Dernières modifications :

Café
diff --git a/biblio/10.2989_025776198784126476.mdwn b/biblio/10.2989_025776198784126476.mdwn
new file mode 100644
index 00000000..79451098
--- /dev/null
+++ b/biblio/10.2989_025776198784126476.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="The role of beak shape in octopodid taxonomy"]]
+[[!tag taxonomy]]
+
+R. S. Ogden , A. L. Allcock , P. C. Wats & J. P. Thorpe
+
+South African Journal of Marine Science, 1998, 20:1, 29-36, doi:10.2989/025776198784126476
+
+The role of beak shape in octopodid taxonomy
+
+[[!doi 10.2989/025776198784126476 desc="PCA and discriminant analysis on morphological measurments of beak shape in octopolids.  Geneera could be distinguished but not species."]]

In GR
diff --git a/biblio/10.1101_2020.03.14.992248v3.mdwn b/biblio/32801147.mdwn
similarity index 74%
rename from biblio/10.1101_2020.03.14.992248v3.mdwn
rename to biblio/32801147.mdwn
index 5dc046eb..32b67e78 100644
--- a/biblio/10.1101_2020.03.14.992248v3.mdwn
+++ b/biblio/32801147.mdwn
@@ -1,13 +1,13 @@
 [[!meta title="HiCanu: accurate assembly of segmental duplications, satellites, and allelic variants from high-fidelity long reads"]]
-[[!tag bioRxiv genome assembly chromosome]]
+[[!tag genome assembly chromosome]]
 
 Sergey Nurk, Brian P Walenz, Arang Rhie, Mitchell R Vollger, Glennis A Logsdon, Robert Grothe, Karen H Miga, Evan E Eichler, Adam M Phillippy, Sergey Koren
 
-bioRxiv 2020.03.14.992248; doi: https://doi.org/10.1101/2020.03.14.992248 
+Genome Res. 2020 Sep;30(9):1291-1305. doi:10.1101/gr.263566.120
 
 HiCanu: accurate assembly of segmental duplications, satellites, and allelic variants from high-fidelity long reads
 
-[[!doi 10.1101/2020.03.14.992248v3 desc="“HiCanu modifies the input reads by
+[[!pmid  32801147 desc="“HiCanu modifies the input reads by
 compressing every homopolymer to a single nucleotide.”  “Outputs contigs as
 “pseudo-haplotypes” that preserve local allelic phasing but may switch between
 haplotypes”"]]
diff --git a/tags/assembly.mdwn b/tags/assembly.mdwn
index 7c18baab..0ed2af28 100644
--- a/tags/assembly.mdwn
+++ b/tags/assembly.mdwn
@@ -23,6 +23,10 @@ fast. Shasta assemblies tend to be more fragmented, but have less disagreement
 with the reference.  Shasta also comes with polishing modules similar to Racon
 and Medaka, but also  to be faster. 
 
+The HiCanu assembler ([[Nurk, Walenz and coll., 2020|biblio/32801147]]) can
+take advantage of high-accuracy sequences such as the ones of the PacBio HiFi
+platform, to assemble multiple variants of the same locus.
+
 Some genome assemblers produce a graph file that can be visualised
 with tools such as Bandage [[Wick and coll., 2015|biblio/26099265]].
 

oburo
diff --git a/biblio/34255842.mdwn b/biblio/34255842.mdwn
new file mode 100644
index 00000000..d7daba71
--- /dev/null
+++ b/biblio/34255842.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="capCLIP: a new tool to probe translational control in human cells through capture and identification of the eIF4E-mRNA interactome."]]
+[[!tag cap method library]]
+
+Jensen KB, Dredge BK, Toubia J, Jin X, Iadevaia V, Goodall GJ, Proud CG.
+
+Nucleic Acids Res. 2021 Oct 11;49(18):e105. doi:10.1093/nar/gkab604
+
+capCLIP: a new tool to probe translational control in human cells through capture and identification of the eIF4E-mRNA interactome.
+
+[[!pmid 34255842 desc="eIF4E flagged via CRISPR/Cas9 gene editing.  mRNAs were crosslinked to eIF4E and immunoprecipitated with anti-flag antibodies.  First-strand cDNAs primed via a linker ligated in 3′.  This method (capCLIP) was used to study the effect of rapamycin treatment and eIF4E phosphorylation."]]
diff --git a/tags/cap.mdwn b/tags/cap.mdwn
index 552aa76d..175d7267 100644
--- a/tags/cap.mdwn
+++ b/tags/cap.mdwn
@@ -63,6 +63,11 @@ in the [[template_switching]] tag page.
    biotinylated forward primers, so that the 5′ end can be recovered after
    mechanical fragmentation.
 
+ - capCLIP ([[Jensen and coll., 2021|biblio/34255842]]): eIF4E is flagged by
+   gene editing, mRNA crosslinked to eIF4E and the whole is immunoprecipitated.
+   This circumvents the problem of access to good eIF4E antibodies for
+   immunoprecipitation.
+
 Atypical caps (work in progress)
 --------------------------------
 

Remove tag.
diff --git a/biblio/34385692.mdwn b/biblio/34385692.mdwn
index 7a7102b5..7b6fa118 100644
--- a/biblio/34385692.mdwn
+++ b/biblio/34385692.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Multiplexed direct detection of barcoded protein reporters on a nanopore array"]]
-[[!tag bioRxiv nanopore]]
+[[!tag nanopore]]
 
 Nat Biotechnol. 2021 Aug 12. doi:10.1038/s41587-021-01002-6.
 

TARA Oceans
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 5bbe5de5..d0ab666a 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -654,7 +654,8 @@ Ecology
    (with oral gland cells and ~8 to 14 subchordal cells).
  - Indian ocean near Australia: detected in eDNA sequencing of 18S rRNA
    ([[Berry and coll., 2019|biblio/30735490]])
- - TARA Oceans ([[Vorobev and coll., 2020|biblio/32205368]]).
+ - TARA Oceans ([[Vorobev and coll., 2020|biblio/32205368]]),
+   [[Delmont and coll., biblio/10.1101_2020.10.15.341214v2]].
 
 ### In the past:
 

Peer-reviewed.
diff --git a/biblio/10.1101_837542.mdwn b/biblio/34385692.mdwn
similarity index 55%
rename from biblio/10.1101_837542.mdwn
rename to biblio/34385692.mdwn
index df5c2c40..7a7102b5 100644
--- a/biblio/10.1101_837542.mdwn
+++ b/biblio/34385692.mdwn
@@ -1,10 +1,10 @@
 [[!meta title="Multiplexed direct detection of barcoded protein reporters on a nanopore array"]]
 [[!tag bioRxiv nanopore]]
 
-Posted November 11, 2019.
+Nat Biotechnol. 2021 Aug 12. doi:10.1038/s41587-021-01002-6.
 
-Nicolas Cardozo, Karen Zhang, Katie Doroschak, Aerilynn Nguyen, Zoheb Siddiqui, Karin Strauss, Luis Ceze and Jeff Nivala.
+Nicolas Cardozo, Karen Zhang, Katie Doroschak, Aerilynn Nguyen, Zoheb Siddiqui, Nicholas Bogard, Karin Strauss, Luis Ceze and Jeff Nivala.
 
 Multiplexed direct detection of barcoded protein reporters on a nanopore array
 
-[[!doi 10.1101/837542 desc="Detection of peptide barcodes in Nanopore flow cells."]]
+[[!pmid 34385692 desc="Detection of peptide barcodes in Nanopore flow cells."]]

Café
diff --git a/biblio/10.1101_2020.10.15.341214v2.mdwn b/biblio/10.1101_2020.10.15.341214v2.mdwn
new file mode 100644
index 00000000..a7e64dc1
--- /dev/null
+++ b/biblio/10.1101_2020.10.15.341214v2.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Functional repertoire convergence of distantly related eukaryotic plankton lineages revealed by genome-resolved metagenomics"]]
+[[!tag bioRxiv Oikopleura eDNA]]
+
+Tom O. Delmont, Morgan Gaia, Damien D. Hinsinger, Paul Fremont, Chiara Vanni, Antonio Fernandez Guerra, A. Murat Eren, Artem Kourlaiev, Leo d’Agata, Quentin Clayssen, Emilie Villar, Karine Labadie, Corinne Cruaud, Julie Poulain, Corinne Da Silva, Marc Wessner, Benjamin Noel, Jean-Marc Aury, Tara Oceans Coordinators, Colomban de Vargas, Chris Bowler, Eric Karsenti, Eric Pelletier, Patrick Wincker, Olivier Jaillon
+
+bioRxiv 2020.10.15.341214; doi: https://doi.org/10.1101/2020.10.15.341214 
+
+Functional repertoire convergence of distantly related eukaryotic plankton lineages revealed by genome-resolved metagenomics
+
+[[!doi 10.1101/2020.10.15.341214v2 desc="Assembled more than 700 eukaryotic metagenomes.  37 of them are Appendicularian.  A phylogeny was made using DNA-dependent RNA polymerases."]]

Café
diff --git a/biblio/31857067.mdwn b/biblio/31857067.mdwn
new file mode 100644
index 00000000..19b1826a
--- /dev/null
+++ b/biblio/31857067.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Protein phosphatase 2A is essential to maintain meiotic arrest, and to prevent Ca2+ burst at spawning and eventual parthenogenesis in the larvacean Oikopleura dioica."]]
+[[!tag ]]
+
+Protein phosphatase 2A is essential to maintain meiotic arrest, and to prevent Ca2+ burst at spawning and eventual parthenogenesis in the larvacean Oikopleura dioica.
+
+Dev Biol. 2020 Apr 15;460(2):155-163. doi:10.1016/j.ydbio.2019.12.005
+
+Matsuo M, Onuma TA, Omotezako T, Nishida H.
+
+[[!pmid 31857067 desc="“PP2A is essential for the maintenance of meiotic arrest and prevention of parthenogenesis at spawning event in O. dioica. When PP2Ac is lost, the pH rise at spawning brings about an aberrant Ca burst by still unknown molecular mechanisms, and it activates eggs via CaMK II, reinitiates meiosis, and eventually results in improper initiation of embryogenesis.” Okadaic acid also induced parthenogenesis.  Termination of parthenogenetic migth be explain by failure to complete the cleavages because of the absence of the centrosome that should have been brought by the sperm."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 8badd625..5bbe5de5 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -361,6 +361,9 @@ Development
    2008|biblio/18845138]]).
  - The first and second polar bodies are visible 5 and 15 min after fertilisation,
    respectively ([[Nishino and Morisawa, 1998|biblio/10.2108_zsj.15.723]]).
+ - Meiosis is resumed by change of extracellular pH when the oocytes are released
+   in seawater.  Partenogenesis starts if PP2A is inhibited by DNAi or with
+   okadaic acid ([[Matsuo and coll., 2020|biblio/31857067]).
  - First embryonic cleavages are deterministic and “Clonal organization of the
    tissues is essentially invariant among individuals” ([[Stach and coll.,
    2008|biblio/18490654]]).

Consolidate
diff --git a/biblio/24022005.mdwn b/biblio/24022005.mdwn
index f5776d7a..4a14020d 100644
--- a/biblio/24022005.mdwn
+++ b/biblio/24022005.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Barriers to transmission of transcriptional noise in a c-fos c-jun pathway."]]
-[[!tag single_cell noise immediate_early PLA]]
+[[!tag single_cell noise PLA]]
 
 Shah K, Tyagi S.
 
diff --git a/tags/immediate_early.mdwn b/tags/immediate_early.mdwn
deleted file mode 100644
index 43881d39..00000000
--- a/tags/immediate_early.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged immediate early"]]
-
-[[!inline pages="tagged(immediate_early)" actions="no" archive="yes"
-feedshow=10]]

Consolidation
diff --git a/biblio/25575391.mdwn b/biblio/25575391.mdwn
index 6edd1c2e..e48d0a5c 100644
--- a/biblio/25575391.mdwn
+++ b/biblio/25575391.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Tunic morphology and cellulosic components of pyrosomas, doliolids, and salps (thaliacea, urochordata)."]]
-[[!tag tunic cellulose]]
+[[!tag tunicate cellulose]]
 
 Hirose E, Kimura S, Itoh T, Nishikawa J.
 
diff --git a/tags/tunic.mdwn b/tags/tunic.mdwn
deleted file mode 100644
index 3c7ece5a..00000000
--- a/tags/tunic.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged tunic"]]
-
-[[!inline pages="tagged(tunic)" actions="no" archive="yes"
-feedshow=10]]

Café
diff --git a/biblio/34408075.mdwn b/biblio/34408075.mdwn
new file mode 100644
index 00000000..731289c6
--- /dev/null
+++ b/biblio/34408075.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Genomic structural variants constrain and facilitate adaptation in natural populations of Theobroma cacao, the chocolate tree."]]
+[[!tag haplotype variants]]
+
+Hämälä T, Wafula EK, Guiltinan MJ, Ralph PE, dePamphilis CW, Tiffin P.
+
+Proc Natl Acad Sci U S A. 2021 Aug 31;118(35):e2102914118. doi:10.1073/pnas.2102914118
+
+Genomic structural variants constrain and facilitate adaptation in natural populations of Theobroma cacao, the chocolate tree.
+
+[[!pmid 34408075 desc="31 × 2 haplotype assemblies using Illumina and 10x Genomics linked reads.  dN/dS (interspecies) and πN/πS (intraspecies) values in SVs are higher than expectation and vary according the type of SV and the proximity to the SV's breakpoints.  Genes with allele-specific expression were over-represented at heterozygous inversions.  Genetic load is higher at inversions, as expected if they suppress recombination."]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 6eb4f28c..a4ea2c03 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -8,6 +8,10 @@ SVs per individual (insertios: 13,353; deletions: 9,474) [[Beyter and coll, 2021
 SNP analysis in >1400 seaweed flies identified known and candidate genomic inversions
 ([[Mérot and coll, 2021|biblio/33963409]]).
 
+SV analysis of 31 diploid assemblies of _Theobroma cacao_ showed relaxed
+selection and increased genetic load in inversions and other types of variants
+[[Hämälä and coll., 2021|biblio/34408075]].
+
 ### Software
 
  - _NanoSV_ ([[Cretu Stancu and coll., 2017|biblio/29109544]]) uses nanopore long

Retiring variability tag, used only two times.
diff --git a/biblio/15289471.mdwn b/biblio/15289471.mdwn
index df2443d3..88c5491c 100644
--- a/biblio/15289471.mdwn
+++ b/biblio/15289471.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Regional patterns of gene expression in human and chimpanzee brains."]]
-[[!tag chimpanzee brain visual_cortex variability transcriptome]]
+[[!tag chimpanzee brain visual_cortex population transcriptome]]
 
 Khaitovich P, Muetzel B, She X, Lachmann M, Hellmann I, Dietzsch J, Steigele S, Do HH, Weiss G, Enard W, Heissig F, Arendt T, Nieselt-Struwe K, Eichler EE, Pääbo S.
 
@@ -7,4 +7,4 @@ Genome Res. 2004 Aug;14(8):1462-73 doi:10.1101/gr.2538704
 
 Regional patterns of gene expression in human and chimpanzee brains.
 
-[[!pmid 15289471 desc="Individual variations are stronger than regional variations in cortex. Developmental genes are implicated in inter-reigonal, but not inter-species variations. Differential interspecific variation correlates with recent chromosomal duplications."]]
+[[!pmid 15289471 desc="Individual variations are stronger than regional variations in cortex. Developmental genes are implicated in inter-regional, but not inter-species variations. Differential interspecific variation correlates with recent chromosomal duplications."]]
diff --git a/biblio/29483654.mdwn b/biblio/29483654.mdwn
index 81509e0c..a579bd25 100644
--- a/biblio/29483654.mdwn
+++ b/biblio/29483654.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="The human noncoding genome defined by genetic diversity."]]
-[[!tag non_coding variability]]
+[[!tag non_coding population]]
 
 Nat Genet. 2018 Mar;50(3):333-337. doi:10.1038/s41588-018-0062-7
 
diff --git a/tags/variability.mdwn b/tags/variability.mdwn
deleted file mode 100644
index c70635a0..00000000
--- a/tags/variability.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged variability"]]
-
-[[!inline pages="tagged(variability)" actions="no" archive="yes"
-feedshow=10]]

GOC
diff --git a/biblio/14585609.mdwn b/biblio/14585609.mdwn
new file mode 100644
index 00000000..c51736d2
--- /dev/null
+++ b/biblio/14585609.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="DNA repeats lead to the accelerated loss of gene order in bacteria."]]
+[[!tag synteny]]
+
+Rocha, Eduardo P C.
+
+Trends Genet. 2003 Nov;19(11):600-3. doi:10.1016/j.tig.2003.09.011
+
+DNA repeats lead to the accelerated loss of gene order in bacteria.
+
+[[!pmid 14585609 desc="Defines a Gene Order Conservation (GOC) number as: “the average number of orthologues for which the consecutive orthologue co-occurs close by in the other genome. It varies between 0 (no co-occurrence) and 1 (complete gene order conservation)”."]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 296a3a30..5ec7e063 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -50,4 +50,11 @@ two species [[Mudd and coll, 2020|biblio/32873878]].
 
  - The ancestral amniote has 49 chromosomes ([[Sacerdot and coll., 2018|biblio/30333059]]).
 
+### Computational aspects
+
+ - [[Rocha (2003)|biblio/14585609]] defines a Gene Order Conservation (GOC)
+   number as: “the average number of orthologues for which the consecutive
+   orthologue co-occurs close by in the other genome. It varies between 0 (no
+   co-occurrence) and 1 (complete gene order conservation)”.
+
 [[!inline pages="tagged(synteny)" limit=0]]

C-left
diff --git a/biblio/19592681.mdwn b/biblio/19592681.mdwn
new file mode 100644
index 00000000..d2bf1f59
--- /dev/null
+++ b/biblio/19592681.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Unusual composition of a yeast chromosome arm is associated with its delayed replication."]]
+[[!tag yeast chromosome]]
+
+Payen C, Fischer G, Marck C, Proux C, Sherman DJ, Coppée JY, Johnston M, Dujon B, Neuvéglise C.
+
+Genome Res. 2009 Oct;19(10):1710-21. doi:10.1101/gr.090605.108
+
+Unusual composition of a yeast chromosome arm is associated with its delayed replication.
+
+[[!pmid 19592681 desc="“high GC content (52.9%) of the 1-Mb left arm of chromosome C (abbreviated here as ‘C-left’)”  “The replication timing of C-left is delayed compared with the rest of the genome”  “The global gene density, transcriptional orientations, proportion of orthologs to S. cerevisiae essential genes, and proportion of genes in families are comparable between C-left and the rest of the genome. The only differences are modest: the complete absence of any traces of LTR retrotransposons, an overrepresentation of microsatellites, and a moderate increase in CDS length.”"]]

Quotes
diff --git a/biblio/28416820.mdwn b/biblio/28416820.mdwn
index 2d874f04..30f81ad3 100644
--- a/biblio/28416820.mdwn
+++ b/biblio/28416820.mdwn
@@ -8,3 +8,11 @@ Nat Genet. 2017 Jun;49(6):913-924. doi:10.1038/ng.3847
 Contrasting evolutionary genome dynamics between domesticated and wild yeasts.
 
 [[!pmid 28416820 desc="Yeast subtelomeres accumulate structural variants."]]
+
+“For each subtelomere, we located its proximal boundary on the basis of the sudden loss of synteny conservation and demarcated its distal boundary by the telomere-associated core X and Y′ elements”
+
+“All previously defined essential genes in S. cerevisiae S288C28 fell into the chromosomal cores, whereas all previously described subtelomeric duplication blocks in S288C were fully enclosed in our defined S288C subtelomeres. Furthermore, the genes from our defined subtelomeres showed 36.6-fold higher CNV accumulation than those from the cores”
+
+“subtelomeric one-to-one orthologs also showed significantly higher nonsynonymous-to-synonymous substitution rate ratio (dN/dS) than those from the cores in the S. cerevisiae–S. cerevisiae and S. cerevisiae–S. paradoxus comparisons”
+
+“rapid evolution of subtelomeres can substantially alter the gene repertoire and generate novel recombinants with adaptive potential”

Temperature
diff --git a/biblio/34301628.mdwn b/biblio/34301628.mdwn
new file mode 100644
index 00000000..4996a81b
--- /dev/null
+++ b/biblio/34301628.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Temperature dependence of spontaneous mutation rates."]]
+[[!tag temperature]]
+
+Waldvogel AM, Pfenninger M.
+
+Genome Res. 2021 Sep;31(9):1582-1589. doi:10.1101/gr.275168.120
+
+Temperature dependence of spontaneous mutation rates.
+
+[[!pmid 34301628 desc="Study on the non-biting midge _Chironomus riparius_ (harlequin fly). “short-term mutation accumulation experiments at temperatures between 12°C and 26°C.”  “mutation rates depended on temperature in a U-shaped manner with increasing rates toward both temperature extremes.”  Cold could increase mutation rates by eithery increasing oxydative stress or increasing generation time."]]

FBS
diff --git a/biblio/30775458.mdwn b/biblio/30775458.mdwn
new file mode 100644
index 00000000..88215b6c
--- /dev/null
+++ b/biblio/30775458.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Exosome-mediated horizontal gene transfer occurs in double-strand break repair during genome editing."]]
+[[!tag CRISPR repeat mutation]]
+
+Commun Biol. 2019 Feb 8;2:57. doi:10.1038/s42003-019-0300-2
+
+Ono R, Yasuhiko Y, Aisaki KI, Kitajima S, Kanno J, Hirabayashi Y.
+
+Exosome-mediated horizontal gene transfer occurs in double-strand break repair during genome editing.
+
+[[!pmid 30775458 desc="Insertion of bovine SINE elements in human cells whose genome was edited with CRISPR nucleases.  The bovine sequences are thought to originate from exosomes in the FBS."]]

