Dernières modifications :

vanadium
diff --git a/biblio/10.2108_zsj.13.489.mdwn b/biblio/10.2108_zsj.13.489.mdwn
new file mode 100644
index 00000000..5deb9077
--- /dev/null
+++ b/biblio/10.2108_zsj.13.489.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="The Mechanism of Accumulation of Vanadium by Ascidians: Some Progress towards an Understanding of this Unusual Phenomenon"]]
+[[!tag vanadium Ciona]]
+
+Hitoshi Michibata
+
+Zoological Science, 13(4), 489-502, (1 August 1996) doi:10.2108/zsj.13.489
+
+The Mechanism of Accumulation of Vanadium by Ascidians: Some Progress towards an Understanding of this Unusual Phenomenon
+
+[[!doi 10.2108/zsj.13.489 desc="Vanadium detected by neutron activation that causes γ-ray emission at 1,434 keV.  Blood cells of _Ascidia gemmata_ contained ~350 mM ov vanadium.  Other Phlebobranchia contained 20–60 mM, but _C. intestinalis_ contained only 0.6.  Stolidobranchia contained much lower amounts.  Vanadium-containing cells (vanadocytes) were identified as signet cells.  Sulfonic acid might be the counter ion.  Vanadocyte pH is very low (1.9–4.2).  There exist other low-pH cells that do not contain vanadium.  Accumulation of vanadium may involve a mechanism using a vacuolar-type H+-ATPase.  Vanadium contents of the embryo are low but increase during embryogenesis."]]
diff --git a/tags/Ciona.mdwn b/tags/Ciona.mdwn
index 2ac8eea9..9ac123bc 100644
--- a/tags/Ciona.mdwn
+++ b/tags/Ciona.mdwn
@@ -97,4 +97,9 @@ with respcet to _C. roulei_ ([[Nydam and Harrison, 2010|biblio/20403444]]).
  - Mitochondrial gene order differs even within the _Ciona_ genus ([[Gissi,
    Iannelli and Pesole 2004|biblio/15114417]]).
 
+## Other
+
+Blood cells of _C intestinalis_ (_robusta_?) contain vanadium ([[Michibata,
+1996|biblio/10.2108_zsj.13.489]]).
+
 [[!inline pages="tagged(Ciona)" actions="no" limit=0]]

ITSx
diff --git a/biblio/10.1111_2041-210X.12073.mdwn b/biblio/10.1111_2041-210X.12073.mdwn
index 9edb8cd1..3109ba43 100644
--- a/biblio/10.1111_2041-210X.12073.mdwn
+++ b/biblio/10.1111_2041-210X.12073.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Improved software detection and extraction of ITS1 and ITS2 from ribosomal ITS sequences of fungi and other eukaryotes for analysis of environmental sequencing data."]]
-[[!tag ribosome]]
+[[!tag software ribosome]]
 
 Bengtsson-Palme, J., Ryberg, M., Hartmann, M., Branco, S., Wang, Z., Godhe, A., De Wit, P., Sánchez-García, M., Ebersberger, I., de Sousa, F., Amend, A., Jumpponen, A., Unterseher, M., Kristiansson, E., Abarenkov, K., Bertrand, Y.J.K., Sanli, K., Eriksson, K.M., Vik, U., Veldre, V. and Nilsson, R.H.
 

ITSx
diff --git a/tags/ribosome.mdwn b/tags/ribosome.mdwn
index c0abef21..0a40a88c 100644
--- a/tags/ribosome.mdwn
+++ b/tags/ribosome.mdwn
@@ -1,4 +1,10 @@
 [[!meta title="pages tagged ribosome"]]
 
-[[!inline pages="tagged(ribosome)" actions="no" archive="yes"
-feedshow=10]]
+_in progress_
+
+The [ITSx](https://microbiology.se/software/itsx/) software detects ITS
+sequences from larger rDNA fragments by matching HMMS representing the tail of
+the 18S, the whole 5.8S and the head of the 28S
+([[|biblio/10.1111_2041-210X.12073]]).
+
+[[!inline pages="tagged(ribosome)" limit=0]]

