
 msgid ""
-"\tpages=\"biblio/* and !biblio/template and !biblio/tous\"\n"
+"\tpages=\"biblio/*.mdwn and !biblio/template and !biblio/tous\"\n"
 "\tfeeds=\"no\"]]\n"
 msgstr ""
 "\tpages=\"biblio/* and !biblio/template and !biblio/tous\"\n"

On ne liste pas les images.
diff --git a/biblio.mdwn b/biblio.mdwn
index c40006ac..e5683ec5 100644
--- a/biblio.mdwn
+++ b/biblio.mdwn
@@ -5,7 +5,7 @@ Bibliographie à la volée.
 
 [[!pagestats pages="tags/*" among="biblio/*"]]
 [[!inline
-	pages="biblio/* and !biblio/template and !biblio/tous"
+	pages="biblio/*.mdwn and !biblio/template and !biblio/tous"
 	feeds="no"]]
 
 Voir [[tous les articles|biblio/tous]].

updated PO files
diff --git a/biblio.en.po b/biblio.en.po
index fafc4fed..1c22933e 100644
--- a/biblio.en.po
+++ b/biblio.en.po
@@ -1,7 +1,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2011-01-13 23:56+0900\n"
+"POT-Creation-Date: 2022-09-15 06:11+0000\n"
 "PO-Revision-Date: 2011-01-10 00:08+0900\n"
 "Last-Translator: Charles Plessy <https://launchpad.net/~plessy>\n"
 "Language-Team: Hopla\n"
@@ -21,6 +21,11 @@ msgstr ""
 "Some bibliography\n"
 "=================\n"
 
+#. type: Plain text
+#, no-wrap
+msgid "[[!img biblio/wordcloud.png]]\n"
+msgstr ""
+
 #. type: Plain text
 #, no-wrap
 msgid "[[!pagestats pages=\"tags/*\" among=\"biblio/*\"]]\n"

Word cloud.
git grep -h '\[\[\!tag' | sed -e 's/\[\[\!tag//' -e 's/]]//' -e 's/_/ /'
https://www.jasondavies.com/wordcloud/
diff --git a/biblio.mdwn b/biblio.mdwn
index 47059eb7..c40006ac 100644
--- a/biblio.mdwn
+++ b/biblio.mdwn
@@ -1,6 +1,8 @@
 Bibliographie à la volée.
 =========================
 
+[[!img biblio/wordcloud.png]]
+
 [[!pagestats pages="tags/*" among="biblio/*"]]
 [[!inline
 	pages="biblio/* and !biblio/template and !biblio/tous"
diff --git a/biblio/wordcloud.png b/biblio/wordcloud.png
new file mode 100644
index 00000000..4f827303
Binary files /dev/null and b/biblio/wordcloud.png differ

Consolidate extraction and purification tags.
diff --git a/biblio/30669388.mdwn b/biblio/30669388.mdwn
index 74c3c509..7d0c9084 100644
--- a/biblio/30669388.mdwn
+++ b/biblio/30669388.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="A High-Quality De Novo Genome Assembly from a Single Mosquito using PacBio Sequencing"]]
-[[!tag genome assembly mosquito method extraction]]
+[!tag genome assembly mosquito method purification]]
 
 Sarah Kingan, Haynes Heaton, Juliana Cudini, Christine Lambert, Primo Baybayan, Brendan Galvin, Richard Durbin, Jonas Korlach, Mara Lawniczak
 
diff --git a/biblio/8969838.mdwn b/biblio/8969838.mdwn
index 742f59e4..12ef381e 100644
--- a/biblio/8969838.mdwn
+++ b/biblio/8969838.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="RT-PCR without RNA isolation."]]
-[[!tag RNA extraction RT-PCR DTT]]
+[[!tag RNA purification RT-PCR DTT]]
 
 Klebe RJ, Grant GM, Grant AM, Garcia MA, Giambernardi TA, Taylor GP.
 
diff --git a/tags/extraction.mdwn b/tags/extraction.mdwn
deleted file mode 100644
index 4ee4f87e..00000000
--- a/tags/extraction.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged extraction"]]
-
-[[!inline pages="tagged(extraction)" actions="no" archive="yes"
-feedshow=10]]

salting out
diff --git a/biblio/35312712.mdwn b/biblio/35312712.mdwn
new file mode 100644
index 00000000..9e8adb4e
--- /dev/null
+++ b/biblio/35312712.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Comparison of six methods for Loa loa genomic DNA extraction."]]
+[[!tag method purification]]
+
+Dieki R, Nsi Emvo E, Akue JP.
+
+PLoS One. 2022 Mar 21;17(3):e0265582. doi:10.1371/journal.pone.0265582
+
+Comparison of six methods for Loa loa genomic DNA extraction.
+
+[[!pmid 35312712 desc="Higher yield with the salting out method than with the phenol-chloroform method."]]