Earl grey
diff --git a/biblio/10.1038_scientificamerican0776-94.mdwn b/biblio/10.1038_scientificamerican0776-94.mdwn
new file mode 100644
index 00000000..420b69d5
--- /dev/null
+++ b/biblio/10.1038_scientificamerican0776-94.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Appendicularians"]]
+[[!tag Oikopleura]]
+
+Alldredge, Alice
+
+Scientific American Vol. 235, No. 1 (July 1976), pp. 94-105 (12 pages)
+
+Appendicularians
+
+[[!doi 10.1038/scientificamerican0776-94 desc="JSTOR ID 24950396"]]
diff --git a/biblio/34414660.mdwn b/biblio/34414660.mdwn
new file mode 100644
index 00000000..9bb34a28
--- /dev/null
+++ b/biblio/34414660.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Arrhenius equation for developmental processes."]]
+[[!tag development temperature Drosophila frog]]
+
+Crapse J, Pappireddi N, Gupta M, Shvartsman SY, Wieschaus E, Wühr M.
+
+Mol Syst Biol. 2021 Aug;17(8):e9895. doi: 10.15252/msb.20209895
+
+Arrhenius equation for developmental processes.
+
+[[!pmid 34414660 desc="Fitting development time courses at different temperatures to the Arrhenius law shows that different steps have different activation energies.  The fit is not linear, and the fact that each step is a combination of many reactions is not enough to explain the extent of the deviation.  In addition, the fit of simple reactions catalysed by GAPDH or LacZ is also non-linear.  The authors postulate that “Either all rate-limiting steps occurring in parallel at a given embryonic stage have evolved similar activation energies, or the embryos have developed checkpoints that assure a resynchronization of converging developmental processes over wide temperature ranges.”"]]
diff --git a/tags/Drosophila.mdwn b/tags/Drosophila.mdwn
index 9445f484..ca999b86 100644
--- a/tags/Drosophila.mdwn
+++ b/tags/Drosophila.mdwn
@@ -23,4 +23,9 @@ one synteny break every 6 genes in average ([[Renschler and coll., 2019|biblio/3
 
 See also [[Muller elements|muller_element]].
 
+### Other papers
+
+_D. melanogaster_'s development time course at different temperatures was fitted
+to the Arrhenius law in [[Crapse and coll., 2021|biblio/34414660]].
+
 [[!inline pages="tagged(Drosophila)" limit=0]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 1684c65f..8badd625 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -13,7 +13,8 @@ for feeding (and perhaps defending).  The main house proteins are called
 _oikosins_ and half or them are unique to Oikopleura and related animals
 ("_Appendicularia_").  The japanese name of _O. dioica_ is
 [ワカレオタマボヤ](https://www.godac.jamstec.go.jp/bismal/j/view/9018229).
-Review for non-specialists: [[Glover, 2020|biblio/33080189]].
+Review for non-specialists: [[Glover, 2020|biblio/33080189]].  Article
+in Scientific American: [[Alice Alldredge, 1976|biblio/10.1038_scientificamerican0776-94]].
 
 Some links:
 

matin
diff --git a/biblio/34400545.mdwn b/biblio/34400545.mdwn
new file mode 100644
index 00000000..46552aab
--- /dev/null
+++ b/biblio/34400545.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Ultrarapid detection of SARS-CoV-2 RNA using a reverse transcription-free exponential amplification reaction, RTF-EXPAR."]]
+[[!tag amplification]]
+
+Carter JG, Orueta Iturbe L, Duprey JHA, Carter IR, Southern CD, Rana M, Whalley CM, Bosworth A, Beggs AD, Hicks MR, Tucker JHR, Dafforn TR.
+
+Proc Natl Acad Sci U S A. 2021 Aug 31;118(35):e2100347118. doi:10.1073/pnas.2100347118
+
+Ultrarapid detection of SARS-CoV-2 RNA using a reverse transcription-free exponential amplification reaction, RTF-EXPAR.
+
+[[!pmid 34400545 desc="“Binder DNA X anneals to viral RNA; the DNA strand of the DNA:RNA heteroduplex is cut by the restriction endonuclease BstNI, which acts as a nicking enzyme by cutting the DNA strand only; the released DNA strand is Trigger X, which is then amplified by EXPAR.”"]]

Café
diff --git a/biblio/34078885.mdwn b/biblio/34078885.mdwn
new file mode 100644
index 00000000..b52040a5
--- /dev/null
+++ b/biblio/34078885.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Discovery of widespread transcription initiation at microsatellites predictable by sequence-based deep neural network."]]
+[[!tag CAGE method fingerprint nanopore]]
+
+Discovery of widespread transcription initiation at microsatellites predictable by sequence-based deep neural network.
+
+Nat Commun. 2021 Jun 2;12(1):3297. doi:10.1038/s41467-021-23143-7
+
+Grapotte M, Saraswat M, Bessière C, Menichelli C, Ramilowski JA, Severin J, Hayashizaki Y, Itoh M, Tagami M, Murata M, Kojima-Ishiyama M, Noma S, Noguchi S, Kasukawa T, Hasegawa A, Suzuki H, Nishiyori-Sueki H, Frith MC; FANTOM consortium, Chatelain C, Carninci P, de Hoon MJL, Wasserman WW, Bréhélin L, Lecellier CH.
+
+[[!pmid 34078885 desc="Cap Trap RNA-seq (CTR) seq: sequencing of CAGE cDNAs on the Nanopore platform.  RT primers contain some Us and the DNA/RNA hybrids are digested with USER to shorten the tail.  A BBBBBBBB UMI is present."]]

Encore
diff --git a/tags/cellulose.mdwn b/tags/cellulose.mdwn
index 273e6c35..f29f5376 100644
--- a/tags/cellulose.mdwn
+++ b/tags/cellulose.mdwn
@@ -15,7 +15,8 @@ A cellulose synthase and several endoglycanase genes were observed in the _C.
 intestinalis_ genome by [[Dehal and coll., 2002|biblio/12481130]].
 
 _CesA_ is not found in other animals outside Tunicates.  The GH6 (cellulose hydrolase)
-gene is found as an independent copy an as a domain of _CesA_ in Tunicates
-([[Inoue, Nakashima and Satoh, 2019|biblio/30974905]]).
+gene is found as an independent copy and as a domain of _CesA_ in Tunicates
+([[Inoue, Nakashima and Satoh, 2019|biblio/30974905]]).  In _Oikopleura_,
+GHC6-1 lacks a conserved catalytic aspartate ([[Li and coll., 2020|biblio/32823766]]).
 
 [[!inline pages="tagged(cellulose)" limit=0]]

Le soir.
diff --git a/biblio/32823766.mdwn b/biblio/32823766.mdwn
new file mode 100644
index 00000000..e6eaf534
--- /dev/null
+++ b/biblio/32823766.mdwn
@@ -0,0 +1,14 @@
+[[!meta title="Phylogenetic Analyses of Glycosyl Hydrolase Family 6 Genes in Tunicates: Possible Horizontal Transfer."]]
+[[!tag cellulose Oikopleura]]
+
+Li KL, Nakashima K, Inoue J, Satoh N.
+
+Genes (Basel). 2020 Aug 13;11(8):937. doi:10.3390/genes11080937
+
+Phylogenetic Analyses of Glycosyl Hydrolase Family 6 Genes in Tunicates: Possible Horizontal Transfer.
+
+[[!pmid 32823766 desc="Comparison of primary sequence and of intron position suggests that GHC6-1 was transferred in a common ancestor of all living tunicates.  _O. dioica_'s GH6-1 gene lacks a conserved catalytic aspartate, and does not share introns with the other tunicate genes."]]
+
+“We found that in many tunicate GH6-1 proteins, an aspartic acid can be aligned to the catalytic _H. jecorina_ D221, except for SthGH6-1b (E197) and OdiGH6-1 (K211).  However, the catalytic aspartic acid was not conserved in tunicate CesA.”
+
+“In this study, although we found no other sites shared between genes of _O. dioica_ and other tunicates, we found that many shared splice sites are present among GH6-containing genes from three other major clades of tunicates (Thaliacea + Phlebobranchia + Stolidobranchia). It is reasonable to assume that many shared introns were acquired after the branching of larvaceans and before the subsequent divergence of major tunicate clades.”
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 9475b5a3..1684c65f 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -202,7 +202,9 @@ Genes and pathways
    intestinalis_ ([[Matthysse and coll., 2004|biblio/14722352]]).
  - A GH6 (glycosyl hydrolase family 6) domain is found in the CesA genes,
    as well as an independent genes, in Tunicates
-   ([[Inoue, Nakashima and Satoh, 2019|biblio/30974905]]).
+   ([[Inoue, Nakashima and Satoh, 2019|biblio/30974905]]).  In _Oikopleura_, it
+   lacks a conserved catalytic aspatate, and does not share ancestral introns with
+   other tunicates ([[Li and coll., 2020|biblio/32823766]]).
  - _O. dioica_ has multiple CDK1 and Cyclin B paraplogs, some of which are
    implicated in oogenesis ([[Øvrebø and coll., 2015|biblio/25714331]],
    [[Feng & Thompson, 2018|biblio/29969934]]).

Markdown syntax.
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 099fa178..9475b5a3 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -662,7 +662,7 @@ Culture protocols (incomplete list):
 
  - [[Fenaux and Gorsky (1985)|biblio/art0358]] published a method using a
    helicoidal paddle to stir the culture.
- - Rotating vessels: [[Sato and coll, 1999|biblio/10005415955].
+ - Rotating vessels: [[Sato and coll, 1999|biblio/10005415955]].
  - Tested once in Ctenophore tubes ([[Patry, Bubel, Hansen and Knowles,
    2020|biblio/32292660]]).
  - Nishida lab protocol: [[Nishida 2008|biblio/18494706]].

PDF link.
diff --git a/biblio/10005415955.mdwn b/biblio/10005415955.mdwn
index 0059e176..52dadbc2 100644
--- a/biblio/10005415955.mdwn
+++ b/biblio/10005415955.mdwn
@@ -8,3 +8,5 @@ Plankton Biology and Ecology 46(2), 162-164, 1999-08-01
 New apparatuses for cultivation of appendicularians
 
 [Culture of O. dioica and O. longicauda in rotating vessels.  O. lon required an “unidentified flagellate of 2µm cell diameter”.](https://ci.nii.ac.jp/naid/10005415955)
+
+PDF at: http://www.plankton.jp/PBE/issue/vol46_2/vol46_2_162.pdf

Café
diff --git a/biblio/34389685.mdwn b/biblio/34389685.mdwn
new file mode 100644
index 00000000..b77ee199
--- /dev/null
+++ b/biblio/34389685.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Caenorhabditis elegans DSB-3 reveals conservation and divergence among protein complexes promoting meiotic double-strand breaks."]]
+[[!tag meiosis nematode]]
+
+Hinman AW, Yeh HY, Roelens B, Yamaya K, Woglar A, Bourbon HG, Chi P, Villeneuve AM.
+
+Proc Natl Acad Sci U S A. 2021 Aug 17;118(33):e2109306118. doi:10.1073/pnas.2109306118
+
+_Caenorhabditis elegans+ DSB-3 reveals conservation and divergence among protein complexes promoting meiotic double-strand breaks.
+
+[[!pmid 34389685 desc="DSB-3, likely homologue of Mei4, interacts with DSB-1 and DSB-2 (likely homologues of Rec114).  Together, they are interdependent for localisation to meiotic nuclei and promoting formation of crossovers.  Yeast two-hybrid experiments that DSB-3 binds SPO-11 via DSB-1."]]

Café
diff --git a/tags/meiosis.mdwn b/tags/meiosis.mdwn
index 9bfc0b3f..c756bf68 100644
--- a/tags/meiosis.mdwn
+++ b/tags/meiosis.mdwn
@@ -6,4 +6,10 @@ _in progress_
    homologous recombination ([[Johnson and coll., 2021|biblio/34108687]]
    and [[Prieler and coll., 2021|biblio/34108684]]).
 
+ - In _C. elegans_, a yeast two-hybrid experiment suggests that SPO-11 binds
+   the DSB-1,2,3 complex via DSB-1.  The complex is necessary to form
+   cross-overs.  Failure to cross over causes aneuploidy, which is causes
+   embryonic inviability and excess of males ([[Hinmann and coll.,
+   2021|biblio/34389685]]).
+
 [[!inline pages="tagged(meiosis)" limit=0]]

Cafés
diff --git a/biblio/34045355.mdwn b/biblio/34045355.mdwn
new file mode 100644
index 00000000..33785ea9
--- /dev/null
+++ b/biblio/34045355.mdwn
@@ -0,0 +1,18 @@
+[[!meta title="3D genomics across the tree of life reveals condensin II as a determinant of architecture type."]]
+[[!tag centromere]]
+
+Hoencamp C, Dudchenko O, Elbatsh AMO, Brahmachari S, Raaijmakers JA, van Schaik T, Sedeño Cacciatore Á, Contessoto VG, van Heesbeen RGHP, van den Broek B, Mhaskar AN, Teunissen H, St Hilaire BG, Weisz D, Omer AD, Pham M, Colaric Z, Yang Z, Rao SSP, Mitra N, Lui C, Yao W, Khan R, Moroz LL, Kohn A, St Leger J, Mena A, Holcroft K, Gambetta MC, Lim F, Farley E, Stein N, Haddad A, Chauss D, Mutlu AS, Wang MC, Young ND, Hildebrandt E, Cheng HH, Knight CJ, Burnham TLU, Hovel KA, Beel AJ, Mattei PJ, Kornberg RD, Warren WC, Cary G, Gómez-Skarmeta JL, Hinman V, Lindblad-Toh K, Di Palma F, Maeshima K, Multani AS, Pathak S, Nel-Themaat L, Behringer RR, Kaur P, Medema RH, van Steensel B, de Wit E, Onuchic JN, Di Pierro M, Lieberman Aiden E, Rowland BD.
+
+Science. 2021 May 28;372(6545):984-989. doi:10.1126/science.abe2218
+
+3D genomics across the tree of life reveals condensin II as a determinant of architecture type.
+
+[[!pmid 34045355 desc="Hi-C profiles tend to show centromeric clustering in cells that lack condensin II or have very long chromosomes, because they are in “Rabl” conformation."]]
+
+“In ∆CAP-H2 human cells, centromeres also cluster in or around the nucleolus. However, disrupting nucleolar structure did not affect centromeric clustering. The clustering of centromeres at the human nucleolus is likely because rDNA sequences, which are the genomic component of the nucleolus, often lie near centromeres”
+
+“acute depletion of the condensin I subunit CAP-H did not lead to centromeric clustering”
+
+“we found that the notable increase in chromosome length in the Indian muntjac coincides, as expected, with the appearance of centromeric clustering.”
+
+“We hypothesize that (i) centromeres tend to adhere to one another, a process that is facilitated by proximity during and shortly after mitosis; (ii) the shortening of chromosomes interferes with this adhesion, enabling the centromeres to spread out over the newly formed nuclei; and (iii) chromosome territories emerge as a by-product of the resulting chromosomal separation.”
diff --git a/tags/centromere.mdwn b/tags/centromere.mdwn
index d3c212c0..b1444e75 100644
--- a/tags/centromere.mdwn
+++ b/tags/centromere.mdwn
@@ -15,6 +15,8 @@ _Work in progress_
    coll., 2019|biblio/31306061]].
  - Centromeric regions of sister chromatids are rarely resolved in FISH.  Instead,
    the intensity of the spot increases ([[Amakawa and coll., 2013|biblio/23832878]]).
+ - In Hi-C profiles, centromeric clustering is seen in cells that lack condensin II
+   or have extremely long chromosomes ([[Hoencamp and coll., 2021|biblio/34045355]]).
 
 ## Evolution
 
diff --git a/tags/muller_element.mdwn b/tags/muller_element.mdwn
index 2aec4611..6ee4d973 100644
--- a/tags/muller_element.mdwn
+++ b/tags/muller_element.mdwn
@@ -13,6 +13,10 @@ and coll., 2017|biblio/28336562]]; [[Copmton and coll., 2020|biblio/32883756]]).
 Note that the chromosomes of _Aedes aegypti_
 are significantly larger than what is usually found in _Drosophila_.
 
+In [[Hoencamp and coll., 2021|biblio/34045355]], centromeric clustering in Hi-C
+contact maps is also shown; it is hypothtised that it is because of the lack
+of a fully functional condensin II complex.
+
 _D. bifasciata_ (and other Drosophila) have large and highly repetitive
 pericentric regions [[Bracewell and coll., 2020|biblio/31969429]].
 

Interpretation
diff --git a/biblio/22106305.mdwn b/biblio/22106305.mdwn
index 2b266f6a..0e59f5ee 100644
--- a/biblio/22106305.mdwn
+++ b/biblio/22106305.mdwn
@@ -7,4 +7,4 @@ Dmitrieva NI, Cui K, Kitchaev DA, Zhao K, Burg MB.
 
 Proc Natl Acad Sci U S A. 2011 Dec 20;108(51):20796-801. doi:10.1073/pnas.1114677108
 
-[[!pmid 22106305 desc="At high osmolarity, double-strand breaks (DSBs) form in cells.  Repair is much more active once osmolarity has been lowered, as viewed by the increase of γH2AX foci.  ChIP sequencing of these foci show a strong enrichment in gene deserts."]]
+[[!pmid 22106305 desc="At high osmolarity, double-strand breaks (DSBs) form in cells.  Repair is much more active once osmolarity has been lowered, as viewed by the increase of γH2AX foci.  ChIP sequencing of these foci show a strong enrichment in gene deserts.  The authors suggest that gene deserts could be a vertebrate adaptation to the high-salt environment of their kidney cells."]]

creating tag page tags/γH2AX
diff --git "a/tags/\316\263H2AX.mdwn" "b/tags/\316\263H2AX.mdwn"
new file mode 100644
index 00000000..78e77919
--- /dev/null
+++ "b/tags/\316\263H2AX.mdwn"
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged γH2AX"]]
+
+[[!inline pages="tagged(γH2AX)" actions="no" archive="yes"
+feedshow=10]]

creating tag page tags/H2AX
diff --git a/tags/H2AX.mdwn b/tags/H2AX.mdwn
new file mode 100644
index 00000000..03083502
--- /dev/null
+++ b/tags/H2AX.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged H2AX"]]
+
+[[!inline pages="tagged(H2AX)" actions="no" archive="yes"
+feedshow=10]]

Au bureau
diff --git a/biblio/21756361.mdwn b/biblio/21756361.mdwn
index 005b2ba3..c22dc346 100644
--- a/biblio/21756361.mdwn
+++ b/biblio/21756361.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Histone variant innovation in a rapidly evolving chordate lineage."]]
-[[!tag Oikopleura histone]]
+[[!tag Oikopleura histone H2AX]]
 
 Histone variant innovation in a rapidly evolving chordate lineage.
 
diff --git a/biblio/22106305.mdwn b/biblio/22106305.mdwn
new file mode 100644
index 00000000..2b266f6a
--- /dev/null
+++ b/biblio/22106305.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="DNA double-strand breaks induced by high NaCl occur predominantly in gene deserts."]]
+[[!tag repair γH2AX H2AX]]
+
+DNA double-strand breaks induced by high NaCl occur predominantly in gene deserts.
+
+Dmitrieva NI, Cui K, Kitchaev DA, Zhao K, Burg MB.
+
+Proc Natl Acad Sci U S A. 2011 Dec 20;108(51):20796-801. doi:10.1073/pnas.1114677108
+
+[[!pmid 22106305 desc="At high osmolarity, double-strand breaks (DSBs) form in cells.  Repair is much more active once osmolarity has been lowered, as viewed by the increase of γH2AX foci.  ChIP sequencing of these foci show a strong enrichment in gene deserts."]]

Café le matin.
diff --git a/biblio/16775417.mdwn b/biblio/16775417.mdwn
new file mode 100644
index 00000000..c9fa3077
--- /dev/null
+++ b/biblio/16775417.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="The saltiness of the sea breaks DNA in marine invertebrates: possible implications for animal evolution."]]
+[[!tag evolution repair]]
+
+Dmitrieva NI, Ferraris JD, Norenburg JL, Burg MB.
+
+Cell Cycle. 2006 Jun;5(12):1320-3. doi:10.4161/cc.5.12.2867
+
+The saltiness of the sea breaks DNA in marine invertebrates: possible implications for animal evolution.
+
+[[!pmid 16775417 desc="Proposes that increased salinity in evaporating seas during the Cambrian caused elevated numbers of DNA breaks and accelerated evolution, leading to the Cambrian explosion.  Vertebrates maintain constant interstitial osmolarity at ~300 mosmol/kg.  Invertebrates show increased levels of DNA breaks (measured by TUNEL assay) at 1000 mosmol/kg compared to 300 mosmol/kg."]]

Encore plus de café
diff --git a/biblio/31601616.mdwn b/biblio/31601616.mdwn
index a96cc4fe..1afde776 100644
--- a/biblio/31601616.mdwn
+++ b/biblio/31601616.mdwn
@@ -8,3 +8,17 @@ Genes Dev. 2019 Oct 10. doi: 10.1101/gad.328971.119
 Hi-C guided assemblies reveal conserved regulatory topologies on X and autosomes despite extensive genome shuffling.
 
 [[!pmid 31601616 desc="Found 20 synteny breakpoints (SB) per Mb on average. “Approximately 75% of SBs stay within the A or B compartment”  “Overlaps of TAD boundaries and SB breakpoints in all comparisons are highly significant”"]]
+
+“Hi-C data of D. melanogaster, D. virilis, and D. busckii embryos”
+
+“D. virilis and D. busckii [...] cover ∼40 million years of evolution and multiple subgenera (Russo et al. 2013).”
+
+“conserved sequences mostly reside on the same chromosomal arms”
+
+“we defined synteny blocks (SBs), which are chains of conserved collinear regions that are used to identify and compare homologous regions between different species. On average, we find 20 synteny breakpoints per megabase (3726 and 3252 breakpoints in the D. melanogaster vs. D. virilis comparison, respectively, and 3340 and 2776 breakpoints in the D. melanogaster vs. D. busckii comparison, respectively), corresponding to about one breakpoint every six genes.”
+
+“Approximately 75% of SBs stay within the A or B compartment and 25% switch between compartments. In general, about double the number of SBs lie within the A compartment than the B compartment.”
+
+“many SB breakpoints overlap with TAD boundaries”
+
+“To identify synteny blocks (SBs) we use LASTZ (Harris 2007) with the following parameters: “–gfextend –nochain –gapped,” which identifies local alignment blocks. We then chained blocks that are within 10-kb distance, have the same orientation, and contain at least four LASTZ-defined blocks. Chained results that were <4 kb or completely overlapped a bigger synteny block were removed.”
diff --git a/tags/Drosophila.mdwn b/tags/Drosophila.mdwn
index b48f6760..9445f484 100644
--- a/tags/Drosophila.mdwn
+++ b/tags/Drosophila.mdwn
@@ -18,6 +18,9 @@ year ([[Schlötterer and coll., 1994|biblio/8015444]]).
 12 Drosophila genomes were sequenced and compared by the [[Drosophila 12
 Genomes Consortium (2007)|biblio/17994087]].
 
+Hi-C scaffolding and genome comparison between _D. virilis_ and _D. buskii_ shows
+one synteny break every 6 genes in average ([[Renschler and coll., 2019|biblio/31601616]]).
+
 See also [[Muller elements|muller_element]].
 
 [[!inline pages="tagged(Drosophila)" limit=0]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 7877f2c5..296a3a30 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -14,7 +14,8 @@ distribution follows a power law and explain it with a model that requires
 breakpoints to be in open regions (ENCODE) interacting with each other (Hi-C).
 
 [[Renschler and coll. (2019)|biblio/31601616]] found 20 synteny breakpoints
-(SB) per Mb on average. “Approximately 75% of SBs stay within the A or B
+(SB) per Mb on average (1 every 6 gene) when comparing _D. virilis_ and _D. buskii_,
+which are ~40 MY apart.  “Approximately 75% of SBs stay within the A or B
 compartment”  “Overlaps of TAD boundaries and SB breakpoints in all comparisons
 are highly significant”
 

poedit
diff --git "a/Debian/debi\303\242neries/codesearch.en.po" "b/Debian/debi\303\242neries/codesearch.en.po"
index 990bd4ab..b8654e40 100644
--- "a/Debian/debi\303\242neries/codesearch.en.po"
+++ "b/Debian/debi\303\242neries/codesearch.en.po"
@@ -7,7 +7,7 @@ msgid ""
 msgstr ""
 "Project-Id-Version: \n"
 "POT-Creation-Date: 2021-07-22 08:43+0000\n"
-"PO-Revision-Date: 2021-07-22 17:43+0900\n"
+"PO-Revision-Date: 2021-07-22 17:46+0900\n"
 "Last-Translator: Charles Plessy <toto@example.com>\n"
 "Language-Team: \n"
 "Language: en\n"

Merge branch 'master' of ssh://charles-plessy-org.branchable.com
https
diff --git "a/Debian/debi\303\242neries/codesearch.en.po" "b/Debian/debi\303\242neries/codesearch.en.po"
index a9a55728..9153742d 100644
--- "a/Debian/debi\303\242neries/codesearch.en.po"
+++ "b/Debian/debi\303\242neries/codesearch.en.po"
@@ -7,7 +7,7 @@ msgid ""
 msgstr ""
 "Project-Id-Version: \n"
 "POT-Creation-Date: 2021-07-22 08:44+0000\n"
-"PO-Revision-Date: 2021-07-22 17:43+0900\n"
+"PO-Revision-Date: 2021-07-22 17:45+0900\n"
 "Last-Translator: Charles Plessy <toto@example.com>\n"
 "Language-Team: \n"
 "Language: en\n"
@@ -37,16 +37,6 @@ msgid "[[!meta title=\"Recherche dans les sources de Debian\"]]\n"
 msgstr "[[!meta title=\"Search in Debian's sources\"]]\n"
 
 #. type: Plain text
-#, fuzzy
-#| msgid ""
-#| "Via mon travail sur le paquet [`media-types`](packages.debian.org/media-"
-#| "types)\n"
-#| "je voulais savoir quel paquets utilisaient le type média `application/x-"
-#| "xcf`\n"
-#| "qui apparemment est erroné ([#991158](https://bugs.debian.org/991158)).  "
-#| "Le\n"
-#| "site <codesearch.debian.net> permet de répondre à cette question.  "
-#| "(Merci !)\n"
 msgid ""
 "Via mon travail sur le paquet [`media-types`](packages.debian.org/media-"
 "types)  je voulais savoir quel paquets utilisaient le type média "
@@ -60,7 +50,7 @@ msgstr ""
 "xcf`,\n"
 "which apparently is not correct ([#991158](https://bugs.debian."
 "org/991158)).\n"
-"The <codesearch.debian.net> site gives the answer.  (Thanks!)\n"
+"The <https://codesearch.debian.net> site gives the answer.  (Thanks!)"
 
 #. type: Plain text
 msgid ""

updated PO files
diff --git "a/Debian/debi\303\242neries/codesearch.en.po" "b/Debian/debi\303\242neries/codesearch.en.po"
index 923df5f1..a9a55728 100644
--- "a/Debian/debi\303\242neries/codesearch.en.po"
+++ "b/Debian/debi\303\242neries/codesearch.en.po"
@@ -6,14 +6,14 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: \n"
-"POT-Creation-Date: 2021-07-22 08:37+0000\n"
+"POT-Creation-Date: 2021-07-22 08:44+0000\n"
 "PO-Revision-Date: 2021-07-22 17:43+0900\n"
+"Last-Translator: Charles Plessy <toto@example.com>\n"
+"Language-Team: \n"
 "Language: en\n"
 "MIME-Version: 1.0\n"
 "Content-Type: text/plain; charset=UTF-8\n"
 "Content-Transfer-Encoding: 8bit\n"
-"Last-Translator: Charles Plessy <toto@example.com>\n"
-"Language-Team: \n"
 "X-Generator: Poedit 2.2.1\n"
 
 #. type: Plain text
@@ -37,27 +37,42 @@ msgid "[[!meta title=\"Recherche dans les sources de Debian\"]]\n"
 msgstr "[[!meta title=\"Search in Debian's sources\"]]\n"
 
 #. type: Plain text
-#, no-wrap
+#, fuzzy
+#| msgid ""
+#| "Via mon travail sur le paquet [`media-types`](packages.debian.org/media-"
+#| "types)\n"
+#| "je voulais savoir quel paquets utilisaient le type média `application/x-"
+#| "xcf`\n"
+#| "qui apparemment est erroné ([#991158](https://bugs.debian.org/991158)).  "
+#| "Le\n"
+#| "site <codesearch.debian.net> permet de répondre à cette question.  "
+#| "(Merci !)\n"
 msgid ""
-"Via mon travail sur le paquet [`media-types`](packages.debian.org/media-types)\n"
-"je voulais savoir quel paquets utilisaient le type média `application/x-xcf`\n"
-"qui apparemment est erroné ([#991158](https://bugs.debian.org/991158)).  Le\n"
-"site <codesearch.debian.net> permet de répondre à cette question.  (Merci !)\n"
+"Via mon travail sur le paquet [`media-types`](packages.debian.org/media-"
+"types)  je voulais savoir quel paquets utilisaient le type média "
+"`application/x-xcf` qui apparemment est erroné ([#991158](https://bugs."
+"debian.org/991158)).  Le site <https://codesearch.debian.net> permet de "
+"répondre à cette question.  (Merci !)"
 msgstr ""
-"Via my work on the [`media-types`](packages.debian.org/media-types) package, \n"
-"I wanted to know which packages were using the media type `application/x-xcf`,\n"
-"which apparently is not correct ([#991158](https://bugs.debian.org/991158)).\n"
+"Via my work on the [`media-types`](packages.debian.org/media-types) "
+"package, \n"
+"I wanted to know which packages were using the media type `application/x-"
+"xcf`,\n"
+"which apparently is not correct ([#991158](https://bugs.debian."
+"org/991158)).\n"
 "The <codesearch.debian.net> site gives the answer.  (Thanks!)\n"
 
 #. type: Plain text
 msgid ""
-"De plus, [en créant une clé d'utilisateur](https://codesearch.debian.net/apikeys/), on peut "
-"interroger le site en ligne de commande; voici un exemple ci-dessous (le fichier `dcs-apikeyHeader-"
-"plessy.txt` contient `x-dcs-apikey: ` suivi de ma clé d'accès)"
+"De plus, [en créant une clé d'utilisateur](https://codesearch.debian.net/"
+"apikeys/), on peut interroger le site en ligne de commande; voici un exemple "
+"ci-dessous (le fichier `dcs-apikeyHeader-plessy.txt` contient `x-dcs-apikey: "
+"` suivi de ma clé d'accès)"
 msgstr ""
-"Moreover, one can [create a user key](https://codesearch.debian.net/apikeys/), for command-line "
-"remote access; here is an example below (the file `dcs-apikeyHeader-plessy.txt` contains `x-dcs-"
-"apikey: ` followed by my access key)."
+"Moreover, one can [create a user key](https://codesearch.debian.net/"
+"apikeys/), for command-line remote access; here is an example below (the "
+"file `dcs-apikeyHeader-plessy.txt` contains `x-dcs-apikey: ` followed by my "
+"access key)."
 
 #. type: Plain text
 #, no-wrap
@@ -66,11 +81,12 @@ msgstr "    curl -X GET \"https://codesearch.debian.net/api/v1/searchperpackage?
 
 #. type: Plain text
 msgid ""
-"Le résultat est en JSON.  Voici comment de l'ai transformé pour faire une liste d'adresses courriel "
-"à contacter que j'ai pu facilement coller dans `mutt`."
+"Le résultat est en JSON.  Voici comment de l'ai transformé pour faire une "
+"liste d'adresses courriel à contacter que j'ai pu facilement coller dans "
+"`mutt`."
 msgstr ""
-"The result is serialised in JSON.  Here is how I transformed it to make a list of email addresses "
-"that I could easily paste in `mutt`."
+"The result is serialised in JSON.  Here is how I transformed it to make a "
+"list of email addresses that I could easily paste in `mutt`."
 
 #. type: Plain text
 #, no-wrap

https
diff --git "a/Debian/debi\303\242neries/codesearch.mdwn" "b/Debian/debi\303\242neries/codesearch.mdwn"
index 56b47562..9f7084fe 100644
--- "a/Debian/debi\303\242neries/codesearch.mdwn"
+++ "b/Debian/debi\303\242neries/codesearch.mdwn"
@@ -7,7 +7,7 @@
 Via mon travail sur le paquet [`media-types`](packages.debian.org/media-types)
 je voulais savoir quel paquets utilisaient le type média `application/x-xcf`
 qui apparemment est erroné ([#991158](https://bugs.debian.org/991158)).  Le
-site <codesearch.debian.net> permet de répondre à cette question.  (Merci !)
+site <https://codesearch.debian.net> permet de répondre à cette question.  (Merci !)
 
 De plus, [en créant une clé d'utilisateur](https://codesearch.debian.net/apikeys/),
 on peut interroger le site en ligne de commande; voici un exemple ci-dessous

updated PO files
diff --git "a/Debian/debi\303\242neries/codesearch.en.po" "b/Debian/debi\303\242neries/codesearch.en.po"
index 923df5f1..51ae2ecf 100644
--- "a/Debian/debi\303\242neries/codesearch.en.po"
+++ "b/Debian/debi\303\242neries/codesearch.en.po"
@@ -6,14 +6,14 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: \n"
-"POT-Creation-Date: 2021-07-22 08:37+0000\n"
+"POT-Creation-Date: 2021-07-22 08:43+0000\n"
 "PO-Revision-Date: 2021-07-22 17:43+0900\n"
+"Last-Translator: Charles Plessy <toto@example.com>\n"
+"Language-Team: \n"
 "Language: en\n"
 "MIME-Version: 1.0\n"
 "Content-Type: text/plain; charset=UTF-8\n"
 "Content-Transfer-Encoding: 8bit\n"
-"Last-Translator: Charles Plessy <toto@example.com>\n"
-"Language-Team: \n"
 "X-Generator: Poedit 2.2.1\n"
 
 #. type: Plain text
@@ -51,13 +51,15 @@ msgstr ""
 
 #. type: Plain text
 msgid ""
-"De plus, [en créant une clé d'utilisateur](https://codesearch.debian.net/apikeys/), on peut "
-"interroger le site en ligne de commande; voici un exemple ci-dessous (le fichier `dcs-apikeyHeader-"
-"plessy.txt` contient `x-dcs-apikey: ` suivi de ma clé d'accès)"
+"De plus, [en créant une clé d'utilisateur](https://codesearch.debian.net/"
+"apikeys/), on peut interroger le site en ligne de commande; voici un exemple "
+"ci-dessous (le fichier `dcs-apikeyHeader-plessy.txt` contient `x-dcs-apikey: "
+"` suivi de ma clé d'accès)"
 msgstr ""
-"Moreover, one can [create a user key](https://codesearch.debian.net/apikeys/), for command-line "
-"remote access; here is an example below (the file `dcs-apikeyHeader-plessy.txt` contains `x-dcs-"
-"apikey: ` followed by my access key)."
+"Moreover, one can [create a user key](https://codesearch.debian.net/"
+"apikeys/), for command-line remote access; here is an example below (the "
+"file `dcs-apikeyHeader-plessy.txt` contains `x-dcs-apikey: ` followed by my "
+"access key)."
 
 #. type: Plain text
 #, no-wrap
@@ -66,11 +68,12 @@ msgstr "    curl -X GET \"https://codesearch.debian.net/api/v1/searchperpackage?
 
 #. type: Plain text
 msgid ""
-"Le résultat est en JSON.  Voici comment de l'ai transformé pour faire une liste d'adresses courriel "
-"à contacter que j'ai pu facilement coller dans `mutt`."
+"Le résultat est en JSON.  Voici comment de l'ai transformé pour faire une "
+"liste d'adresses courriel à contacter que j'ai pu facilement coller dans "
+"`mutt`."
 msgstr ""
-"The result is serialised in JSON.  Here is how I transformed it to make a list of email addresses "
-"that I could easily paste in `mutt`."
+"The result is serialised in JSON.  Here is how I transformed it to make a "
+"list of email addresses that I could easily paste in `mutt`."
 
 #. type: Plain text
 #, no-wrap

En english
diff --git "a/Debian/debi\303\242neries/codesearch.en.po" "b/Debian/debi\303\242neries/codesearch.en.po"
index 61139f59..923df5f1 100644
--- "a/Debian/debi\303\242neries/codesearch.en.po"
+++ "b/Debian/debi\303\242neries/codesearch.en.po"
@@ -3,75 +3,74 @@
 # This file is distributed under the same license as the PACKAGE package.
 # FIRST AUTHOR <EMAIL@ADDRESS>, YEAR.
 #
-#, fuzzy
 msgid ""
 msgstr ""
-"Project-Id-Version: PACKAGE VERSION\n"
+"Project-Id-Version: \n"
 "POT-Creation-Date: 2021-07-22 08:37+0000\n"
-"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
-"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
-"Language-Team: LANGUAGE <LL@li.org>\n"
-"Language: \n"
+"PO-Revision-Date: 2021-07-22 17:43+0900\n"
+"Language: en\n"
 "MIME-Version: 1.0\n"
 "Content-Type: text/plain; charset=UTF-8\n"
 "Content-Transfer-Encoding: 8bit\n"
+"Last-Translator: Charles Plessy <toto@example.com>\n"
+"Language-Team: \n"
+"X-Generator: Poedit 2.2.1\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!meta date=\"Thu, 22 Jul 2021 17:24:34 +0900\"]]\n"
-msgstr ""
+msgstr "[[!meta date=\"Thu, 22 Jul 2021 17:24:34 +0900\"]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!meta updated=\"Thu, 22 Jul 2021 17:24:34 +0900\"]]\n"
-msgstr ""
+msgstr "[[!meta updated=\"Thu, 22 Jul 2021 17:24:34 +0900\"]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!tag Debian]]\n"
-msgstr ""
+msgstr "[[!tag Debian]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!meta title=\"Recherche dans les sources de Debian\"]]\n"
-msgstr ""
+msgstr "[[!meta title=\"Search in Debian's sources\"]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid ""
-"Via mon travail sur le paquet "
-"[`media-types`](packages.debian.org/media-types)\n"
-"je voulais savoir quel paquets utilisaient le type média "
-"`application/x-xcf`\n"
-"qui apparemment est erroné ([#991158](https://bugs.debian.org/991158)).  "
-"Le\n"
-"site <codesearch.debian.net> permet de répondre à cette question.  "
-"(Merci !)\n"
+"Via mon travail sur le paquet [`media-types`](packages.debian.org/media-types)\n"
+"je voulais savoir quel paquets utilisaient le type média `application/x-xcf`\n"
+"qui apparemment est erroné ([#991158](https://bugs.debian.org/991158)).  Le\n"
+"site <codesearch.debian.net> permet de répondre à cette question.  (Merci !)\n"
 msgstr ""
+"Via my work on the [`media-types`](packages.debian.org/media-types) package, \n"
+"I wanted to know which packages were using the media type `application/x-xcf`,\n"
+"which apparently is not correct ([#991158](https://bugs.debian.org/991158)).\n"
+"The <codesearch.debian.net> site gives the answer.  (Thanks!)\n"
 
 #. type: Plain text
 msgid ""
-"De plus, [en créant une clé "
-"d'utilisateur](https://codesearch.debian.net/apikeys/), on peut interroger "
-"le site en ligne de commande; voici un exemple ci-dessous (le fichier "
-"`dcs-apikeyHeader-plessy.txt` contient `x-dcs-apikey: ` suivi de ma clé "
-"d'accès)"
+"De plus, [en créant une clé d'utilisateur](https://codesearch.debian.net/apikeys/), on peut "
+"interroger le site en ligne de commande; voici un exemple ci-dessous (le fichier `dcs-apikeyHeader-"
+"plessy.txt` contient `x-dcs-apikey: ` suivi de ma clé d'accès)"
 msgstr ""
+"Moreover, one can [create a user key](https://codesearch.debian.net/apikeys/), for command-line "
+"remote access; here is an example below (the file `dcs-apikeyHeader-plessy.txt` contains `x-dcs-"
+"apikey: ` followed by my access key)."
 
 #. type: Plain text
 #, no-wrap
-msgid ""
-"    curl -X GET "
-"\"https://codesearch.debian.net/api/v1/searchperpackage?query=application/x-xcf&match_mode=literal\" "
-"-H @dcs-apikeyHeader-plessy.txt > result.json\n"
-msgstr ""
+msgid "    curl -X GET \"https://codesearch.debian.net/api/v1/searchperpackage?query=application/x-xcf&match_mode=literal\" -H @dcs-apikeyHeader-plessy.txt > result.json\n"
+msgstr "    curl -X GET \"https://codesearch.debian.net/api/v1/searchperpackage?query=application/x-xcf&match_mode=literal\" -H @dcs-apikeyHeader-plessy.txt > result.json\n"
 
 #. type: Plain text
 msgid ""
-"Le résultat est en JSON.  Voici comment de l'ai transformé pour faire une "
-"liste d'adresses courriel à contacter que j'ai pu facilement coller dans "
-"`mutt`."
+"Le résultat est en JSON.  Voici comment de l'ai transformé pour faire une liste d'adresses courriel "
+"à contacter que j'ai pu facilement coller dans `mutt`."
 msgstr ""
+"The result is serialised in JSON.  Here is how I transformed it to make a list of email addresses "
+"that I could easily paste in `mutt`."
 