Polyamines.
diff --git a/tags/cell_culture.mdwn b/tags/cell_culture.mdwn
index 25a0c4c3..53cadb57 100644
--- a/tags/cell_culture.mdwn
+++ b/tags/cell_culture.mdwn
@@ -4,6 +4,7 @@ A few notes that just scratch the surface of a vast field…
 
  - [[Echalier and Ohanessian (1969)|biblio/4976834]] reported a culture of _Drosophila_ cells that spontaneously transformed.
  - [[Schneider's (1972)|biblio/4625067]] report of the establishment of the S2 cell line.
+ - Polyamines are needed for the long-term passaging of some cell lines ([[Mitsuhashi 1998|biblio/9769143]]).
  - [[Marteijn and coll. (2003)|biblio/12474249]] optimised a culture medium using a genetic algorithm.  This methdod
    has been used at least once in invertebrates ([[Munroe and coll. (2019)|biblio/30747414]]).
  - [[Kawamura and coll. (2021)|biblio/33899125]] reported the use of plasmin to establish coral cell lines.

Consolidate tags cell_culture and cell_line.
diff --git a/biblio/12474249.mdwn b/biblio/12474249.mdwn
index 0b1b128e..33f74698 100644
--- a/biblio/12474249.mdwn
+++ b/biblio/12474249.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Optimization of a feed medium for fed-batch culture of insect cells using a genetic algorithm"]]
-[[!tag method machine_learning cell_culture cell_line]]
+[[!tag method machine_learning cell_culture]]
 
 Marteijn RC, Jurrius O, Dhont J, de Gooijer CD, Tramper J, Martens DE.
 
diff --git a/biblio/33899125.mdwn b/biblio/33899125.mdwn
index d235c3c5..0382efef 100644
--- a/biblio/33899125.mdwn
+++ b/biblio/33899125.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Establishing Sustainable Cell Lines of a Coral, Acropora tenuis."]]
-[[!tag coral cell_culture cell_line]]
+[[!tag coral cell_culture]]
 
 Kawamura K, Nishitsuji K, Shoguchi E, Fujiwara S, Satoh N.
 
diff --git a/biblio/4625067.mdwn b/biblio/4625067.mdwn
index c2029723..dafa0a29 100644
--- a/biblio/4625067.mdwn
+++ b/biblio/4625067.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Cell lines derived from late embryonic stages of Drosophila melanogaster."]]
-[[!tag Drosophila cell_line]]
+[[!tag Drosophila cell_culture]]
 
 Schneider I.
 
diff --git a/biblio/4976834.mdwn b/biblio/4976834.mdwn
index 23c9d7ae..6bb579a6 100644
--- a/biblio/4976834.mdwn
+++ b/biblio/4976834.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Isolement, en culture in vivo, de lignées cellulaires diploïdes de Drosophila melanogaster."]]
-[[!tag Drosophila cell_line]]
+[[!tag Drosophila cell_culture]]
 
 Echalier G, Ohanessian A.
 
diff --git a/tags/cell_culture.mdwn b/tags/cell_culture.mdwn
index 99b886f2..25a0c4c3 100644
--- a/tags/cell_culture.mdwn
+++ b/tags/cell_culture.mdwn
@@ -1,4 +1,11 @@
 [[!meta title="pages tagged cell culture"]]
 