 #. type: Plain text
 #, no-wrap
@@ -81,3 +80,7 @@ msgid ""
 "      dd-list --stdin |\n"
 "      sed -e '/^ /d' -e '/^$/'d -e 's/$/,/' -e 's/^/  /'\n"
 msgstr ""
+"    cat result.json |\n"
+"      jq --raw-output '.[].\"package\"' |\n"
+"      dd-list --stdin |\n"
+"      sed -e '/^ /d' -e '/^$/'d -e 's/$/,/' -e 's/^/  /'\n"

updated PO files
diff --git "a/Debian/debi\303\242neries/codesearch.en.po" "b/Debian/debi\303\242neries/codesearch.en.po"
new file mode 100644
index 00000000..61139f59
--- /dev/null
+++ "b/Debian/debi\303\242neries/codesearch.en.po"
@@ -0,0 +1,83 @@
+# SOME DESCRIPTIVE TITLE
+# Copyright (C) YEAR Free Software Foundation, Inc.
+# This file is distributed under the same license as the PACKAGE package.
+# FIRST AUTHOR <EMAIL@ADDRESS>, YEAR.
+#
+#, fuzzy
+msgid ""
+msgstr ""
+"Project-Id-Version: PACKAGE VERSION\n"
+"POT-Creation-Date: 2021-07-22 08:37+0000\n"
+"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
+"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
+"Language-Team: LANGUAGE <LL@li.org>\n"
+"Language: \n"
+"MIME-Version: 1.0\n"
+"Content-Type: text/plain; charset=UTF-8\n"
+"Content-Transfer-Encoding: 8bit\n"
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!meta date=\"Thu, 22 Jul 2021 17:24:34 +0900\"]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!meta updated=\"Thu, 22 Jul 2021 17:24:34 +0900\"]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!tag Debian]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!meta title=\"Recherche dans les sources de Debian\"]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid ""
+"Via mon travail sur le paquet "
+"[`media-types`](packages.debian.org/media-types)\n"
+"je voulais savoir quel paquets utilisaient le type média "
+"`application/x-xcf`\n"
+"qui apparemment est erroné ([#991158](https://bugs.debian.org/991158)).  "
+"Le\n"
+"site <codesearch.debian.net> permet de répondre à cette question.  "
+"(Merci !)\n"
+msgstr ""
+
+#. type: Plain text
+msgid ""
+"De plus, [en créant une clé "
+"d'utilisateur](https://codesearch.debian.net/apikeys/), on peut interroger "
+"le site en ligne de commande; voici un exemple ci-dessous (le fichier "
+"`dcs-apikeyHeader-plessy.txt` contient `x-dcs-apikey: ` suivi de ma clé "
+"d'accès)"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid ""
+"    curl -X GET "
+"\"https://codesearch.debian.net/api/v1/searchperpackage?query=application/x-xcf&match_mode=literal\" "
+"-H @dcs-apikeyHeader-plessy.txt > result.json\n"
+msgstr ""
+
+#. type: Plain text
+msgid ""
+"Le résultat est en JSON.  Voici comment de l'ai transformé pour faire une "
+"liste d'adresses courriel à contacter que j'ai pu facilement coller dans "
+"`mutt`."
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid ""
+"    cat result.json |\n"
+"      jq --raw-output '.[].\"package\"' |\n"
+"      dd-list --stdin |\n"
+"      sed -e '/^ /d' -e '/^$/'d -e 's/$/,/' -e 's/^/  /'\n"
+msgstr ""
diff --git "a/Debian/debi\303\242neries/r-4.1.en.po" "b/Debian/debi\303\242neries/r-4.1.en.po"
index 441cd445..33130930 100644
--- "a/Debian/debi\303\242neries/r-4.1.en.po"
+++ "b/Debian/debi\303\242neries/r-4.1.en.po"
@@ -6,14 +6,14 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: \n"
-"POT-Creation-Date: 2021-05-24 02:21+0000\n"
+"POT-Creation-Date: 2021-07-22 08:37+0000\n"
 "PO-Revision-Date: 2021-05-24 11:26+0900\n"
+"Last-Translator: \n"
+"Language-Team: \n"
 "Language: en\n"
 "MIME-Version: 1.0\n"
 "Content-Type: text/plain; charset=UTF-8\n"
 "Content-Transfer-Encoding: 8bit\n"
-"Last-Translator: \n"
-"Language-Team: \n"
 "X-Generator: Poedit 2.2.1\n"
 
 #. type: Plain text

Codesearch
diff --git "a/Debian/debi\303\242neries/codesearch.mdwn" "b/Debian/debi\303\242neries/codesearch.mdwn"
new file mode 100644
index 00000000..56b47562
--- /dev/null
+++ "b/Debian/debi\303\242neries/codesearch.mdwn"
@@ -0,0 +1,25 @@
+[[!meta date="Thu, 22 Jul 2021 17:24:34 +0900"]]
+[[!meta updated="Thu, 22 Jul 2021 17:24:34 +0900"]]
+[[!tag Debian]]
+
+[[!meta title="Recherche dans les sources de Debian"]]
+
+Via mon travail sur le paquet [`media-types`](packages.debian.org/media-types)
+je voulais savoir quel paquets utilisaient le type média `application/x-xcf`
+qui apparemment est erroné ([#991158](https://bugs.debian.org/991158)).  Le
+site <codesearch.debian.net> permet de répondre à cette question.  (Merci !)
+
+De plus, [en créant une clé d'utilisateur](https://codesearch.debian.net/apikeys/),
+on peut interroger le site en ligne de commande; voici un exemple ci-dessous
+(le fichier `dcs-apikeyHeader-plessy.txt` contient `x-dcs-apikey: ` suivi de ma
+clé d'accès)
+
+    curl -X GET "https://codesearch.debian.net/api/v1/searchperpackage?query=application/x-xcf&match_mode=literal" -H @dcs-apikeyHeader-plessy.txt > result.json
+
+Le résultat est en JSON.  Voici comment de l'ai transformé pour faire une liste
+d'adresses courriel à contacter que j'ai pu facilement coller dans `mutt`.
+
+    cat result.json |
+      jq --raw-output '.[]."package"' |
+      dd-list --stdin |
+      sed -e '/^ /d' -e '/^$/'d -e 's/$/,/' -e 's/^/  /'

Parenthèses
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 94662e25..099fa178 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -236,12 +236,12 @@ Genes and pathways
  - Two connexins, CxA and CxB are expressed during embyogenesis ([[Mikhaleva,
    Tolstenkov and Glover 2019|biblio/30905687]]).
  - Piwi ([[Henriet and coll., 2015|biblio/25779047]]).
- - Metallothioneins _OdMT1_ and _OdMT2_ [[Calatayud and coll., 2018|biblio/30284576]].
+ - Metallothioneins _OdMT1_ and _OdMT2_ ([[Calatayud and coll., 2018|biblio/30284576]]).
    Their cysteins are organised in a way that is not found in other branches of the
-   evolutionary tree [[Calatayud and coll., 2021a|biblio/34146103]].  They bind cadmium
+   evolutionary tree ([[Calatayud and coll., 2021a|biblio/34146103]]).  They bind cadmium
    ions and display variations of number of tandem repeats between dioceous species.
    Non-functional alleles were found, raising the possibility that some individuals
-   lack MT genes [[Calatayud and coll., 2021b|biblio/34277643]].
+   lack MT genes ([[Calatayud and coll., 2021b|biblio/34277643]]).
  - 2 NUMB genes were found; both are closer to Vertebrate NUMB than to Vertebrate NUMB-Like
    ([[Confalonieri and coll., 2019|biblio/31451549]]).
  - Genes related to thyroid functions (_vWFL_, _Nkx2-1_, _FoxE_, _TPO_ and _Duox_)

MTs
diff --git a/biblio/34277643.mdwn b/biblio/34277643.mdwn
new file mode 100644
index 00000000..d8968413
--- /dev/null
+++ b/biblio/34277643.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Modular Evolution and Population Variability of Oikopleura dioica Metallothioneins."]]
+[[!tag Oikopleura]]
+
+Calatayud S, Garcia-Risco M, Capdevila M, Cañestro C, Palacios Ò, Albalat R.
+
+Front Cell Dev Biol. 2021 Jul 2;9:702688. doi:10.3389/fcell.2021.702688
+
+Modular Evolution and Population Variability of Oikopleura dioica Metallothioneins.
+
+[[!pmid 34277643 desc="“we concluded that the 11C/12C domain of OdiMTs formed stable clusters with four Cd(II) ions”  “protein sequence comparisons reveal amino-acid identities ranging from 94.4% between Norway and Barcelona, up to 63.9% when compared with the sequence of Okinawa”  “amino acid identities persistently were slightly lower than nucleotide identities [...] indicated that nucleotide substitutions are significantly affecting non-synonymous positions, which can be considered an indication [of] positive selection.”  “The presence of [...] non-functional alleles for both MTs [...] opened the possibility that some O. dioica specimens might lack functional MTs”  “The most conspicuous difference of OdiMT genes between O. dioica populations was the identification of OdiMT2 encoding proteins with variable number of RUs (i.e., t-12C/12 pairs). OdiMT2ORE with seven repeats (RU1–RU7) was the longest one, followed by OdiMT2NOR, with six repeats, OdiMT2OSA, with five repeats, OdiMT2CAT, with four repeats, and OdiMT2OKI, with three repeats.”"]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 2d481120..94662e25 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -238,7 +238,10 @@ Genes and pathways
  - Piwi ([[Henriet and coll., 2015|biblio/25779047]]).
  - Metallothioneins _OdMT1_ and _OdMT2_ [[Calatayud and coll., 2018|biblio/30284576]].
    Their cysteins are organised in a way that is not found in other branches of the
-   evolutionary tree [Calatayud and coll., 2021|biblio/34146103].
+   evolutionary tree [[Calatayud and coll., 2021a|biblio/34146103]].  They bind cadmium
+   ions and display variations of number of tandem repeats between dioceous species.
+   Non-functional alleles were found, raising the possibility that some individuals
+   lack MT genes [[Calatayud and coll., 2021b|biblio/34277643]].
  - 2 NUMB genes were found; both are closer to Vertebrate NUMB than to Vertebrate NUMB-Like
    ([[Confalonieri and coll., 2019|biblio/31451549]]).
  - Genes related to thyroid functions (_vWFL_, _Nkx2-1_, _FoxE_, _TPO_ and _Duox_)

Taco Kimchi
diff --git a/biblio/10.1111_cla.12405.mdwn b/biblio/10.1111_cla.12405.mdwn
index fec5609f..84f37f1c 100644
--- a/biblio/10.1111_cla.12405.mdwn
+++ b/biblio/10.1111_cla.12405.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Phylogenetic analysis of phenotypic characters of Tunicata supports basal Appendicularia and monophyletic Ascidiacea"]]
-[[!tag to_read Oikopleura]]
+[[!tag Oikopleura]]
 
 Katrin Braun, Fanny Leubner, Thomas Stach
 
@@ -7,4 +7,4 @@ Cladistics Volume36, Issue3, June 2020, Pages 259–300 doi:10.1111/cla.12405
 
 Phylogenetic analysis of phenotypic characters of Tunicata supports basal Appendicularia and monophyletic Ascidiacea
 
-[[!doi 10.1111/cla.12405 desc="Places appendicularians basal in tunicates."]]
+[[!doi 10.1111/cla.12405 desc="Places appendicularians basal in tunicates.  Detailed summary of past studies pro and con that placement."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 7c372cb9..2d481120 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -51,6 +51,8 @@ Phylogeny
    and 210 single-copy orthogroups from 37 tunicates + 10 outgroups
    [[DeBiasse and coll., 2020|biblio/32211845]] show that appendicularians are
    sister to all other tunicates.
+ - Study of 117 phenotypic characters in 49 tunicate species also support basal
+   position of appendicularians ([[Braun, Leubner and Stach, 2019|biblio/10.1111_cla.12405]].
  - “The difference between coding sequences was considerably higher in
    comparisons between strains of different oceans than within the Bergen gene
    pool.  We ignore whether and how Oikopleura dioica is subdivided into multiple

eDNA primers
diff --git a/tags/eDNA.mdwn b/tags/eDNA.mdwn
index d17cbe9b..48987409 100644
--- a/tags/eDNA.mdwn
+++ b/tags/eDNA.mdwn
@@ -11,4 +11,22 @@
 
  - A Nextflow pipeline: eDNAFlow [[Mousavi‐Derazmahalleh and coll., 2021|biblio/10.1111_1755-0998.13356]].
 
+### Published primers
+
+```
+>18S_1F 10.1371/journal.pone.0073935
+GCCAGTAGTCATATGCTTGTCT
+>18S_701R 10.1371/journal.pone.0073935
+GGAGCTGGAATTACCGC
+```
+https://doi.org/10.1371/journal.pone.0073935
+
+```
+>UroCox1-244 F 10.2108/zsj.26.564
+CATTTWTTTTGATTWTTTRGWCATCCNGA
+>UroCox1-387R 10.2108/zsj.26.564
+GCWCYTATWSWWAAWACATAATGAAARTG
+```
+https://doi.org/10.2108/zsj.26.564
+
 [[!inline pages="tagged(eDNA)" limit=0]]

Café
diff --git a/biblio/33963409.mdwn b/biblio/33963409.mdwn
new file mode 100644
index 00000000..219e4217
--- /dev/null
+++ b/biblio/33963409.mdwn
@@ -0,0 +1,12 @@
+[[!meta title="Locally adaptive inversions modulate genetic variation at different geographic scales in a seaweed fly"]]
+[[!tag variants genome]]
+
+Mérot C, Berdan E, Cayuela H, Djambazian H, Ferchaud AL, Laporte M, Normandeau E, Ragoussis J, Wellenreuther M, Bernatchez L.
+
+Mol Biol Evol. 2021 May 7:msab143. doi:10.1093/molbev/msab143
+
+Locally adaptive inversions modulate genetic variation at different geographic scales in a seaweed fly.
+
+[[!pmid 33963409 desc="Chromosomal assembly of Coelopa frigida.  SNP analysis and PCA revealed known and candidate genomic inversions."]]
+
+“We sampled the seaweed fly _Coelopa frigida_ along a bioclimatic gradient stretching across 10° of latitude, a salinity gradient and a range of heterogeneous, patchy habitats. We generated a chromosome-level genome assembly to analyse 1,446 low-coverage whole genomes collected along those gradients.“  “Analyses of more than 1,400 whole genomes of _C. frigida_ flies revealed four large chromosomal inversions affecting a large fraction of the genome (36.1Mb, 15%), and three low recombining genomic regions.”  “Among the 124,701 candidate SNPs identified by the GWAS, more than 99.8% were located in Cf-Inv(1)”  “At a finer geographic scale, outlier SNPs associated with wrackbed abiotic characteristics (depth, temperature and salinity) were strongly enriched in the inverted region Cf-Inv(1) with an odds ratio of 5, including outliers with very strong support”
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 864be2d8..6eb4f28c 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -5,6 +5,9 @@ _in progress_
 Long read sequencing data from 3,622 Icelanders identified a median of 22,636
 SVs per individual (insertios: 13,353; deletions: 9,474) [[Beyter and coll, 2021|biblio/33972781]].
 
+SNP analysis in >1400 seaweed flies identified known and candidate genomic inversions
+([[Mérot and coll, 2021|biblio/33963409]]).
+
 ### Software
 
  - _NanoSV_ ([[Cretu Stancu and coll., 2017|biblio/29109544]]) uses nanopore long

Remove rarely used tag
diff --git a/biblio/21177961.mdwn b/biblio/21177961.mdwn
index 7bef1fc6..5c1aa053 100644
--- a/biblio/21177961.mdwn
+++ b/biblio/21177961.mdwn
@@ -1,3 +1,3 @@
 [[!meta title="Genome-wide analysis of promoter architecture in Drosophila melanogaster."]]
-[[!tag fly CAGE promoter 3′_UTR]]
+[[!tag Drosophila CAGE promoter 3′_UTR]]
 [[!pmid 21177961 desc="Introduces promoter ‘shape index’, finds tags aligning to mitochondrial genome, and suggests that, because they do not overlap with the small RNAs produced by PolII stalling, the 3′ peaks are a processing product."]]
diff --git a/tags/fly.mdwn b/tags/fly.mdwn
deleted file mode 100644
index 4ada57c1..00000000
--- a/tags/fly.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged fly"]]
-
-[[!inline pages="tagged(fly)" actions="no" archive="yes"
-feedshow=10]]

Café
diff --git a/biblio/17780989.mdwn b/biblio/17780989.mdwn
new file mode 100644
index 00000000..0ad5b777
--- /dev/null
+++ b/biblio/17780989.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Abandoned larvacean houses: a unique food source in the pelagic environment"]]
+[[!tag Oikopleura]]
+
+Alldredge AL.
+
+Science. 1972 Sep 8;177(4052):885-7. doi:10.1126/science.177.4052.885
+
+Abandoned larvacean houses: a unique food source in the pelagic environment
+
+[[!pmid 17780989 desc="The copepod _Oncaea mediterranea_ can feed on appendicularian houses (lab experiment with starved copepods).  As some nanoplankton is caugt in the abandonned houses, this brings back the nanplankton in the copepod food chain."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 74c9472a..7c372cb9 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -509,6 +509,8 @@ House
    is lost during later development.
  - Study of the _O. dioica_ house and the origin of its components on the oikoblastic
    epithelium, using multiple microscopy techniques [[Razghandi and coll., 2020|biblio/34041785]].
+ - Abandonned houses bring nanoplankton into the copepod food chain
+   ([[Alldredge AL, 1972|biblio/17780989]]).
 
 Phenotypes
 ----------

Café
diff --git a/biblio/33461212.mdwn b/biblio/33461212.mdwn
new file mode 100644
index 00000000..697cfcb2
--- /dev/null
+++ b/biblio/33461212.mdwn
@@ -0,0 +1,22 @@
+[[!meta title="Giant lungfish genome elucidates the conquest of land by vertebrates."]]
+[[!tag fish genome intron]]
+
+Meyer A, Schloissnig S, Franchini P, Du K, Woltering JM, Irisarri I, Wong WY, Nowoshilow S, Kneitz S, Kawaguchi A, Fabrizius A, Xiong P, Dechaud C, Spaink HP, Volff JN, Simakov O, Burmester T, Tanaka EM, Schartl M.
+
+Nature. 2021 Feb;590(7845):284-289. doi:10.1038/s41586-021-03198-8
+
+Giant lungfish genome elucidates the conquest of land by vertebrates.
+
+[[!pmid 33461212 desc="37-Gb assembly, 90% repetitive, with long introns.  However, introns in developmental genes are proportionally smaller than other introns.  The proportion of intronic sequences (~20%) is simlar to the one of human.  Microchromosomes were retained."]]
+
+“37-Gb assembly with an N50 contig size 1.86 Mb”
+
+“The complete retention of microchromosomes [...] suggests that stabilizing selection maintains these ancestral units. In support of this, lungfish microchromosomes show—on average—higher gene densities and a lower density of long interspersed nuclear elements (LINEs), which are the major contributors to genome size”
+
+“[We] identified 67.3% (24.65 Gb) as repetitive. To our knowledge, this is the highest repetitive DNA content in a genome found in the animal kingdom.  [...] applying a second round of repeat annotation [...] revealed an additional 23.92% of repetitive DNA”
+
+“All major categories of transposable elements (1,106 out of 1,821 (60.7%)) were expressed [in poly(A)-RNA-derived RNA-seq data].”
+
+“The largest intron of the lungfish is 5.8 Mb (in the dmbt1 gene) and average intron size is 50 kb as in axolotl, compared to 1 kb in fugu and 6 kb in human. Introns in the N. forsteri genome comprise about 8 Gb (21% of genome)—a similar proportion to that in human (21%), but half that of fugu (40%).”  ”Similar to axolotl, the introns in developmental genes in lungfish are smaller than in nondevelopmental genes”
+
+“The 4 clusters of hox genes [...] comprise 43 genes; the presence of hoxb10 and hoxa14 in lungfish confirms their loss at the fish-to-tetrapod transition.”

mini-chromosomeswq
diff --git a/biblio/32313176.mdwn b/biblio/32313176.mdwn
index 614e184a..f1da69c7 100644
--- a/biblio/32313176.mdwn
+++ b/biblio/32313176.mdwn
@@ -7,4 +7,4 @@ Nat Ecol Evol. 2020 Jun;4(6):820-830. doi:10.1038/s41559-020-1156-z
 
 Deeply conserved synteny resolves early events in vertebrate evolution.
 
-[[!pmid 32313176 desc="Most of the 19 amphioxus (lancelet) chromosomes directly correspond to one of the 17 ancestral chordate linkage groups.  Pattern of paralogue elimination show that autotetraploidy was followed by allotetraploidy in bony vertebrates."]]
+[[!pmid 32313176 desc="Most of the 19 amphioxus (lancelet) chromosomes directly correspond to one of the 17 ancestral chordate linkage groups.  Pattern of paralogue elimination show that autotetraploidy was followed by allotetraploidy in bony vertebrates.  Vertebrate and amphioxus mini-chromosomes descend from the ancestral linkage groups too."]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index f915e414..7877f2c5 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -38,6 +38,8 @@ two species [[Mudd and coll, 2020|biblio/32873878]].
 
  - The ancestral chordate has 17 chromosomes according to amphioxus assemblies
   ([[Putnam and coll, 2008|biblio/18563158]], [[Simakov and coll., 2020|biblio/32313176]]).
+   Vertebrate and amphioxus mini-chromosomes also descend from the ancestral
+   chordate linkage groups (CLG).
 
  - The scallop genome has 19 chromosomes, which are syntenic to the 17 ancestral
    chordate chromosomes.  _Drosophila_ has no synteny with scallop, but _C.

Merge branch 'master' of ssh://charles-plessy-org.branchable.com
GenBank accession numbers.
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index befcf656..754ed7ca 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -27,7 +27,8 @@ Some links:
    ([[Dardaillon and coll., 2020|biblio/31680137]]):
    <https://www.aniseed.cnrs.fr/aniseed/species/show_species?unique_name=Oikopleura_dioica>
  - OKI2018_I69 genome [[Bliznina and coll., 2021|biblio/33781200]] on ZENBU:
-   <https://fantom.gsc.riken.jp/zenbu/gLyphs/#config=0tPT7vwSO1Vm5QV9iKqfAC>.
+   <https://fantom.gsc.riken.jp/zenbu/gLyphs/#config=0tPT7vwSO1Vm5QV9iKqfAC>
+   and in GenBank [CAJRAX010000001-CAJRAX010000013](https://www.ncbi.nlm.nih.gov/nuccore/2038458167).
 
 Parasites: _Oodinium pouchetii_, microsporidia (on _O. gracilis_ ([[Savelieva
 2019|biblio/10.1134_S1063074019020111]])), bacteria ([[Flood,

Café
diff --git a/biblio/34108684.mdwn b/biblio/34108684.mdwn
new file mode 100644
index 00000000..7cf530e7
--- /dev/null
+++ b/biblio/34108684.mdwn
@@ -0,0 +1,22 @@
+[[!meta title="Spo11 generates gaps through concerted cuts at sites of topological stress."]]
+[[!tag meiosis repair]]
+
+Nature. 2021 Jun;594(7864):577-582. doi:10.1038/s41586-021-03632-x
+
+Prieler S, Chen D, Huang L, Mayrhofer E, Zsótér S, Vesely M, Mbogning J, Klein F.
+
+Spo11 generates gaps through concerted cuts at sites of topological stress. 
+
+[[!pmid 34108684 desc="Spo11 has a binding preference for CN7AAGCA|TGCTTN7G and for bendable DNA.  Double Spo11 cleavage generates chromosome gaps repaired by gene conversion."]]
+
+“we developed ‘Protec-seq’ for the purification of end-protected DNA, which includes ChIP of Spo11, ExoV digestion, and the removal of residual 5′-tyrosyl [with hTDP2 (BPS Bioscience)] followed by deep sequencing.”
+
+“dDSB fragments also densely cover chromosomal regions between hotspots, with approximately 31% of cuts outside of hotspots in wild-type cells and around 62% in rad50S mutants”
+
+”The high precision of Protec-seq enabled us to identify that Spo11 has a preference for sequences that partially match a 26-nt long palindromic motif, CN7AAGCA|TGCTTN7G, centred at the cleavage axis (Fig. 2a), and a preference for C and G at position ±13 bp marking the border of the footprint of Spo1133.”
+
+“Dividing the preferred fragment lengths into n helical turns leads to helix lengths above 10.4 bp, indicative of underwound DNA. [...] DNA at promoters is underwound or negatively supercoiled [...] In both wild-type and rad50S cells, (d)DSB levels correlate positively with the corresponding transcriptional stress.”
+
+”As an evolutionary relative of a type IIB topoisomerase, the Spo11 complex may require DNA crossings for the cleavage reaction, which are likely to form at promoters known to accumulate negative supercoils. [...] topoisomerase II (Top2) prefers to bind to DNA crossings under superhelical stress [...] robust [Top2] peaks accumulate at nearly all dDSB sites by the time of DSB formation [...] the occupancy of Top2 increases moderately with higher transcriptional stress at (divergent and tandem) promoters, but not at convergent sites”
+
+“we tested whether gaps that result from dDSBs could account for the observed 6:2 [gene conversion] events by determining the set of dDSB fragments that fully overlap a 6:2 event as an indicator for the local probability of gap formation. The 6:2 event distribution is significantly shifted to genomic positions with higher dDSB gap probability, which indicates that dDSB gaps are enriched at full gene conversion sites and of sufficient length in both wild-type strains and rad50S mutants, as opposed to spo11Y135F mutants”
diff --git a/tags/meiosis.mdwn b/tags/meiosis.mdwn
index be28595d..9bfc0b3f 100644
--- a/tags/meiosis.mdwn
+++ b/tags/meiosis.mdwn
@@ -3,6 +3,7 @@
 _in progress_
 
  - Spo11 cleaves both DNA strands.  Double cleavage creates gaps repaired by
-   homologous recombination ([[Johnson and coll., 2021|biblio/34108687]]).
+   homologous recombination ([[Johnson and coll., 2021|biblio/34108687]]
+   and [[Prieler and coll., 2021|biblio/34108684]]).
 
 [[!inline pages="tagged(meiosis)" limit=0]]

Café
diff --git a/biblio/34146103.mdwn b/biblio/34146103.mdwn
new file mode 100644
index 00000000..de687d52
--- /dev/null
+++ b/biblio/34146103.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Tunicates illuminate the enigmatic evolution of chordate metallothioneins by gene gains and losses, independent modular expansions and functional convergences."]]
+[[!tag Oikopleura]]
+
+Calatayud S, Garcia-Risco M, Palacios Ò, Capdevila M, Cañestro C, Albalat R.
+
+Mol Biol Evol. 2021 Jun 19:msab184. doi:10.1093/molbev/msab184
+
+Tunicates illuminate the enigmatic evolution of chordate metallothioneins by gene gains and losses, independent modular expansions and functional convergences.
+
+[[!pmid 34146103 desc="Ancestral two-domain organisation found in Cephalochordates and Vertebrates.  Ascidians appear to have lost one domain and larvaceans proteins ressemble no other."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index fcddd23c..d6b9b711 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -234,6 +234,8 @@ Genes and pathways
    Tolstenkov and Glover 2019|biblio/30905687]]).
  - Piwi ([[Henriet and coll., 2015|biblio/25779047]]).
  - Metallothioneins _OdMT1_ and _OdMT2_ [[Calatayud and coll., 2018|biblio/30284576]].
+   Their cysteins are organised in a way that is not found in other branches of the
+   evolutionary tree [Calatayud and coll., 2021|biblio/34146103].
  - 2 NUMB genes were found; both are closer to Vertebrate NUMB than to Vertebrate NUMB-Like
    ([[Confalonieri and coll., 2019|biblio/31451549]]).
  - Genes related to thyroid functions (_vWFL_, _Nkx2-1_, _FoxE_, _TPO_ and _Duox_)

Café
diff --git a/biblio/34179025.mdwn b/biblio/34179025.mdwn
new file mode 100644
index 00000000..676538d4
--- /dev/null
+++ b/biblio/34179025.mdwn
@@ -0,0 +1,12 @@
+[[!meta title="Massive Gene Loss and Function Shuffling in Appendicularians Stretch the Boundaries of Chordate Wnt Family Evolution."]]
+[[!tag Oikopleura]]
+
+Martí-Solans J, Godoy-Marín H, Diaz-Gracia M, Onuma TA, Nishida H, Albalat R, Cañestro C.
+
+Front Cell Dev Biol. 2021 Jun 9;9:700827. doi:10.3389/fcell.2021.700827
+
+Massive Gene Loss and Function Shuffling in Appendicularians Stretch the Boundaries of Chordate Wnt Family Evolution.
+
+[[!pmid 34179025 desc="Localised subcellular expression in the “postplasm” during early embryogenesis.  Gene amplification by retrotranscription."]]
+
+”8 _O. dioica_ Wnts belonged to 4 Wnt subfamilies—i.e., Wnt5, Wnt10, Wnt11 (5 sequences) and Wnt16 subfamilies). The results, therefore, show that O. dioica have lost 9 Wnt subfamilies during its evolution. On the other hand, our results revealed that_ O. dioica_ has expanded the Wnt11 subfamily to at least 4 paralogs, named _Odi_Wnt11a_ to _Odi_Wnt11d_.”  “Odi_Wnt11b, Odi_Wnt11c, and Odi_Wnt11d, had no introns, pointing to the possibility of a retrotranscriptional origin during the evolution of the appendicularian lineage.”
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 4e1c5b82..fcddd23c 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -238,6 +238,9 @@ Genes and pathways
    ([[Confalonieri and coll., 2019|biblio/31451549]]).
  - Genes related to thyroid functions (_vWFL_, _Nkx2-1_, _FoxE_, _TPO_ and _Duox_)
    were studied by [[Onuma and coll., 2020|biblio/34107272]].
+ - 8 Wnt genes were found, belonging to 4 families.  Intronless _Wnt11_ genes
+   were found; they might have been created by retrotransposition
+   ([[Martí-Solans and coll., 2021|biblio/34179025]]).
 
 ### Lost
 

Café
diff --git a/biblio/34108687.mdwn b/biblio/34108687.mdwn
new file mode 100644
index 00000000..19fbc116
--- /dev/null
+++ b/biblio/34108687.mdwn
@@ -0,0 +1,20 @@
+[[!meta title="Concerted cutting by Spo11 illuminates meiotic DNA break mechanics."]]
+[[!tag meiosis repair]]
+
+Johnson D, Crawford M, Cooper T, Claeys Bouuaert C, Keeney S, Llorente B, Garcia V, Neale MJ.
+
+Concerted cutting by Spo11 illuminates meiotic DNA break mechanics.
+
+Nature. 2021 Jun;594(7864):572-576. doi:10.1038/s41586-021-03389-3
+
+[[!pmid 34108687 desc="Pairs of double strand breaks created by Spo11 causes loss of short oligonucleotides, creating a cap repaired by homologous recombination."]]
+
+“High-resolution analysis of deproteinized Spo11-oligos showed [a ladder of] periodicity of around 10 nt [that] ranges in length from around 33 nt to more than 100 nt”  “The ladder also arose in rad50S-mutant and Mre11-nuclease-defective strains of S. cerevisiae, which, like the sae2∆ mutant, cannot remove Spo11 from DSB ends. Notably, the ladder depended on the catalytic activity of Spo11”  “we refer to this ladder as hyperlocalized ‘Spo11 double cuts’ (Spo11-DCs).”
+
+“because Spo11-DCs of less than 30 nt in length are not detected on gels and are depleted from filtered Spo11-oligo libraries, we propose that adjacent Spo11 complexes that are capable of making double cuts must, in vivo, interact with DNA from the same direction, thereby generating a ladder of Spo11-DCs with periodicity dictated by the helical pitch of DNA (around 10.5 bp).”
+
+“the global frequency of Spo11-DCs was disproportionately associated with regions of stronger Spo11 activity”
+
+“Deep sequencing of meiotic progeny identifies recombination scars that are consistent with repair initiated from gaps generated by adjacent Spo11 DSBs.”
+
+“We envision a mechanism in which multiple Spo11 proteins assemble with other pro-DSB factors to create a platform that enables concerted Spo11-DSB formation”
diff --git a/tags/meiosis.mdwn b/tags/meiosis.mdwn
index 3424eba1..be28595d 100644
--- a/tags/meiosis.mdwn
+++ b/tags/meiosis.mdwn
@@ -1,4 +1,8 @@
 [[!meta title="pages tagged meiosis"]]
 
-[[!inline pages="tagged(meiosis)" actions="no" archive="yes"
-feedshow=10]]
+_in progress_
+
+ - Spo11 cleaves both DNA strands.  Double cleavage creates gaps repaired by
+   homologous recombination ([[Johnson and coll., 2021|biblio/34108687]]).
+
+[[!inline pages="tagged(meiosis)" limit=0]]

Café
diff --git a/biblio/10.1007_BF00353257.mdwn b/biblio/10.1007_BF00353257.mdwn
new file mode 100644
index 00000000..dbb900ca
--- /dev/null
+++ b/biblio/10.1007_BF00353257.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Diet of anguilloid larvae: leptocephali feed selectively on larvacean houses and fecal pellets."]]
+[[!tag Oikopleura]]
+
+Mochioka, N., Iwamizu, M.
+
+Marine Biology 125, 447–452 (1996). doi:10.1007/BF00353257
+
+Diet of anguilloid larvae: leptocephali feed selectively on larvacean houses and fecal pellets.
+
+[[!doi 10.1007/BF00353257 desc="Proposes that “that the peculiar, large, fang-like teeth of leptocephali are used for feed- ing, and evolved to pierce and grasp the mucous houses of larvaceans”.  Found houses and fecal pellets that may be from _O. longicauda_."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index befcf656..4e1c5b82 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -552,6 +552,8 @@ Ecology
  - _O. dioica_ can filter, ingest and defecate the _Emiliania huxleyi_ virus
    ([[Lawrence and coll., 2018|biblio/10.1002_lno.10734]]).  This study does not assess
    whether the viruses are digested.
+ - Houses and fecal pellets of _Oikopleura_ species are consumed by eel larvae
+   ([[Mochioka and Iwamizu, 1996|biblio/10.1007_BF00353257]]).
 
 ### Distribution in and near Japan
 

Café
diff --git a/biblio/32883756.mdwn b/biblio/32883756.mdwn
new file mode 100644
index 00000000..4fb7dd48
--- /dev/null
+++ b/biblio/32883756.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="The Beginning of the End: A Chromosomal Assembly of the New World Malaria Mosquito Ends with a Novel Telomere. G3 (Bethesda)."]]
+[[!tag mosquito genome]]
+
+Compton A, Liang J, Chen C, Lukyanchikova V, Qi Y, Potters M, Settlage R, Miller D, Deschamps S, Mao C, Llaca V, Sharakhov IV, Tu Z.
+
+G3 (Bethesda). 2020 Oct 5;10(10):3811-3819. doi:10.1534/g3.120.401654
+
+The Beginning of the End: A Chromosomal Assembly of the New World Malaria Mosquito Ends with a Novel Telomere. G3 (Bethesda).
+
+[[!pmid 32883756 desc="Little interactions between chromosome arms."]]
diff --git a/tags/mosquito.mdwn b/tags/mosquito.mdwn
index 54da32e1..0354e7f3 100644
--- a/tags/mosquito.mdwn
+++ b/tags/mosquito.mdwn
@@ -1,4 +1,11 @@
 [[!meta title="pages tagged mosquito"]]
 
-[[!inline pages="tagged(mosquito)" actions="no" archive="yes"
-feedshow=10]]
+_work in progress_
+
+### Hi-C
+
+Little interactions between chromosome arms in _Aedes aegypti_
+([[Dudchenko and coll., 2017|biblio/28336562]]) and _Anopheles
+albimanus_ ([[Copmton and coll., 2020|biblio/32883756]]).
+
+[[!inline pages="tagged(mosquito)" limit=0]]
diff --git a/tags/muller_element.mdwn b/tags/muller_element.mdwn
index dad30cae..2aec4611 100644
--- a/tags/muller_element.mdwn
+++ b/tags/muller_element.mdwn
@@ -9,8 +9,9 @@ Synteny conservation is even visible between fruit flies and cockroaches
 
 Hi-C shows contacts between telomeres and between centromeres in mosquito
 species, and few contacts between both arms of the same chromosome ([[Dudchenko
-and coll., 2017|biblio/28336562]]).  Note that the chromosomes of Aedes aegypti
-are significantly larger than what is usually found in Drosophila.
+and coll., 2017|biblio/28336562]]; [[Copmton and coll., 2020|biblio/32883756]]).
+Note that the chromosomes of _Aedes aegypti_
+are significantly larger than what is usually found in _Drosophila_.
 
 _D. bifasciata_ (and other Drosophila) have large and highly repetitive
 pericentric regions [[Bracewell and coll., 2020|biblio/31969429]].

Avec du vin
diff --git a/biblio/34099548.mdwn b/biblio/34099548.mdwn
new file mode 100644
index 00000000..ea8bcc35
--- /dev/null
+++ b/biblio/34099548.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Accurate genomic variant detection in single cells with primary template-directed amplification."]]
+[[!tag amplification method]]
+
+Gonzalez-Pena V, Natarajan S, Xia Y, Klein D, Carter R, Pang Y, Shaner B, Annu K, Putnam D, Chen W, Connelly J, Pruett-Miller S, Chen X, Easton J, Gawad C.
+
+Proc Natl Acad Sci U S A. 2021 Jun 15;118(24):e2024176118. doi:10.1073/pnas.2024176118
+
+Accurate genomic variant detection in single cells with primary template-directed amplification.
+
+[[!pmid 34099548 desc="“primary template-directed amplification (PTA) [...] takes advantage of the processivity, strong strand displacement activity, and low error rate of phi29 polymerase [...] exonuclease-resistant terminators are incorporated into the reaction, creating smaller double-stranded amplification products that undergo limited subsequent amplification. This transforms the reaction from exponential into a quasilinear process with more of the amplification occurring from the primary template.”"]]
diff --git a/tags/amplification.mdwn b/tags/amplification.mdwn
index 798fcbaf..7c8520fe 100644
--- a/tags/amplification.mdwn
+++ b/tags/amplification.mdwn
@@ -18,4 +18,9 @@ concentration and annealing temperature) were investigated by [[Dai and coll.,
 complex sample, relatively long ITR (compared to primer length), high
 [annealing temperature], and high concentration of primer should be used.”.
 
+## Other methods
+
+ - Primary Template-directed Amplification (PTA), a kind of MDA with terminators
+   to limit the size of intermediate amplicaons [[Gonzalez-Pena and coll., 2021|biblio/34099548]]
+
 [[!inline pages="tagged(amplification)" limit=0]]

Oik
diff --git a/biblio/10.1007_s00343-020-0071-0.mdwn b/biblio/10.1007_s00343-020-0071-0.mdwn
new file mode 100644
index 00000000..4ab803e3
--- /dev/null
+++ b/biblio/10.1007_s00343-020-0071-0.mdwn
@@ -0,0 +1,26 @@
+[[!meta title="Role of intraspecific competition in intrinsic growth rate regulation in an Oikopleura dioica (Tunicata) population"]]
+[[!tag Oikopleura]]
+
+Li, S., Zhang, G.
+
+J. Ocean. Limnol. 39, 609–622 (2021). doi:10.1007/s00343-020-0071-0
+
+Role of intraspecific competition in intrinsic growth rate regulation in an _Oikopleura dioica_ (Tunicata) population.
+
+[[!doi 10.1007/s00343-020-0071-0 desc="_O. dioica_ found in Jiaozhou Bay, Qingdao, China and cultured at 18 °C.  Generation time of 4.5 days.  Largest animals tend to appear with low density of individuals and large amounts of food."]]
+
+“Individuals of Oikopleura dioica (Tunicata, Appendicularia) were collected in the Jiaozhou Bay, Qingdao, China (35°03′N, 120°20′E) on June 20, 2017, using a plankton net with a large-volume cod-end (10L). The samples were diluted into 50 L buckets and transported immediately to the laboratory, where healthy individuals were sorted and cultured in a small room (approximately 10 m2) maintained at 18 ± 1°C using a standard air conditioner.”
+
+“parental animals were forced to release their gametes by gentle aspiration in a pipette.  Then, all dishes were placed in a speed-regulating vibrator (HY-4H) rotating at 60 r/min for 5 min to mix the eggs and male gametes together, and this time was considered time zero (D0).”
+
+“To control the food concentration, a mono-diet of Isochrysis galbana was adopted for all treatments.”
+
+“From gamete production, the entire incubation duration was 4 d and 12 h.”
+
+“The body length of O. dioica was 145 ± 17 μm on average after 15 h of metamorphosis.”  “ On average, body lengths of 324–549 μm were achieved at the end of the experiments.”  “At each food level, both the final body and gonad length decreased on average with density.”
+
+“Calculated with a fixed generation duration of 4.5 d, the mean maximal intrinsic rate of natural increase (rmax) varied between 0.25 and 0.65/d”
+
+“In general, the population growth was significantly regulated by the PFS. The rmax was increased with the PFS and was saturated at values higher than 8.1 μg C/ind.”
+
+“Though the mortality recorded in our experiments was generally higher at low food concentrations, it is uncertain whether mortality increased with increased competition stress.”
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 86c71c2c..befcf656 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -368,6 +368,8 @@ Development
    eventually pause.  Animals in GA can survive ~18 days at 15°C.  GA can also be
    induced by inhibiting the TOR pathway ([[Subramaniam, Campsteijn and Thompson,
    2014|biblio/24695788]]).
+ - Large animals (~5 mm body length) could be cultivated when provided with large
+   amounts of food ([[Li and Zhang, 2021|biblio/10.1007_s00343-020-0071-0]]).
  - Telomeres are localised at the nuclear envelope and do not overlap with nuclear
    pore complexes in early meiotic oocytes before H3S10 phosphorylation.  In nurse
    cells at a later stage of oocyte development, the telomeres localise in silent
@@ -587,6 +589,8 @@ Ecology
  - In the northern south China sea, _O. longicauda_ and _O. rufescens_ were
    reported to be more abundant than _O. dioica_ in 2006 by ([[Li and coll.,
    2012|biblio/10.1007_s13131-012-0243-7]]).
+ - _O. dioica_ captured in 2017 from Jiaozhou Bay, Qingdao, China (35°03′N, 120°20′E)
+    could be cultivated at 18 °C ([[Li and Zhang, 2021|biblio/10.1007_s00343-020-0071-0]]).
  - _O. dioica_ and _O. longicauda_ were found throurought 2006-2007 in the Yellow sea
    ([[Franco, Chen and Li, 2014|biblio/10.1007_s11802-014-2376-0]]).  Abundance peaked
    is spring, but the animals could also be found in winter when water temperature

Accession numbers, typos, ...
diff --git a/tags/Ciona.mdwn b/tags/Ciona.mdwn
index 25dd9e73..f8d5002c 100644
--- a/tags/Ciona.mdwn
+++ b/tags/Ciona.mdwn
@@ -20,7 +20,7 @@ during the Pliocene (≈ 3.8 Ma); a recent introgression then happened 15,000
 years ago ([[Roux and coll., 2013|biblio/23564941]]).
 
 The _C. intermedia_ species was described by [[Mastrototaro and coll.,
-2021|biblio/10.1093_zoolinnean_zlaa042]].  It is sister to _C. edwardsi_
+2020|biblio/10.1093_zoolinnean_zlaa042]].  It is sister to _C. edwardsi_
 but their placement regarding to _C. int_ and _robusta_ varies in
 different computations presented in that work.
 
@@ -64,8 +64,9 @@ with respcet to _C. roulei_ ([[Nydam and Harrison, 2010|biblio/20403444]]).
 