-[[!inline pages="tagged(cell_culture)" actions="no" archive="yes"
-feedshow=10]]
+A few notes that just scratch the surface of a vast field…
+
+ - [[Echalier and Ohanessian (1969)|biblio/4976834]] reported a culture of _Drosophila_ cells that spontaneously transformed.
+ - [[Schneider's (1972)|biblio/4625067]] report of the establishment of the S2 cell line.
+ - [[Marteijn and coll. (2003)|biblio/12474249]] optimised a culture medium using a genetic algorithm.  This methdod
+   has been used at least once in invertebrates ([[Munroe and coll. (2019)|biblio/30747414]]).
+ - [[Kawamura and coll. (2021)|biblio/33899125]] reported the use of plasmin to establish coral cell lines.
+
+[[!inline pages="tagged(cell_culture)" limit=0]]
diff --git a/tags/cell_line.mdwn b/tags/cell_line.mdwn
deleted file mode 100644
index 9a073fbd..00000000
--- a/tags/cell_line.mdwn
+++ /dev/null
@@ -1,11 +0,0 @@
-[[!meta title="pages tagged cell line"]]
-
-A few notes that just scratch the surface of a vast field…
-
- - [[Echalier and Ohanessian (1969)|biblio/4976834]] reported a culture of _Drosophila_ cells that spontaneously transformed.
- - [[Schneider's (1972)|biblio/4625067]] report of the establishment of the S2 cell line.
- - [[Marteijn and coll. (2003)|biblio/12474249]] optimised a culture medium using a genetic algorithm.  This methdod
-   has been used at least once in invertebrates ([[Munroe and coll. (2019)|biblio/30747414]]).
- - [[Kawamura and coll. (2021)|biblio/33899125]] reported the use of plasmin to establish coral cell lines.
-
-[[!inline pages="tagged(cell_line)" limit=0]]

Café
diff --git a/biblio/9769143.mdwn b/biblio/9769143.mdwn
new file mode 100644
index 00000000..4313d084
--- /dev/null
+++ b/biblio/9769143.mdwn
@@ -0,0 +1,12 @@
+[[!meta title="Polyamine as a growth promoter for cultured insect cells."]]
+[[!tag cell_culture]]
+
+Mitsuhashi J.
+
+In Vitro Cell Dev Biol Anim. 1998 Sep;34(8):619-21. doi:10.1007/s11626-996-0007-9
+
+Polyamine as a growth promoter for cultured insect cells.
+
+[[!pmid 9769143 desc="At least one of putrescine, spermidine and spermine at 2
+µg per 1000 ml need to be in the culture medium of NIH-SaPe-4 cells (from the
+fly _Boettcherisca peregrina_) could be passaged more than 10 times."]]

Après café
diff --git a/biblio/m088p297.mdwn b/biblio/m088p297.mdwn
new file mode 100644
index 00000000..859a8104
--- /dev/null
+++ b/biblio/m088p297.mdwn
@@ -0,0 +1,14 @@
+[[!meta title="Lipid and lipid class content of the pelagic tunicate Oikopleura vanhoeffeni"]]
+[[!tag ]]
+
+Deibel, D., Cavaletto, J. F., Riehl, M., Gardner, W. S.
+
+Lipid and lipid class content of the pelagic tunicate _Oikopleura vanhoeffeni_.
+
+MEPS 88:297-302, 1992
+
+Phospholipids represent the large majority of _O. vanhoeffeni_'s lipids.
+“Sterol esters, wax esters, methyl esters and diglycerides were never found”.
+
+https://www.int-res.com/abstracts/meps/v88/
+https://www.int-res.com/articles/meps/88/m088p297.pdf
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 4c9263eb..e50d170d 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -288,7 +288,7 @@ Genes and pathways
    inner kinetochore cound not be found in the genome by ([[Feng and coll.,
    2019|biblio/31306061]]).
  - _Nodal_ is not found in _O. dioica_'s genome ([[Onuma and coll., 2020|biblio/32029598]]).
- - Peroxysomes and genes related to them ([[Žárský and Tachezy, 2015|biblio/26700421]];
+ - Peroxisomes and genes related to them ([[Žárský and Tachezy, 2015|biblio/26700421]];
    [[Kienle, Kloepper and Fasshauer, 2016|biblio/27756227]]).
  - _Mesp_, _Ets1/2b_, _Gata4/5/6_, _Mek1/2_,  _Hand-r_ and _Tbx1/10_ (heart development,
    [[Ferrández-Roldán and coll., 2021|biblio/34789899]]).
@@ -500,6 +500,9 @@ Physiology
  - Oxygen consumption increases with temperature (15°C vs 22°C) and activity (anesthesised
    vs control animals).  It scales with body weigth, and not with food concentration after
    correcting for body weight ([[Lombard, Sciandra and Gorsky, 2005|biblio/10.3354_meps301149]]).
+ - In line with the absence of peroxisomes in _O. dioica_, no wax esters
+   (storage lipids) were found in _O vanhoeffenni_, which is mostly containing
+   phospholipids [[Deibel and coll.,1992|biblio/m088p297]].
 