 ## Genomes
 
- - _Ciona robusta_ latest genome: version HT ([[Satou and coll.,
-   2019|biblio/31621849]]) is a reassembly of the KS genome using Hi-C and
+ - _Ciona robusta_ latest genome: version HT
+   [GCA_009617815](https://www.ncbi.nlm.nih.gov/assembly/GCA_009617815.1/)
+   ([[Satou and coll., 2019|biblio/31621849]]) is a reassembly of the KS genome using Hi-C and
    PacBio additional data, in which over 95 % of the dequences is included in
    chromosomes.  Out of 14 pairs of chromosomes, 10 are metacentric ([[Shoguchi
    and coll., 2005|biblio/15930823]]); the Hi-C contact map suggests that their
@@ -73,7 +74,9 @@ with respcet to _C. roulei_ ([[Nydam and Harrison, 2010|biblio/20403444]]).
    Inter-chromosomal contacts are much more rare in comparison.
 
  - _Ciona intestinalis_: chromosome-level assemblies of two individuals
-   ([[Satou and coll., 2021|biblio/]]) suggests that there are ~20 inversions
+   [GCA_018327805](https://www.ncbi.nlm.nih.gov/assembly/GCA_018327805.1)
+   [GCA_018327825](https://www.ncbi.nlm.nih.gov/assembly/GCA_018327825.1)
+   ([[Satou and coll., 2021|biblio/33822040]]) suggests that there are ~20 inversions
    (containing at least 3 genes) between the two species.  Some of them are
    not fixed.
 

Nouveau tag taxononmie
diff --git a/tags/taxonomy.mdwn b/tags/taxonomy.mdwn
index 71e4c475..8d9f3bd2 100644
--- a/tags/taxonomy.mdwn
+++ b/tags/taxonomy.mdwn
@@ -1,4 +1,7 @@
 [[!meta title="pages tagged taxonomy"]]
 
-[[!inline pages="tagged(taxonomy)" actions="no" archive="yes"
-feedshow=10]]
+_work in progress_
+
+ - _Ciona intermedia_: [[Mastrototaro and coll., 2021|biblio/10.1093_zoolinnean_zlaa042]]
+
+[[!inline pages="tagged(taxonomy)" limit=0]]

creating tag page tags/taxonomy
diff --git a/tags/taxonomy.mdwn b/tags/taxonomy.mdwn
new file mode 100644
index 00000000..71e4c475
--- /dev/null
+++ b/tags/taxonomy.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged taxonomy"]]
+
+[[!inline pages="tagged(taxonomy)" actions="no" archive="yes"
+feedshow=10]]

Ciona
diff --git a/biblio/10.1093_zoolinnean_zlaa042.mdwn b/biblio/10.1093_zoolinnean_zlaa042.mdwn
new file mode 100644
index 00000000..ef784c50
--- /dev/null
+++ b/biblio/10.1093_zoolinnean_zlaa042.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="An integrative taxonomic framework for the study of the genus Ciona (Ascidiacea) and description of a new species, Ciona intermedia"]]
+[[!tag Ciona taxonomy]]
+
+Francesco Mastrototaro, Federica Montesanto, Marika Salonna, Frédérique Viard, Giovanni Chimienti, Egidio Trainito, Carmela Gissi
+
+Zoological Journal of the Linnean Society, Volume 190, Issue 4, December 2020, Pages 1193–1216, doi:10.1093/zoolinnean/zlaa042
+
+An integrative taxonomic framework for the study of the genus _Ciona_ (Ascidiacea) and description of a new species, _Ciona intermedia_
+
+[[!doi 10.1093/zoolinnean/zlaa042 desc="“The percentage identity between _C. intermedia_ and other _Ciona_ species, including _C. roulei_ and _C. edwardsi_, is lower than 94.28% for cox1, 90.14% for x3n1 [“_cox2_ and _cob_”] and 91.89% for x2cb [ _cox3_, _trnK_, _nad1_, and two non-coding spacers].”"]]
diff --git a/tags/Ciona.mdwn b/tags/Ciona.mdwn
index 95bba46c..25dd9e73 100644
--- a/tags/Ciona.mdwn
+++ b/tags/Ciona.mdwn
@@ -19,6 +19,11 @@ The _intestinalis_ and _robusta_ speciation is estimated to have happened
 during the Pliocene (≈ 3.8 Ma); a recent introgression then happened 15,000
 years ago ([[Roux and coll., 2013|biblio/23564941]]).
 
+The _C. intermedia_ species was described by [[Mastrototaro and coll.,
+2021|biblio/10.1093_zoolinnean_zlaa042]].  It is sister to _C. edwardsi_
+but their placement regarding to _C. int_ and _robusta_ varies in
+different computations presented in that work.
+
 ## Hybridisation between species
 
 _C. intestinalis_ and _C. savignyi_ can cross-fertilise after removal of the

C. edwardsi
diff --git a/tags/Ciona.mdwn b/tags/Ciona.mdwn
index 54df4717..95bba46c 100644
--- a/tags/Ciona.mdwn
+++ b/tags/Ciona.mdwn
@@ -37,6 +37,9 @@ were F1 and of _C. int_ maternal origin.
 _C. roulei_ can cross-hybridise easily with _C. intestinalis_, suggesting
 that they are the same species ([[Malfant, Darras and Viart, 2018|biblio/29367599]]).
 
+_C. edwardsi_ is reproductively isolated from _C. intestinalis_, _robusta_ and _savignyi_
+([[Malfant, Darras and Viart, 2018|biblio/29367599]]).
+
 ## Detailed evidence for speciation
 
 Comparison of mitochnodrial CO1 sequences show that _C. intestinalis_ types A

C. Roulei
diff --git a/tags/Ciona.mdwn b/tags/Ciona.mdwn
index 86cae169..54df4717 100644
--- a/tags/Ciona.mdwn
+++ b/tags/Ciona.mdwn
@@ -21,6 +21,9 @@ years ago ([[Roux and coll., 2013|biblio/23564941]]).
 
 ## Hybridisation between species
 
+_C. intestinalis_ and _C. savignyi_ can cross-fertilise after removal of the
+vitelline enveloppe ([[Byrd and Lambert, 2000|biblio/10602281]]).
+
 _Ciona robusta_'s sperm can efficiently fertilise _C. intestinalis_ eggs, but
 the fertilisation rates are much lower in the reciprocal crosses ([[Suzuki,
 Nishikawa and Bird, 2005|biblio/16205978]], [[Caputi and coll.,
@@ -31,8 +34,8 @@ strains from Plymouth did not develop beyond cleavage ([[Caputi and coll.,
 analysis of wild animals of ([[Bouchemousse and coll., 2016|biblio/27662427]])
 were F1 and of _C. int_ maternal origin.
 
-_C. intestinalis_ and _C. savignyi_ can cross-fertilise after removal of the
-vitelline enveloppe ([[Byrd and Lambert, 2000|biblio/10602281]]).
+_C. roulei_ can cross-hybridise easily with _C. intestinalis_, suggesting
+that they are the same species ([[Malfant, Darras and Viart, 2018|biblio/29367599]]).
 
 ## Detailed evidence for speciation
 

Markdown
diff --git a/tags/Ciona.mdwn b/tags/Ciona.mdwn
index c127a741..86cae169 100644
--- a/tags/Ciona.mdwn
+++ b/tags/Ciona.mdwn
@@ -9,7 +9,7 @@
     -|
       ---- Ciona savignyi Herdman, 1882 [WoRMS ID 250292](http://www.marinespecies.org/aphia.php?p=taxdetails&id=250292)
 
-_C. savignyi is estimated to have diverged from the two others ~184 (±15) My
+_C. savignyi_ is estimated to have diverged from the two others ~184 (±15) My
 ago based on protein sequence comparisons and estimation of the acceleration of
 the molecular clock in tunicates [[Berná, Alvarez-Valin and D'Onofrio,
 2009|biblio/20052388]] or 122 ± 33 million years ago based on sequence analysis

Café
diff --git a/biblio/33822040.mdwn b/biblio/33822040.mdwn
new file mode 100644
index 00000000..55bdd55a
--- /dev/null
+++ b/biblio/33822040.mdwn
@@ -0,0 +1,20 @@
+[[!meta title="Chromosomal Inversion Polymorphisms in Two Sympatric Ascidian Lineages."]]
+[[!tag Ciona genome variants]]
+
+Satou Y, Sato A, Yasuo H, Mihirogi Y, Bishop J, Fujie M, Kawamitsu M, Hisata K, Satoh N.
+
+Genome Biol Evol. 2021 Jun 8;13(6):evab068. doi:10.1093/gbe/evab068
+
+Chromosomal Inversion Polymorphisms in Two Sympatric Ascidian Lineages.
+
+[[!pmid 33822040 desc="Chromosoma assembly of _Ciona intestinalis_ finds ~20 inversions compared to _C. robusta_.  Some inversions are heterozygous."]]
+
+“Chromosomal-level assemblies for the two type-B individuals, sampled at Roscoff (France; specimen R) and Plymouth (England; specimen P)”  “For each specimen, we built contigs from long Nanopore reads with the NECAT assembler and polished obtained contigs with Illumina reads using the Nextpolish software [and removed overlaping contigs] using the purge_dups software [...]. Both of these contig sets were 140 Mb in length (table 1).”  “Although the heterozygosity rate of type-A animals has been estimated to be 1.1–1.2% (Dehal et al. 2002; Satou et al. 2012), those of specimens R and P were 3.0% and 3.6%, respectively.”
+
+“Exons are highly conserved between type-A and type-B animals, whereas intergenic regions are highly varied between the two types.”  [Supplemental material shows 97% similarity in aligned regions between R and P and 94% similarity between R/P and A]
+
+“To identify translocations, we searched the genomic sequences for blocks containing three or more genes that were not found in the positions expected from the type-A genome. We found two small interchromosomal translocations between the genomes of specimen P and type A, [but] we did not find such translocations between the genomes of specimen R and type A.”
+
+“Similarly, to identify inversions, we searched the genomic sequences for blocks containing three or more genes that were mapped in the reverse direction to the order in the type-A genome. We found 21 and 20 inversions in the genomes of specimens R and P, respectively (supplementary fig. S7, Supplementary Material online). Among them, 15 sites were common, and the remaining 11 sites were specific to specimen R or P (supplementary fig. S10 and tables S3 and S4, Supplementary Material online). Thus, our data indicate that there are structural variations not only between type-A and type-B animals but also between specimens R and P.”
+
+“We found R-derived haplotype contigs that were structurally different from the chromosome of specimen R, but the same as both the specimen-P and the type-A chromosomes. [In “an inversion in chromosome 7 [that] contained the largest number of genes over an ∼900-kb region”] genomic PCR using four primers flanking the junctional sites demonstrated that specimen R was indeed heterozygous”  “We also confirmed experimentally an inversion on chromosome 3 [...]. A PCR analysis demonstrated that specimen P was indeed heterozygous in this region.”  “we manually inspected genomic alignments of the two type-B specimens against the type-A genome, and found nine additional inversions.”  “To understand how prevalent the inversions we found were in type-B populations, we collected eight wild specimens at Roscoff and Plymouth, RO1–RO4 and PL1–PL4, respectively, and performed genomic PCR [that demonstrated that] type-B animals indeed have inversion polymorphisms.”  “The inversions we found in the present study are relatively small (3 kb ∼ 873 kb)”  “our data highlight the likely importance of inversions in speciation of _Ciona_, an invertebrate with mating governed by interactions of aquatic gametes”.
diff --git a/tags/Ciona.mdwn b/tags/Ciona.mdwn
index 55873314..c127a741 100644
--- a/tags/Ciona.mdwn
+++ b/tags/Ciona.mdwn
@@ -1,19 +1,25 @@
 [[!meta title="pages tagged Ciona"]]
 
 
+## Phylogeny
+
         -- Ciona robusta Hoshino & Tokioka, 1967 [WoRMS ID 252565](http://www.marinespecies.org/aphia.php?p=taxdetails&id=252565)
       -|
      |  -- Ciona intestinalis Linnaeus, 1767 [WoRMS ID 103732](http://www.marinespecies.org/aphia.php?p=taxdetails&id=103732)
     -|
       ---- Ciona savignyi Herdman, 1882 [WoRMS ID 250292](http://www.marinespecies.org/aphia.php?p=taxdetails&id=250292)
 
-_C. intestinalis_ and _C. savignyi_ can cross-fertilise after removal of the
-vitelline enveloppe ([[Byrd and Lambert, 2000|biblio/10602281]]).  They are
-estimated to have diverged ~184 (±15) My ago based on protein sequence
-comparisons and estimation of the acceleration of the molecular clock in
-tunicates [[Berná, Alvarez-Valin and D'Onofrio, 2009|biblio/20052388]] or
-122 ± 33 million years ago based on sequence analysis of 258 proteins from 63
-species ([[Delsuc and coll., 2018|biblio/29653534]]).
+_C. savignyi is estimated to have diverged from the two others ~184 (±15) My
+ago based on protein sequence comparisons and estimation of the acceleration of
+the molecular clock in tunicates [[Berná, Alvarez-Valin and D'Onofrio,
+2009|biblio/20052388]] or 122 ± 33 million years ago based on sequence analysis
+of 258 proteins from 63 species ([[Delsuc and coll., 2018|biblio/29653534]]).
+
+The _intestinalis_ and _robusta_ speciation is estimated to have happened
+during the Pliocene (≈ 3.8 Ma); a recent introgression then happened 15,000
+years ago ([[Roux and coll., 2013|biblio/23564941]]).
+
+## Hybridisation between species
 
 _Ciona robusta_'s sperm can efficiently fertilise _C. intestinalis_ eggs, but
 the fertilisation rates are much lower in the reciprocal crosses ([[Suzuki,
@@ -25,6 +31,11 @@ strains from Plymouth did not develop beyond cleavage ([[Caputi and coll.,
 analysis of wild animals of ([[Bouchemousse and coll., 2016|biblio/27662427]])
 were F1 and of _C. int_ maternal origin.
 
+_C. intestinalis_ and _C. savignyi_ can cross-fertilise after removal of the
+vitelline enveloppe ([[Byrd and Lambert, 2000|biblio/10602281]]).
+
+## Detailed evidence for speciation
+
 Comparison of mitochnodrial CO1 sequences show that _C. intestinalis_ types A
 and B (now renamed _robusta_ and _intestinalis sensu_) are as distant as
 distinct species ([[Nydam and Harrison,
@@ -35,22 +46,29 @@ coll|biblio/10.1111_jzs.12101]] proposed the presence of “tubercular
 prominences” in the tunic as a more accurate morphological marker.
 Mitochondrial gene order differ between the two species ([[Ianelli and coll.,
 2007|biblio/17640763]]).  Sequencing of nuclear genes showed intragenic
-recombination in _C. robusta_ and _C. intestinalis_, buy supported monophyly of
+recombination in _C. robusta_ and _C. intestinalis_, but supported monophyly of
 these two species.  Both data also supported paraphyly of _C. intestinalis_
 with respcet to _C. roulei_ ([[Nydam and Harrison, 2010|biblio/20403444]]).
-Speciation is estimated to have happened during the Pliocene (≈ 3.8 Ma); a
-recent introgression then happened 15,000 years ago ([[Roux and coll.,
-2013|biblio/23564941]]).
-
-Latest _Ciona robusta_ genome: version HT ([[Satou and coll.,
-2019|biblio/31621849]]) is a reassembly of the KS genome using Hi-C and PacBio
-additional data, in which over 95 % of the dequences is included in
-chromosomes.  Out of 14 pairs of chromosomes, 10 are metacentric ([[Shoguchi
-and coll., 2005|biblio/15930823]]); the Hi-C contact map suggests that their
-arms interact with each other almost as much as with themselves.
-Inter-chromosomal contacts are much more rare in comparison.
-
-Mitochondrial gene order differs even within the _Ciona_ genus ([[Gissi,
-Iannelli and Pesole 2004|biblio/15114417]]).
+
+
+## Genomes
+
+ - _Ciona robusta_ latest genome: version HT ([[Satou and coll.,
+   2019|biblio/31621849]]) is a reassembly of the KS genome using Hi-C and
+   PacBio additional data, in which over 95 % of the dequences is included in
+   chromosomes.  Out of 14 pairs of chromosomes, 10 are metacentric ([[Shoguchi
+   and coll., 2005|biblio/15930823]]); the Hi-C contact map suggests that their
+   arms interact with each other almost as much as with themselves.
+   Inter-chromosomal contacts are much more rare in comparison.
+
+ - _Ciona intestinalis_: chromosome-level assemblies of two individuals
+   ([[Satou and coll., 2021|biblio/]]) suggests that there are ~20 inversions
+   (containing at least 3 genes) between the two species.  Some of them are
+   not fixed.
+
+ - _Ciona savignyi_: [paper to read]
+
+ - Mitochondrial gene order differs even within the _Ciona_ genus ([[Gissi,
+   Iannelli and Pesole 2004|biblio/15114417]]).
 
 [[!inline pages="tagged(Ciona)" actions="no" limit=0]]

normalise
diff --git a/biblio/25801028.mdwn b/biblio/25801028.mdwn
index e0b046ef..e8ecfe78 100644
--- a/biblio/25801028.mdwn
+++ b/biblio/25801028.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="The 3D organization of chromatin explains evolutionary fragile genomic regions."]]
-[[!tag chromosome breakpoint synteny]]
+[[!tag chromosome synteny]]
 
 Berthelot C, Muffato M, Abecassis J, Roest Crollius H.
 
diff --git a/tags/breakpoint.mdwn b/tags/breakpoint.mdwn
deleted file mode 100644
index 8c230a4f..00000000
--- a/tags/breakpoint.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged breakpoint"]]
-
-[[!inline pages="tagged(breakpoint)" actions="no" archive="yes"
-feedshow=10]]

NanoSV
diff --git a/tags/assembly.mdwn b/tags/assembly.mdwn
index 79f5f2d7..7c18baab 100644
--- a/tags/assembly.mdwn
+++ b/tags/assembly.mdwn
@@ -84,6 +84,6 @@ BUSCO uses AUGUSTUS, and AUGUSTUS can be trained for a new species with
 transcriptome data, as explained by [[Hoff and Stanke, 2018|biblio/30466165]].
 
 A reference assembly can be used to search for structural variants in a different
-individual, for instance with NanoSV ([[Cretu and coll., 2017|biblio/29109544]]).
+individual, for instance with NanoSV ([[Cretu Stancu and coll., 2017|biblio/29109544]]).
 
 [[!inline pages="tagged(assembly)" actions="no" limit=0]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 712ec456..864be2d8 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -7,7 +7,7 @@ SVs per individual (insertios: 13,353; deletions: 9,474) [[Beyter and coll, 2021
 
 ### Software
 
- - _NanoSV_ ([[Stancu and coll., 2017|biblio/29109544]]) uses nanopore long
+ - _NanoSV_ ([[Cretu Stancu and coll., 2017|biblio/29109544]]) uses nanopore long
    reads aligned to a reference genome with last-split
 
 

NanoSV
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 6971bd68..712ec456 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -5,4 +5,10 @@ _in progress_
 Long read sequencing data from 3,622 Icelanders identified a median of 22,636
 SVs per individual (insertios: 13,353; deletions: 9,474) [[Beyter and coll, 2021|biblio/33972781]].
 
+### Software
+
+ - _NanoSV_ ([[Stancu and coll., 2017|biblio/29109544]]) uses nanopore long
+   reads aligned to a reference genome with last-split
+
+
 [[!inline pages="tagged(variants)" limit=0]]

PRDM9
diff --git a/biblio/32001511.mdwn b/biblio/32001511.mdwn
index 316b02d4..ed5b9686 100644
--- a/biblio/32001511.mdwn
+++ b/biblio/32001511.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="HELLS and PRDM9 form a pioneer complex to open chromatin at meiotic recombination hot spots."]]
-[[!tag meiosis H3K4me3 H3K4me1 H3K36me3 H3K9ac]]
+[[!tag PRDM9 meiosis H3K4me3 H3K4me1 H3K36me3 H3K9ac]]
 
 HELLS and PRDM9 form a pioneer complex to open chromatin at meiotic recombination hot spots.
 
diff --git a/tags/PRDM9.mdwn b/tags/PRDM9.mdwn
index 53dacd8c..f4844b09 100644
--- a/tags/PRDM9.mdwn
+++ b/tags/PRDM9.mdwn
@@ -1,4 +1,10 @@
 [[!meta title="pages tagged PRDM9"]]
 
-[[!inline pages="tagged(PRDM9)" actions="no" archive="yes"
-feedshow=10]]
+PRDM9 interacts with HELLS to open chromatin at hotspots
+([[Spruce and coll., 2020|biblio/32001511]]).
+
+Structural variants in the zinc fingers PRDM9 correlate with changes in the
+fraction of crossovers that occur in hotspots. [[Beyter and coll,
+2021|biblio/33972781]]
+
+[[!inline pages="tagged(PRDM9)" limit=0]]

creating tag page tags/PRDM9
diff --git a/tags/PRDM9.mdwn b/tags/PRDM9.mdwn
new file mode 100644
index 00000000..53dacd8c
--- /dev/null
+++ b/tags/PRDM9.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged PRDM9"]]
+
+[[!inline pages="tagged(PRDM9)" actions="no" archive="yes"
+feedshow=10]]

Café
diff --git a/biblio/33972781.mdwn b/biblio/33972781.mdwn
new file mode 100644
index 00000000..63d223bd
--- /dev/null
+++ b/biblio/33972781.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Long-read sequencing of 3,622 Icelanders provides insight into the role of structural variants in human diseases and other traits."]]
+[[!tag variants PRDM9]]
+
+Beyter D, Ingimundardottir H, Oddsson A, Eggertsson HP, Bjornsson E, Jonsson H, Atlason BA, Kristmundsdottir S, Mehringer S, Hardarson MT, Gudjonsson SA, Magnusdottir DN, Jonasdottir A, Jonasdottir A, Kristjansson RP, Sverrisson ST, Holley G, Palsson G, Stefansson OA, Eyjolfsson G, Olafsson I, Sigurdardottir O, Torfason B, Masson G, Helgason A, Thorsteinsdottir U, Holm H, Gudbjartsson DF, Sulem P, Magnusson OT, Halldorsson BV, Stefansson K.
+
+Nat Genet. 2021 Jun;53(6):779-786. doi:10.1038/s41588-021-00865-4
+
+Long-read sequencing of 3,622 Icelanders provides insight into the role of structural variants in human diseases and other traits.
+
+[[!pmid 33972781 desc="”We generated [long read sequencing] data from 3,622 Icelanders and identified a median of 22,636 SVs per individual (a median of 13,353 insertions and 9,474 deletions).”  “We did not attempt to discover translocations and inversions.“  “We found more SVs, particularly TR SVs, near telomeres, a reflection of the sequence content of telomeres and the high mutation rate of TRs”  “The ZnF domain of PRDM9 is the DNA-binding domain, and the SV alleles thus introduce alterations in the DNA-binding motif of PRDM9 and consequently change the locations of meiotic recombination57,58. All the different ZnF-motif lengths showed a strong association with the location of crossovers as measured by the fraction of crossovers that occur in recombination hotspots.”"]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 86f3ec85..6971bd68 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -1,4 +1,8 @@
 [[!meta title="pages tagged variants"]]
 
-[[!inline pages="tagged(variants)" actions="no" archive="yes"
-feedshow=10]]
+_in progress_
+
+Long read sequencing data from 3,622 Icelanders identified a median of 22,636
+SVs per individual (insertios: 13,353; deletions: 9,474) [[Beyter and coll, 2021|biblio/33972781]].
+
+[[!inline pages="tagged(variants)" limit=0]]

Café
diff --git a/biblio/34107272.mdwn b/biblio/34107272.mdwn
new file mode 100644
index 00000000..f5ea2a1e
--- /dev/null
+++ b/biblio/34107272.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Nkx2-1 and FoxE regionalize glandular (mucus-producing) and thyroid-equivalent traits in the endostyle of the chordate Oikopleura dioica."]]
+[[!tag Oikopleura]]
+
+Onuma TA, Nakanishi R, Sasakura Y, Ogasawara M.
+
+Dev Biol. 2021 Jun 6:S0012-1606(21)00142-1. doi: 10.1016/j.ydbio.2021.05.021.
+
+Nkx2-1 and FoxE regionalize glandular (mucus-producing) and thyroid-equivalent traits in the endostyle of the chordate Oikopleura dioica.
+
+[[!pmid 34107272 desc="Found vWFL (von Willebrand factor-like, a single gene, whereas Ciona has two), and the thyroid-related peroxidases, TPO and Duox, and the thyroid-related TFs Nkx2-1 and FoxE.  Also reported a SCO spondin in the supplemental material.  “Nkx2-1 knockdown suppressed vWFL expression in 8 hpf larvae. In contrast, FoxE knockdown had no effect on vWFL expression.”  “Nkx2-1 knockdown decreased TPO expression in the endostyle of over 90% of larvae.”  “FoxE knockdown did not affect Duox expression.”  “Nkx2-1 knockdown caused malformation of the endostyle in 80% of the larvae. In contrast, FoxE knockdown did not affect endostyle morphology.”  “Nkx2-1 expression was decreased by Nkx2-1 knockdown, but not by FoxE knockdown. On the other hand, FoxE expression was decreased in two-thirds of the Nkx2-1 knockdown larvae as well as in FoxE knockdown larvae.”"]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index c62f3ace..86c71c2c 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -236,6 +236,8 @@ Genes and pathways
  - Metallothioneins _OdMT1_ and _OdMT2_ [[Calatayud and coll., 2018|biblio/30284576]].
  - 2 NUMB genes were found; both are closer to Vertebrate NUMB than to Vertebrate NUMB-Like
    ([[Confalonieri and coll., 2019|biblio/31451549]]).
+ - Genes related to thyroid functions (_vWFL_, _Nkx2-1_, _FoxE_, _TPO_ and _Duox_)
+   were studied by [[Onuma and coll., 2020|biblio/34107272]].
 
 ### Lost
 

Café
diff --git a/biblio/24493737.mdwn b/biblio/24493737.mdwn
new file mode 100644
index 00000000..89cc27cf
--- /dev/null
+++ b/biblio/24493737.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Improved search heuristics find 20,000 new alignments between human and mouse genomes."]]
+[[!tag LAST alignment]]
+
+Frith MC, Noé L.
+
+Nucleic Acids Res. 2014 Apr;42(7):e59. doi:10.1093/nar/gku104
+
+Improved search heuristics find 20,000 new alignments between human and mouse genomes.
+
+[[!pmid 24493737 desc="“using more codesigned seed patterns makes the alignment more sensitive but slower. The interesting point, though, is that using more seeds beats increasing the rareness threshold. For example, using four seeds with m 1⁄4 10 is both faster and more sensitive than one seed with m 1⁄4 100. The downside is that more seeds require more memory.”  “We also tried aligning 10 000 random 1-kb chunks of the _melanogaster_ genome to the _pseudoobscura_ genome. In this case, the 1:1 [transitions:transversions] seeds perform better than the 3:2 seeds, as expected.”  “Mammals have a greater excess than _Drosophila_, presumably because they have more methylcytosine, which mutates rapidly to thymine. Less-similar genomes have a lower excess of transitions: this is as expected because the transitions cannot keep increasing linearly but instead tend to an asymptote.”"]]
diff --git a/tags/LAST.mdwn b/tags/LAST.mdwn
index fc0a0dfa..49e93fcd 100644
--- a/tags/LAST.mdwn
+++ b/tags/LAST.mdwn
@@ -2,6 +2,9 @@
 
 _bibliography in progress..._
 
+ - `lastdb` can use various seeding schemes to build its index.
+    [[Frith and Noé (2014)|biblio/24493737]] discuss some of them.
+
  - `last-postmask` ([[Frith, 2011|biblio/22205972]]): discards alignments that
    contain a significant amount of lower-case-masked sequences.
 

Café
diff --git a/biblio/32808665.mdwn b/biblio/32808665.mdwn
new file mode 100644
index 00000000..56c72045
--- /dev/null
+++ b/biblio/32808665.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="A haplotype-resolved, de novo genome assembly for the wood tiger moth (Arctia plantaginis) through trio binning."]]
+[[!tag genome population haplotype]]
+
+Yen EC, McCarthy SA, Galarza JA, Generalovic TN, Pelan S, Nguyen P, Meier JI, Warren IA, Mappes J, Durbin R, Jiggins CD.
+
+Gigascience. 2020 Aug 1;9(8):giaa088. doi:10.1093/gigascience/giaa088
+
+A haplotype-resolved, de novo genome assembly for the wood tiger moth (Arctia plantaginis) through trio binning.
+
+[[!pmid 32808665 desc="“Heterozygosity of the F1 offspring was estimated to be ∼1.9%”  “the 2 scaffolded assemblies [were concatenated], mapped the 10X Illumina data [...], called variants [...], then applied homozygous non-reference edits to the assembly using bcftools consensus.”  “Assemblytics detected 32,203 SVs between the haplotype assemblies, affecting 51.6 Mb of the genome”"]]

Café
diff --git a/biblio/34041785.mdwn b/biblio/34041785.mdwn
new file mode 100644
index 00000000..a069d783
--- /dev/null
+++ b/biblio/34041785.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="The filter-house of the larvacean Oikopleura dioica. A complex extracellular architecture: from fiber production to rudimentary state to inflated house."]]
+[[!tag Oikopleura]]
+
+The filter-house of the larvacean Oikopleura dioica. A complex extracellular architecture: from fiber production to rudimentary state to inflated house.
+
+J Morphol. 2021 May 26. doi:10.1002/jmor.21382
+
+Razghandi K, Janßen NF, Le Mai-Lee V, Stach T.
+
+[[!pmid 34041785 desc="Developmental origin of the escape slot and the outlet valve."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 202f99be..c62f3ace 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -497,7 +497,8 @@ House
  - A 8th cell was seen in the Fol area at 10 hpf in the 3D tomography analysis
    of [[Nishida and coll., 2021|biblio/33649401]].  It is possible that this cell
    is lost during later development.
-
+ - Study of the _O. dioica_ house and the origin of its components on the oikoblastic
+   epithelium, using multiple microscopy techniques [[Razghandi and coll., 2020|biblio/34041785]].
 
 Phenotypes
 ----------

Café
diff --git a/biblio/20052388.mdwn b/biblio/20052388.mdwn
new file mode 100644
index 00000000..7d66f3d8
--- /dev/null
+++ b/biblio/20052388.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="How fast is the sessile ciona?"]]
+[[!tag Ciona speciation]]
+
+Berná L, Alvarez-Valin F, D'Onofrio G.
+
+Comp Funct Genomics. 2009;2009:875901. doi:10.1155/2009/875901
+
+How fast is the sessile ciona?
+
+[[!pmid 20052388 desc="“Tajima’s test results [...] for the great majority of the alignments, _Ciona_ genes evolve faster than those of all vertebrate groups[...].”  “On the average, _Ciona_ evolves 50% faster than all vertebrates, with the exception of _O. anatinus_ and _M. domestica_.”  “The divergence between _C. intestinalis_ and _C. savignyi_ was reestimated and found to took place ~184 (±15) My ago.”"]]
diff --git a/tags/Ciona.mdwn b/tags/Ciona.mdwn
index aa1838e7..55873314 100644
--- a/tags/Ciona.mdwn
+++ b/tags/Ciona.mdwn
@@ -9,8 +9,11 @@
 
 _C. intestinalis_ and _C. savignyi_ can cross-fertilise after removal of the
 vitelline enveloppe ([[Byrd and Lambert, 2000|biblio/10602281]]).  They are
-estimated to have diverged 122 ± 33 million years ago ([[Delsuc and coll.,
-2018|biblio/29653534]]).
+estimated to have diverged ~184 (±15) My ago based on protein sequence
+comparisons and estimation of the acceleration of the molecular clock in
+tunicates [[Berná, Alvarez-Valin and D'Onofrio, 2009|biblio/20052388]] or
+122 ± 33 million years ago based on sequence analysis of 258 proteins from 63
+species ([[Delsuc and coll., 2018|biblio/29653534]]).
 
 _Ciona robusta_'s sperm can efficiently fertilise _C. intestinalis_ eggs, but
 the fertilisation rates are much lower in the reciprocal crosses ([[Suzuki,
diff --git a/tags/speciation.mdwn b/tags/speciation.mdwn
index 240b8e82..8c73eea3 100644
--- a/tags/speciation.mdwn
+++ b/tags/speciation.mdwn
@@ -1,4 +1,3 @@
 [[!meta title="pages tagged speciation"]]
 
-[[!inline pages="tagged(speciation)" actions="no" archive="yes"
-feedshow=10]]
+[[!inline pages="tagged(speciation)" limit=0]]

Café
diff --git a/biblio/33927397.mdwn b/biblio/33927397.mdwn
new file mode 100644
index 00000000..64f7b09f
--- /dev/null
+++ b/biblio/33927397.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Transcription-dependent domain-scale three-dimensional genome organization in the dinoflagellate Breviolum minutum."]]
+[[!tag chromosome epigenetic genome transcription]]
+
+Transcription-dependent domain-scale three-dimensional genome organization in the dinoflagellate Breviolum minutum.
+
+Marinov GK, Trevino AE, Xiang T, Kundaje A, Grossman AR, Greenleaf WJ.
+
+Nat Genet. 2021 May;53(5):613-617. doi: 10.1038/s41588-021-00848-5.
+
+[[!pmid 33927397 desc="“each dinoTAD corresponded to a pair of divergent gene arrays”  “α-amanitin treatment resulted in a dose-dependent, progressive dinoTAD decompaction”"]]

Add missing piece
diff --git "a/Debian/debi\303\242neries/r-4.1.en.po" "b/Debian/debi\303\242neries/r-4.1.en.po"
index 726ef3f0..441cd445 100644
--- "a/Debian/debi\303\242neries/r-4.1.en.po"
+++ "b/Debian/debi\303\242neries/r-4.1.en.po"
@@ -7,7 +7,7 @@ msgid ""
 msgstr ""
 "Project-Id-Version: \n"
 "POT-Creation-Date: 2021-05-24 02:21+0000\n"
-"PO-Revision-Date: 2021-05-24 11:24+0900\n"
+"PO-Revision-Date: 2021-05-24 11:26+0900\n"
 "Language: en\n"
 "MIME-Version: 1.0\n"
 "Content-Type: text/plain; charset=UTF-8\n"
@@ -83,6 +83,13 @@ msgstr ""
 "        users=  # Here put your username\n"
 "        root-groups=root\n"
 "        profile=desktop\n"
+"        personality=linux\n"
+"        preserve-environment=true\n"
+"    sudo schroot -c r-4.1\n"
+"    vi /etc/apt/sources.list # To add the experimental distribution\n"
+"    apt update\n"
+"    apt install sudo vim wget\n"
+"    exit\n"
 
 #. type: Plain text
 msgid "Installation de R:"

R 4.1
diff --git "a/Debian/debi\303\242neries/r-4.1.en.po" "b/Debian/debi\303\242neries/r-4.1.en.po"
index 7f6c9160..726ef3f0 100644
--- "a/Debian/debi\303\242neries/r-4.1.en.po"
+++ "b/Debian/debi\303\242neries/r-4.1.en.po"
@@ -3,51 +3,54 @@
 # This file is distributed under the same license as the PACKAGE package.
 # FIRST AUTHOR <EMAIL@ADDRESS>, YEAR.
 #
-#, fuzzy
 msgid ""
 msgstr ""
-"Project-Id-Version: PACKAGE VERSION\n"
+"Project-Id-Version: \n"
 "POT-Creation-Date: 2021-05-24 02:21+0000\n"
-"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
-"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
-"Language-Team: LANGUAGE <LL@li.org>\n"
-"Language: \n"
+"PO-Revision-Date: 2021-05-24 11:24+0900\n"
+"Language: en\n"
 "MIME-Version: 1.0\n"
 "Content-Type: text/plain; charset=UTF-8\n"
 "Content-Transfer-Encoding: 8bit\n"
+"Last-Translator: \n"
+"Language-Team: \n"
+"X-Generator: Poedit 2.2.1\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!meta date=\"Mon, 24 May 2021 10:22:43 +0900\"]]\n"
-msgstr ""
+msgstr "[[!meta date=\"Mon, 24 May 2021 10:22:43 +0900\"]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!meta updated=\"Mon, 24 May 2021 10:22:43 +0900\"]]\n"
-msgstr ""
+msgstr "[[!meta updated=\"Mon, 24 May 2021 10:22:43 +0900\"]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!tag Debian]]\n"
-msgstr ""
+msgstr "[[!tag Debian]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!meta title=\"J'essaye R 4.1\"]]\n"
-msgstr ""
+msgstr "[[!meta title=\"Trying R 4.1\"]]\n"
 
 #. type: Plain text
 msgid ""
-"J'essaye [R "
-"4.1](https://stat.ethz.ch/pipermail/r-devel/2021-May/080724.html)  dans un "
-"conteneur [schroot](https://manpages.debian.org/schroot) _experimental_ en "
-"attendant la publication de _Bullseye_ qui permettra la migration dans _Sid_ "
-"et la recompilation des paquets R que nous fournissions."
+"J'essaye [R 4.1](https://stat.ethz.ch/pipermail/r-devel/2021-May/080724."
+"html)  dans un conteneur [schroot](https://manpages.debian.org/schroot) "
+"_experimental_ en attendant la publication de _Bullseye_ qui permettra la "
+"migration dans _Sid_ et la recompilation des paquets R que nous fournissions."
 msgstr ""
+"I am trying [R 4.1](https://stat.ethz.ch/pipermail/r-devel/2021-May/080724."
+"html) in a [schroot](https://manpages.debian.org/schroot) _experimental_ "
+"container, while waiting that _Bullseye_'s release will allow the package to "
+"be uploaded to _Sid_ and the needed dependencies to be recompiled."
 
 #. type: Plain text
 msgid "Le _schroot_:"
-msgstr ""
+msgstr "The _schroot_:"
 
 #. type: Plain text
 #, no-wrap
@@ -70,30 +73,45 @@ msgid ""
 "    apt install sudo vim wget\n"
 "    exit\n"
 msgstr ""
+"    sudo debootstrap sid /srv/chroot/r-4.1 http://deb.debian.org/debian\n"
+"    sudo vi /etc/schroot/chroot.d/r-4.1\n"
+"    # Edit it to have something like\n"
+"        [r-4.1]\n"
+"        description=R 4.1 (experimental)\n"
+"        type=directory\n"
+"        directory=/srv/chroot/r-4.1\n"
+"        users=  # Here put your username\n"
+"        root-groups=root\n"
+"        profile=desktop\n"
 
 #. type: Plain text
 msgid "Installation de R:"
-msgstr ""
+msgstr "Installation of R:"
 
 #. type: Plain text
 #, no-wrap
 msgid ""
 "    schroot -c r-4.1\n"
 "    sudo apt install r-base/experimental -texperimental\n"
-"    sudo apt install -texperimental pandoc libxml2-dev libcurl4-openssl-dev "
-"git libssl-dev texlive\n"
+"    sudo apt install -texperimental pandoc libxml2-dev libcurl4-openssl-dev git libssl-dev texlive\n"
 msgstr ""
+"    schroot -c r-4.1\n"
+"    sudo apt install r-base/experimental -texperimental\n"
+"    sudo apt install -texperimental pandoc libxml2-dev libcurl4-openssl-dev git libssl-dev texlive\n"
 
 #. type: Plain text
 msgid "Et de Rstudio (il faut la version _preview_)"
-msgstr ""
+msgstr "And RStudio (_preview_ version needed)"
 
 #. type: Plain text
 #, no-wrap
 msgid ""
-"    wget "
-"https://s3.amazonaws.com/rstudio-ide-build/desktop/bionic/amd64/rstudio-1.4.1714-amd64.deb\n"
+"    wget https://s3.amazonaws.com/rstudio-ide-build/desktop/bionic/amd64/rstudio-1.4.1714-amd64.deb\n"
 "    sudo apt install libnss3 libasound2\n"
 "    sudo dpkg -i rstudio-1.4.1714-amd64.deb \n"
 "    sudo apt -f install -texperimental\n"
 msgstr ""
+"    wget https://s3.amazonaws.com/rstudio-ide-build/desktop/bionic/amd64/rstudio-1.4.1714-amd64.deb\n"
+"    sudo apt install libnss3 libasound2\n"
+"    sudo dpkg -i rstudio-1.4.1714-amd64.deb \n"
+"    sudo apt -f install -texperimental\n"

updated PO files
diff --git "a/Debian/debi\303\242neries/r-4.1.en.po" "b/Debian/debi\303\242neries/r-4.1.en.po"
new file mode 100644
index 00000000..7f6c9160
--- /dev/null
+++ "b/Debian/debi\303\242neries/r-4.1.en.po"
@@ -0,0 +1,99 @@
+# SOME DESCRIPTIVE TITLE
+# Copyright (C) YEAR Free Software Foundation, Inc.
+# This file is distributed under the same license as the PACKAGE package.
+# FIRST AUTHOR <EMAIL@ADDRESS>, YEAR.
+#
+#, fuzzy
+msgid ""
+msgstr ""
+"Project-Id-Version: PACKAGE VERSION\n"
+"POT-Creation-Date: 2021-05-24 02:21+0000\n"
+"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
+"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
+"Language-Team: LANGUAGE <LL@li.org>\n"
+"Language: \n"
+"MIME-Version: 1.0\n"
+"Content-Type: text/plain; charset=UTF-8\n"
+"Content-Transfer-Encoding: 8bit\n"
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!meta date=\"Mon, 24 May 2021 10:22:43 +0900\"]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!meta updated=\"Mon, 24 May 2021 10:22:43 +0900\"]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!tag Debian]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!meta title=\"J'essaye R 4.1\"]]\n"
+msgstr ""
+
+#. type: Plain text
+msgid ""
+"J'essaye [R "
+"4.1](https://stat.ethz.ch/pipermail/r-devel/2021-May/080724.html)  dans un "
+"conteneur [schroot](https://manpages.debian.org/schroot) _experimental_ en "
+"attendant la publication de _Bullseye_ qui permettra la migration dans _Sid_ "
+"et la recompilation des paquets R que nous fournissions."
+msgstr ""
+
+#. type: Plain text
+msgid "Le _schroot_:"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid ""
+"    sudo debootstrap sid /srv/chroot/r-4.1 http://deb.debian.org/debian\n"
+"    sudo vi /etc/schroot/chroot.d/r-4.1\n"
+"    # Edit it to have something like\n"
+"        [r-4.1]\n"
+"        description=R 4.1 (experimental)\n"
+"        type=directory\n"
+"        directory=/srv/chroot/r-4.1\n"
+"        users=  # Here put your username\n"
+"        root-groups=root\n"
+"        profile=desktop\n"
+"        personality=linux\n"
+"        preserve-environment=true\n"
+"    sudo schroot -c r-4.1\n"
+"    vi /etc/apt/sources.list # To add the experimental distribution\n"
+"    apt update\n"
+"    apt install sudo vim wget\n"
+"    exit\n"
+msgstr ""
+
+#. type: Plain text
+msgid "Installation de R:"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid ""
+"    schroot -c r-4.1\n"
+"    sudo apt install r-base/experimental -texperimental\n"
+"    sudo apt install -texperimental pandoc libxml2-dev libcurl4-openssl-dev "
+"git libssl-dev texlive\n"
+msgstr ""
+
+#. type: Plain text
+msgid "Et de Rstudio (il faut la version _preview_)"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid ""
+"    wget "
+"https://s3.amazonaws.com/rstudio-ide-build/desktop/bionic/amd64/rstudio-1.4.1714-amd64.deb\n"
+"    sudo apt install libnss3 libasound2\n"
+"    sudo dpkg -i rstudio-1.4.1714-amd64.deb \n"
+"    sudo apt -f install -texperimental\n"
+msgstr ""