 House
 -----

Typo
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index f01b0f49..4c9263eb 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -444,7 +444,7 @@ Development
    Postlethwait (2000)|biblio/10753519]]).
  - Notochord cell precursors express _Brachyury_ like in other chordates
    ([[Bassham and Postlethwait (2000)|biblio/10753519]]).
- - Adult notochord cells proliferate ([[Søviknes and Glover, 2008|biblio/18258772]).
+ - Adult notochord cells proliferate ([[Søviknes and Glover, 2008|biblio/18258772]]).
  - Expression of development genes is retarded by polyunsaturated aldehydes produced
    by diatoms ([[Torres-Águila and coll., 2018|biblio/30272001]]).
  - Epithelial cells divide by mitosis during embryogenesis.  Once the final number

Notochord cell proliferation in the adult.
diff --git a/biblio/18258772.mdwn b/biblio/18258772.mdwn
new file mode 100644
index 00000000..c9ebd136
--- /dev/null
+++ b/biblio/18258772.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Continued growth and cell proliferation into adulthood in the notochord of the appendicularian Oikopleura dioica."]]
+[[!tag Oikopleura H3S10p]]
+
+Søviknes AM, Glover JC.
+
+Biol Bull. 2008 Feb;214(1):17-28. doi:10.2307/25066656
+
+Continued growth and cell proliferation into adulthood in the notochord of the appendicularian _Oikopleura dioica_.
+
+[[!pmid 18258772 desc="Actin stained with phalloidin, DNA stained with To-Pro-3, and BrdU stained with antibodies.  Dual H2S10p and BrdU staining in the adult notochord suggest cell proliferation."]]
diff --git a/tags/H3S10p.mdwn b/tags/H3S10p.mdwn
index 267b4cbd..3a389252 100644
--- a/tags/H3S10p.mdwn
+++ b/tags/H3S10p.mdwn
@@ -6,4 +6,8 @@ Dmitrov (2003)|biblio/12917355]] for review.
 Figure 1j of [[Ganot P1, Kallesøe T, Thompson EM (2007)|biblio/17123503]] shows
 H3S10p staining of meiotic chromosomes in π-conformation in mature oocytes.
 
+The monoclonal antibody 9706S used in [[Søviknes and Glover
+(2008)|biblio/18258772]] stains the phosphorylated serine 10 on histone 3.
+Double-staining with BrdU in the notocord suggests adult cell proliferation.
+
 [[!inline pages="tagged(H3S10p)" limit=0]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 4b589086..f01b0f49 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -444,6 +444,7 @@ Development
    Postlethwait (2000)|biblio/10753519]]).
  - Notochord cell precursors express _Brachyury_ like in other chordates
    ([[Bassham and Postlethwait (2000)|biblio/10753519]]).
+ - Adult notochord cells proliferate ([[Søviknes and Glover, 2008|biblio/18258772]).
  - Expression of development genes is retarded by polyunsaturated aldehydes produced
    by diatoms ([[Torres-Águila and coll., 2018|biblio/30272001]]).
  - Epithelial cells divide by mitosis during embryogenesis.  Once the final number

Add tag.
diff --git a/biblio/32085510.mdwn b/biblio/32085510.mdwn
index 7fb36d0b..9ffdef98 100644
--- a/biblio/32085510.mdwn
+++ b/biblio/32085510.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Animal, Fungi, and Plant Genome Sequences Harbor Different Non-Canonical Splice Sites."]]
-[[!tag Oikopleura]]
+[[!tag Oikopleura splicing]]
 
 Frey K, Pucker B.
 

Re-typo.
diff --git a/biblio/27756227.mdwn b/biblio/27756227.mdwn
index e78f5b84..3de86e31 100644
--- a/biblio/27756227.mdwn
+++ b/biblio/27756227.mdwn
@@ -7,4 +7,4 @@ BMC Evol Biol. 2016 Oct 18;16(1):215.
 
 Shedding light on the expansion and diversification of the Cdc48 protein family during the rise of the eukaryotic cell.
 
-[[!pmid 27756227 desc="Also reports the loss of peroxysomal genes in _Oikopleura_."]]
+[[!pmid 27756227 desc="Also reports the loss of peroxisomal genes in _Oikopleura_."]]

Typo
diff --git a/biblio/27756227.mdwn b/biblio/27756227.mdwn
index 4a11fe91..e78f5b84 100644
--- a/biblio/27756227.mdwn
+++ b/biblio/27756227.mdwn
@@ -7,4 +7,4 @@ BMC Evol Biol. 2016 Oct 18;16(1):215.
 
 Shedding light on the expansion and diversification of the Cdc48 protein family during the rise of the eukaryotic cell.
 