R 4.1
diff --git "a/Debian/debi\303\242neries/r-4.1.mdwn" "b/Debian/debi\303\242neries/r-4.1.mdwn"
new file mode 100644
index 00000000..8c06e251
--- /dev/null
+++ "b/Debian/debi\303\242neries/r-4.1.mdwn"
@@ -0,0 +1,43 @@
+[[!meta date="Mon, 24 May 2021 10:22:43 +0900"]]
+[[!meta updated="Mon, 24 May 2021 10:22:43 +0900"]]
+[[!tag Debian]]
+
+[[!meta title="J'essaye R 4.1"]]
+
+J'essaye [R 4.1](https://stat.ethz.ch/pipermail/r-devel/2021-May/080724.html)
+dans un conteneur [schroot](https://manpages.debian.org/schroot) _experimental_
+en attendant la publication de _Bullseye_ qui permettra la migration dans _Sid_
+et la recompilation des paquets R que nous fournissions.
+
+Le _schroot_:
+
+    sudo debootstrap sid /srv/chroot/r-4.1 http://deb.debian.org/debian
+    sudo vi /etc/schroot/chroot.d/r-4.1
+    # Edit it to have something like
+        [r-4.1]
+        description=R 4.1 (experimental)
+        type=directory
+        directory=/srv/chroot/r-4.1
+        users=  # Here put your username
+        root-groups=root
+        profile=desktop
+        personality=linux
+        preserve-environment=true
+    sudo schroot -c r-4.1
+    vi /etc/apt/sources.list # To add the experimental distribution
+    apt update
+    apt install sudo vim wget
+    exit
+
+Installation de R:
+
+    schroot -c r-4.1
+    sudo apt install r-base/experimental -texperimental
+    sudo apt install -texperimental pandoc libxml2-dev libcurl4-openssl-dev git libssl-dev texlive
+ 
+Et de Rstudio (il faut la version _preview_)
+
+    wget https://s3.amazonaws.com/rstudio-ide-build/desktop/bionic/amd64/rstudio-1.4.1714-amd64.deb
+    sudo apt install libnss3 libasound2
+    sudo dpkg -i rstudio-1.4.1714-amd64.deb 
+    sudo apt -f install -texperimental

Café
diff --git a/biblio/33927399.mdwn b/biblio/33927399.mdwn
new file mode 100644
index 00000000..d22f582e
--- /dev/null
+++ b/biblio/33927399.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Genetic and spatial organization of the unusual chromosomes of the dinoflagellate Symbiodinium microadriaticum."]]
+[[!tag chromosome transcription epigenetic genome]]
+
+Genetic and spatial organization of the unusual chromosomes of the dinoflagellate Symbiodinium microadriaticum.
+
+Nand A, Zhan Y, Salazar OR, Aranda M, Voolstra CR, Dekker J.
+
+Nat Genet. 2021 May;53(5):618-629. doi: 10.1038/s41588-021-00841-y
+
+[[!pmid 33927399 desc="“We find two chromosome-scale patterns of GC content fluctuations: (1) GC content increases towards the ends of the chromosomes and (2) GC content dips to form small local minima at Hi-C domain boundaries.”  “most domain boundaries observed by Hi-C are located at positions where transcription of blocks of unidirectional genes converges.”  “chromatin conformation is sensitive to treatment of cells with triptolide and DRB.”"]]

Café
diff --git a/biblio/32873878.mdwn b/biblio/32873878.mdwn
new file mode 100644
index 00000000..7f8c0a0e
--- /dev/null
+++ b/biblio/32873878.mdwn
@@ -0,0 +1,12 @@
+[[!meta title="Analysis of muntjac deer genome and chromatin architecture reveals rapid karyotype evolution."]]
+[[!tag genome synteny chromosome epigenetic evolution]]
+
+Mudd AB, Bredeson JV, Baum R, Hockemeyer D, Rokhsar DS
+
+Commun Biol. 2020 Sep 1;3(1):480. doi:10.1038/s42003-020-1096-9
+
+Analysis of muntjac deer genome and chromatin architecture reveals rapid karyotype evolution.
+
+[[!pmid 32873878 desc="“Comparative Hi-C analysis showed that the chromosome fusions on the M. muntjak lineage altered long-range, three-dimensional chromosome organization relative to M. reevesi in interphase nuclei including A/B compartment structure. This reshaping of multi-megabase contacts occurred without notable change in local chromatin compaction, even near fusion sites.”"]]
+
+“During the ~4.9 million years since the divergence of M. muntjak and M. reevesi, the M. muntjak lineage experienced 26 fusions for a rate of ~5.3 changes per million years.”  “M. muntjak and M. reevesi [...] genomes are locally very similar, with 98.5% identity in aligned regions and a nucleotide divergence of 0.0130 substitutions per site, based on fourfold degenerate positions.”  “The pairwise alignment of the muntjac genomes contains 2.45 Gb of contig sequence [...] average sequence identity of 98.5%, excluding indels [...] In comparison, alignments of red deer, reindeer, and muntjacs to B. taurus contain 1.80–2.21 Gb of contig sequences with 92.7–93.2% average identity.”  “The nucleotide and temporal divergence between the two muntjac species is comparable to the divergence between humans and chimpanzees. The observed chromosome dynamism in muntjacs, however, far exceeds the rate in the chimpanzee and human lineages”  “we noted the maintenance of distinct Hi-C boundaries in several examples, such as the junction between the X and autosomal segments on MMU3_X circa 133 Mb. Other fusion sites, however, show no notable difference compared with the rest of the genome in M. muntjak. As expected, M. reevesi shows a clear distinction between intra- and inter-chromosome contacts, including across fusion sites in M. muntjak.”
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index ead25ecd..f915e414 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -27,6 +27,11 @@ of 90 rearrangements per MY (_mel_ / _simulans_) and 226–354 per MY (_sim_ / _
 In insects, the Osiris gene family shows conservation of synteny over ~400
 million years ([[Sah and coll., 2012|biblio/22384409]]).
 
+The indian munjac has only 3 chromosomes, which are the result of fusions in
+the past ~5 My.  The chinese munjak has undergone much less fusions.  In most
+cases, long-range chromosome structure (Hi-C) is not conserved between theses
+two species [[Mudd and coll, 2020|biblio/32873878]].
+
 ### Ancestral karyotpyes
 
  - The ancestral mammalian genome has 30 chromosomes ([[Zhou and coll., 2021|biblio/33408411]]).

Café
diff --git a/biblio/10.1007_s00227-021-03887-y.mdwn b/biblio/10.1007_s00227-021-03887-y.mdwn
new file mode 100644
index 00000000..6fbcb49e
--- /dev/null
+++ b/biblio/10.1007_s00227-021-03887-y.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Toward a global reference database of COI barcodes for marine zooplankton."]]
+[[!tag review eDNA]]
+
+Ann Bucklin, Katja T. C. A. Peijnenburg, Ksenia N. Kosobokova, Todd D. O’Brien, Leocadio Blanco-Bercial, Astrid Cornils, Tone Falkenhaug, Russell R. Hopcroft, Aino Hosia, Silke Laakmann, Chaolun Li, Luis Martell, Jennifer M. Questel, Deborah Wall-Palmer, Minxiao Wang, Peter H. Wiebe & Agata Weydmann-Zwolicka
+
+Mar Biol 168, 78 (2021). doi:10.1007/s00227-021-03887-y
+
+Toward a global reference database of COI barcodes for marine zooplankton.
+
+[[!doi 10.1007/s00227-021-03887-y desc="MetaZooGene Barcode Atlas and Database (MZGdb).  Database built on top of BOLD and GenBank.  It includes species from which COI data is not yet available."]]

creating tag page tags/parasite
diff --git a/tags/parasite.mdwn b/tags/parasite.mdwn
new file mode 100644
index 00000000..78a15747
--- /dev/null
+++ b/tags/parasite.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged parasite"]]
+
+[[!inline pages="tagged(parasite)" actions="no" archive="yes"
+feedshow=10]]

Cognac
diff --git a/biblio/29109705.mdwn b/biblio/29109705.mdwn
new file mode 100644
index 00000000..6e1ef48e
--- /dev/null
+++ b/biblio/29109705.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Complete Genome Sequence of Vibrio campbellii LMB 29 Isolated from Red Drum with Four Native Megaplasmids."]]
+[[!tag parasite bacteria]]
+
+Liu J, Zhao Z, Deng Y, Shi Y, Liu Y, Wu C, Luo P, Hu C.
+
+Front Microbiol. 2017 Oct 23;8:2035. doi: 10.3389/fmicb.2017.02035. 
+
+Complete Genome Sequence of Vibrio campbellii LMB 29 Isolated from Red Drum with Four Native Megaplasmids.
+
+[[!pmid 29109705 desc="The rifampicin ADP ribosyltransferase, arr-9 gene was found in a plasmid."]]

Café
diff --git a/biblio/33899125.mdwn b/biblio/33899125.mdwn
new file mode 100644
index 00000000..d235c3c5
--- /dev/null
+++ b/biblio/33899125.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Establishing Sustainable Cell Lines of a Coral, Acropora tenuis."]]
+[[!tag coral cell_culture cell_line]]
+
+Kawamura K, Nishitsuji K, Shoguchi E, Fujiwara S, Satoh N.
+
+Mar Biotechnol (NY). 2021 Apr 26. doi:10.1007/s10126-021-10031-w
+
+Establishing Sustainable Cell Lines of a Coral, Acropora tenuis.
+
+[[!pmid  33899125 desc="Dissociation with “a mixture of trypsin, EDTA, and collagenase”.  “Treatment for 1–2 h at 25–28 °C did not complete cell dissociation, but after 3–4 h, only single cells without debris were found in the culture dish.”  “[The modular protease] plasmin (2 μg/mL) was effective in maintaining dissociated cells in culture for more than 2 weeks, during which a large number of a new type of cell appeared in the culture dish.”  “Aliquots of polyclonal cell population were harvested from the primary 24-well culture plate, diluted fivefold with growth medium containing plasmin, and dispensed into 96-well plates (100 μL/well). Cells in clumps proliferated with a doubling time of 2–3 days.”"]]
diff --git a/tags/cell_line.mdwn b/tags/cell_line.mdwn
index 72dcb22b..b3df749e 100644
--- a/tags/cell_line.mdwn
+++ b/tags/cell_line.mdwn
@@ -4,5 +4,6 @@ A few notes that just scratch the surface of a vast field…
 
  - [[Echalier and Ohanessian (1969)|biblio/4976834]] reported a culture of _Drosophila_ cells that spontaneously transformed.
  - [[Schneider's (1972)|biblio/4625067]] report of the establishment of the S2 cell line.
+ - [[Kawamura and coll (2021)|biblio/33899125]] reported the use of plasmin to establish coral cell lines.
 
 [[!inline pages="tagged(cell_line)" limit=0]]

Typos
diff --git a/tags/Drosophila.mdwn b/tags/Drosophila.mdwn
index c4eb67c8..b48f6760 100644
--- a/tags/Drosophila.mdwn
+++ b/tags/Drosophila.mdwn
@@ -15,8 +15,8 @@ D. silvestris diverged 5.1 My ago.
 The ITS2 sequence of Drosophila species diverged at the speed of 1.2 % per million
 year ([[Schlötterer and coll., 1994|biblio/8015444]]).
 
-12 Drosophila genomes were sequenced and compared by the [[(Drosophila 12
-Genomes Consortium (2007)|biblio/17994087)]].
+12 Drosophila genomes were sequenced and compared by the [[Drosophila 12
+Genomes Consortium (2007)|biblio/17994087]].
 
 See also [[Muller elements|muller_element]].
 
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 116648a6..ead25ecd 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -1,6 +1,6 @@
 [[!meta title="pages tagged synteny"]]
 
-[[(Drosophila 12 Genomes Consortium (2007)|biblio/17994087)]] sequenced
+[[Drosophila 12 Genomes Consortium (2007)|biblio/17994087]] sequenced
 across the _Drosophila_ genus and showed synteny conservation ranging
 between few large blocks with many genes to many small blocks with few genes.
 

Café
diff --git a/biblio/17994087.mdwn b/biblio/17994087.mdwn
new file mode 100644
index 00000000..d7dfe06e
--- /dev/null
+++ b/biblio/17994087.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Evolution of genes and genomes on the Drosophila phylogeny."]]
+[[!tag Drosophila synteny]]
+
+Drosophila 12 Genomes Consortium, Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artieri CG, Barbash DA, Barker D, Barsanti P, Batterham P, Batzoglou S, Begun D, Bhutkar A, Blanco E, Bosak SA, Bradley RK, Brand AD, Brent MR, Brooks AN, Brown RH, Butlin RK, Caggese C, Calvi BR, Bernardo de Carvalho A, Caspi A, Castrezana S, Celniker SE, Chang JL, Chapple C, Chatterji S, Chinwalla A, Civetta A, Clifton SW, Comeron JM, Costello JC, Coyne JA, Daub J, David RG, Delcher AL, Delehaunty K, Do CB, Ebling H, Edwards K, Eickbush T, Evans JD, Filipski A, Findeiss S, Freyhult E, Fulton L, Fulton R, Garcia AC, Gardiner A, Garfield DA, Garvin BE, Gibson G, Gilbert D, Gnerre S, Godfrey J, Good R, Gotea V, Gravely B, Greenberg AJ, Griffiths-Jones S, Gross S, Guigo R, Gustafson EA, Haerty W, Hahn MW, Halligan DL, Halpern AL, Halter GM, Han MV, Heger A, Hillier L, Hinrichs AS, Holmes I, Hoskins RA, Hubisz MJ, Hultmark D, Huntley MA, Jaffe DB, Jagadeeshan S, Jeck WR, Johnson J, Jones CD, Jordan WC, Karpen GH, Kataoka E, Keightley PD, Kheradpour P, Kirkness EF, Koerich LB, Kristiansen K, Kudrna D, Kulathinal RJ, Kumar S, Kwok R, Lander E, Langley CH, Lapoint R, Lazzaro BP, Lee SJ, Levesque L, Li R, Lin CF, Lin MF, Lindblad-Toh K, Llopart A, Long M, Low L, Lozovsky E, Lu J, Luo M, Machado CA, Makalowski W, Marzo M, Matsuda M, Matzkin L, McAllister B, McBride CS, McKernan B, McKernan K, Mendez-Lago M, Minx P, Mollenhauer MU, Montooth K, Mount SM, Mu X, Myers E, Negre B, Newfeld S, Nielsen R, Noor MA, O'Grady P, Pachter L, Papaceit M, Parisi MJ, Parisi M, Parts L, Pedersen JS, Pesole G, Phillippy AM, Ponting CP, Pop M, Porcelli D, Powell JR, Prohaska S, Pruitt K, Puig M, Quesneville H, Ram KR, Rand D, Rasmussen MD, Reed LK, Reenan R, Reily A, Remington KA, Rieger TT, Ritchie MG, Robin C, Rogers YH, Rohde C, Rozas J, Rubenfield MJ, Ruiz A, Russo S, Salzberg SL, Sanchez-Gracia A, Saranga DJ, Sato H, Schaeffer SW, Schatz MC, Schlenke T, Schwartz R, Segarra C, Singh RS, Sirot L, Sirota M, Sisneros NB, Smith CD, Smith TF, Spieth J, Stage DE, Stark A, Stephan W, Strausberg RL, Strempel S, Sturgill D, Sutton G, Sutton GG, Tao W, Teichmann S, Tobari YN, Tomimura Y, Tsolas JM, Valente VL, Venter E, Venter JC, Vicario S, Vieira FG, Vilella AJ, Villasante A, Walenz B, Wang J, Wasserman M, Watts T, Wilson D, Wilson RK, Wing RA, Wolfner MF, Wong A, Wong GK, Wu CI, Wu G, Yamamoto D, Yang HP, Yang SP, Yorke JA, Yoshida K, Zdobnov E, Zhang P, Zhang Y, Zimin AV, Baldwin J, Abdouelleil A, Abdulkadir J, Abebe A, Abera B, Abreu J, Acer SC, Aftuck L, Alexander A, An P, Anderson E, Anderson S, Arachi H, Azer M, Bachantsang P, Barry A, Bayul T, Berlin A, Bessette D, Bloom T, Blye J, Boguslavskiy L, Bonnet C, Boukhgalter B, Bourzgui I, Brown A, Cahill P, Channer S, Cheshatsang Y, Chuda L, Citroen M, Collymore A, Cooke P, Costello M, D'Aco K, Daza R, De Haan G, DeGray S, DeMaso C, Dhargay N, Dooley K, Dooley E, Doricent M, Dorje P, Dorjee K, Dupes A, Elong R, Falk J, Farina A, Faro S, Ferguson D, Fisher S, Foley CD, Franke A, Friedrich D, Gadbois L, Gearin G, Gearin CR, Giannoukos G, Goode T, Graham J, Grandbois E, Grewal S, Gyaltsen K, Hafez N, Hagos B, Hall J, Henson C, Hollinger A, Honan T, Huard MD, Hughes L, Hurhula B, Husby ME, Kamat A, Kanga B, Kashin S, Khazanovich D, Kisner P, Lance K, Lara M, Lee W, Lennon N, Letendre F, LeVine R, Lipovsky A, Liu X, Liu J, Liu S, Lokyitsang T, Lokyitsang Y, Lubonja R, Lui A, MacDonald P, Magnisalis V, Maru K, Matthews C, McCusker W, McDonough S, Mehta T, Meldrim J, Meneus L, Mihai O, Mihalev A, Mihova T, Mittelman R, Mlenga V, Montmayeur A, Mulrain L, Navidi A, Naylor J, Negash T, Nguyen T, Nguyen N, Nicol R, Norbu C, Norbu N, Novod N, O'Neill B, Osman S, Markiewicz E, Oyono OL, Patti C, Phunkhang P, Pierre F, Priest M, Raghuraman S, Rege F, Reyes R, Rise C, Rogov P, Ross K, Ryan E, Settipalli S, Shea T, Sherpa N, Shi L, Shih D, Sparrow T, Spaulding J, Stalker J, Stange-Thomann N, Stavropoulos S, Stone C, Strader C, Tesfaye S, Thomson T, Thoulutsang Y, Thoulutsang D, Topham K, Topping I, Tsamla T, Vassiliev H, Vo A, Wangchuk T, Wangdi T, Weiand M, Wilkinson J, Wilson A, Yadav S, Young G, Yu Q, Zembek L, Zhong D, Zimmer A, Zwirko Z, Jaffe DB, Alvarez P, Brockman W, Butler J, Chin C, Gnerre S, Grabherr M, Kleber M, Mauceli E, MacCallum I.
+
+Nature. 2007 Nov 8;450(7167):203-18. doi:10.1038/nature06341
+
+Evolution of genes and genomes on the Drosophila phylogeny.
+
+[[!pmid 17994087 desc="The result of pairwise comparisons between the species ranges between a few tens or hundreds of synteny blocks of up to ~1000 genes, to ~1000 synteny blocks with a few (tens of) genes."]]
diff --git a/tags/Drosophila.mdwn b/tags/Drosophila.mdwn
index 68c6d5e5..c4eb67c8 100644
--- a/tags/Drosophila.mdwn
+++ b/tags/Drosophila.mdwn
@@ -15,6 +15,9 @@ D. silvestris diverged 5.1 My ago.
 The ITS2 sequence of Drosophila species diverged at the speed of 1.2 % per million
 year ([[Schlötterer and coll., 1994|biblio/8015444]]).
 
+12 Drosophila genomes were sequenced and compared by the [[(Drosophila 12
+Genomes Consortium (2007)|biblio/17994087)]].
+
 See also [[Muller elements|muller_element]].
 
 [[!inline pages="tagged(Drosophila)" limit=0]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 0a15e461..116648a6 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -1,5 +1,9 @@
 [[!meta title="pages tagged synteny"]]
 
+[[(Drosophila 12 Genomes Consortium (2007)|biblio/17994087)]] sequenced
+across the _Drosophila_ genus and showed synteny conservation ranging
+between few large blocks with many genes to many small blocks with few genes.
+
 [[Carbone and coll. (2014)|biblio/25209798]] found 96 gibbon–human synteny
 breakpoints (~30 per Gb), associated with segmental duplication or Alu element
 enrichment.  They often bore signatures of non-homology based mechanisms, and

Parasites.
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 7d43fee1..202f99be 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -30,7 +30,8 @@ Some links:
    <https://fantom.gsc.riken.jp/zenbu/gLyphs/#config=0tPT7vwSO1Vm5QV9iKqfAC>.
 
 Parasites: _Oodinium pouchetii_, microsporidia (on _O. gracilis_ ([[Savelieva
-2019|biblio/10.1134_S1063074019020111]])) and others.
+2019|biblio/10.1134_S1063074019020111]])), bacteria ([[Flood,
+1991|biblio/24817302]]), and others.
 
 
 Phylogeny