-[[!pmid 27756227 desc="Also reports the loss of peroximal genes in _Oikopleura_."]]
+[[!pmid 27756227 desc="Also reports the loss of peroxysomal genes in _Oikopleura_."]]

Medium optimisation.
diff --git a/biblio/12474249.mdwn b/biblio/12474249.mdwn
index 33f74698..0b1b128e 100644
--- a/biblio/12474249.mdwn
+++ b/biblio/12474249.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Optimization of a feed medium for fed-batch culture of insect cells using a genetic algorithm"]]
-[[!tag method machine_learning cell_culture]]
+[[!tag method machine_learning cell_culture cell_line]]
 
 Marteijn RC, Jurrius O, Dhont J, de Gooijer CD, Tramper J, Martens DE.
 
diff --git a/biblio/30747414.mdwn b/biblio/30747414.mdwn
new file mode 100644
index 00000000..dbb43ef1
--- /dev/null
+++ b/biblio/30747414.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Genetic algorithm as an optimization tool for the development of sponge cell culture media"]]
+[[!tag cell_culture machine_learning]]
+
+In Vitro Cell Dev Biol Anim. 2019 Mar;55(3):149-158. doi:10.1007/s11626-018-00317-0
+
+Munroe S, Sandoval K, Martens DE, Sipkema D, Pomponi SA.
+
+Genetic algorithm as an optimization tool for the development of sponge cell culture media
+
+[[!pmid 30747414 desc="4 generations of 30 experiments each screening the concentrations of all amino acids."]]
diff --git a/tags/cell_line.mdwn b/tags/cell_line.mdwn
index b3df749e..9a073fbd 100644
--- a/tags/cell_line.mdwn
+++ b/tags/cell_line.mdwn
@@ -4,6 +4,8 @@ A few notes that just scratch the surface of a vast field…
 
  - [[Echalier and Ohanessian (1969)|biblio/4976834]] reported a culture of _Drosophila_ cells that spontaneously transformed.
  - [[Schneider's (1972)|biblio/4625067]] report of the establishment of the S2 cell line.
- - [[Kawamura and coll (2021)|biblio/33899125]] reported the use of plasmin to establish coral cell lines.
+ - [[Marteijn and coll. (2003)|biblio/12474249]] optimised a culture medium using a genetic algorithm.  This methdod
+   has been used at least once in invertebrates ([[Munroe and coll. (2019)|biblio/30747414]]).
+ - [[Kawamura and coll. (2021)|biblio/33899125]] reported the use of plasmin to establish coral cell lines.
 
 [[!inline pages="tagged(cell_line)" limit=0]]

Retire one more tag.
diff --git a/biblio/20868489.mdwn b/biblio/20868489.mdwn
index bfc37a0b..c5927f58 100644
--- a/biblio/20868489.mdwn
+++ b/biblio/20868489.mdwn
@@ -1,3 +1,3 @@
 [[!meta title="An arthropod cis-regulatory element functioning in sensory organ precursor development dates back to the Cambrian."]]
-[[!tag enhancer sequence-conservation Drosophila]]
+[[!tag enhancer Drosophila]]
 [[!pmid 20868489 desc="The atonal sensory organ precursor enhancer (SOPE)"]]
diff --git a/tags/sequence-conservation.mdwn b/tags/sequence-conservation.mdwn
deleted file mode 100644
index 715a5bdf..00000000
--- a/tags/sequence-conservation.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged sequence-conservation"]]
-
-[[!inline pages="tagged(sequence-conservation)" actions="no" archive="yes"
-feedshow=10]]

Retiring the polyamides tag.
diff --git a/biblio/29192133.mdwn b/biblio/29192133.mdwn
index 4bf72d69..72bda7ee 100644
--- a/biblio/29192133.mdwn
+++ b/biblio/29192133.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Synthetic transcription elongation factors license transcription across repressive chromatin."]]
-[[!tag drug elongation polyamides]]
+[[!tag drug elongation]]
 
 Erwin GS, Grieshop MP, Ali A, Qi J, Lawlor M, Kumar D, Ahmad I, McNally A,
 Teider N, Worringer K, Sivasankaran R, Syed DN, Eguchi A, Ashraf M, Jeffery J, Xu
diff --git a/tags/polyamides.mdwn b/tags/polyamides.mdwn
deleted file mode 100644
index 0c75a041..00000000
--- a/tags/polyamides.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged polyamides"]]
-
-[[!inline pages="tagged(polyamides)" actions="no" archive="yes"
-feedshow=10]]