À la maison
diff --git a/biblio/10.1111_2041-210X.12073.mdwn b/biblio/10.1111_2041-210X.12073.mdwn
new file mode 100644
index 00000000..9edb8cd1
--- /dev/null
+++ b/biblio/10.1111_2041-210X.12073.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Improved software detection and extraction of ITS1 and ITS2 from ribosomal ITS sequences of fungi and other eukaryotes for analysis of environmental sequencing data."]]
+[[!tag ribosome]]
+
+Bengtsson-Palme, J., Ryberg, M., Hartmann, M., Branco, S., Wang, Z., Godhe, A., De Wit, P., Sánchez-García, M., Ebersberger, I., de Sousa, F., Amend, A., Jumpponen, A., Unterseher, M., Kristiansson, E., Abarenkov, K., Bertrand, Y.J.K., Sanli, K., Eriksson, K.M., Vik, U., Veldre, V. and Nilsson, R.H.
+
+Methods Ecol Evol, 4: 914-919. 2013
+
+Improved software detection and extraction of ITS1 and ITS2 from ribosomal ITS sequences of fungi and other eukaryotes for analysis of environmental sequencing data. 
+
+[[!doi 10.1111/2041-210X.12073 desc="Fungal HMMs were computed for a 45-base-pair region of the immediate 3′ end of SSU, the 5′ and 3′ ends of 5.8S, and the 5′ end of LSU [...] The SSU is extracted as everything from the 5′ end of the query sequence to the 3′ end of SSU as indicated by the HMM match; the ITS1 is extracted 1 bp downstream from the end of SSU and 1 bp upstream of the start of 5.8S; and so on. [...] we evaluated the proportion of false positives by generating one million random sequences of 550 bp [...] Zero false-positive ‘ITS’ sequences were detected among the random sequences [...] The extractor cannot identify sequences of SSU, 5.8S or LSU shorter than c. 20 bp (25 bp for consistent performance)"]]

syntaxagain
diff --git a/biblio/10.1093_plankt_23.4.415.mdwn b/biblio/10.1093_plankt_23.4.415.mdwn
index 222b6b13..acaf83b6 100644
--- a/biblio/10.1093_plankt_23.4.415.mdwn
+++ b/biblio/10.1093_plankt_23.4.415.mdwn
@@ -7,4 +7,4 @@ Journal of Plankton Research, Volume 23, Issue 4, April 2001, Pages 415–423, d
 
 House Production by Oikopleura dioica (Tunicata, Appendicularia) Under Laboratory Conditions
 
-[[! doi:10.1093/plankt/23.4.415 desc="Generation time of Tôkyô bay's _O. dioica_: 6 days at 15°C, 4 days at 20°C and 3 days at 25°C.  Fed with _I. galbana_ and _Tetraselmis sp._  Individuals produced ~50 houses in their life.  Higher temperature increases house production (from ~0.5 / h at 15°C to ~ 0.8 / h at 25 °C.  Artificial clogging with the diatom _Ditylum_ increased house renewal.."]]
+[[!doi 10.1093/plankt/23.4.415 desc="Generation time of Tôkyô bay's _O. dioica_: 6 days at 15°C, 4 days at 20°C and 3 days at 25°C.  Fed with _I. galbana_ and _Tetraselmis sp._  Individuals produced ~50 houses in their life.  Higher temperature increases house production (from ~0.5 / h at 15°C to ~ 0.8 / h at 25 °C.  Artificial clogging with the diatom _Ditylum_ increased house renewal.."]]

Syntax
diff --git a/biblio/10.1093_plankt_23.4.415.mdwn b/biblio/10.1093_plankt_23.4.415.mdwn
index fd6c0a3f..222b6b13 100644
--- a/biblio/10.1093_plankt_23.4.415.mdwn
+++ b/biblio/10.1093_plankt_23.4.415.mdwn
@@ -7,4 +7,4 @@ Journal of Plankton Research, Volume 23, Issue 4, April 2001, Pages 415–423, d
 
 House Production by Oikopleura dioica (Tunicata, Appendicularia) Under Laboratory Conditions
 
-[[!doi:10.1093/plankt/23.4.415 desc="Generation time of Tôkyô bay's _O. dioica_: 6 days at 15°C, 4 days at 20°C and 3 days at 25°C.  Fed with _I. galbana_ and _Tetraselmis sp._  Individuals produced ~50 houses in their life.  Higher temperature increases house production (from ~0.5 / h at 15°C to ~ 0.8 / h at 25 °C.  Artificial clogging with the diatom _Ditylum_ increased house renewal.."]]
+[[! doi:10.1093/plankt/23.4.415 desc="Generation time of Tôkyô bay's _O. dioica_: 6 days at 15°C, 4 days at 20°C and 3 days at 25°C.  Fed with _I. galbana_ and _Tetraselmis sp._  Individuals produced ~50 houses in their life.  Higher temperature increases house production (from ~0.5 / h at 15°C to ~ 0.8 / h at 25 °C.  Artificial clogging with the diatom _Ditylum_ increased house renewal.."]]

More numbers.
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 444fa94a..4b589086 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -547,8 +547,9 @@ House
    clogging particles.  An individual stuck to the culture vessel could not inflate
    new houses, but nevertheless synthesised 7 rudiments (stacked on each other) before
    starving ([[Fenaux 1985|biblio/WOSA1985AYN8600012]].
- - Temperature and food availability increase house production from ~0.4 /h to ~0.8 / h
-   ([[Fenaux 1985|biblio/WOSA1985AYN8600012]], [[Sato, Tanaka and Ishimaru, 2001|biblio/10.1093_plankt_23.4.415]].
+ - Temperature and food availability increase house production from ~0.2 /h to ~0.4 / h
+   ([[Fenaux 1985|biblio/WOSA1985AYN8600012]], of from ~0.4 /h to ~0.8 / h
+   [[Sato, Tanaka and Ishimaru, 2001|biblio/10.1093_plankt_23.4.415]].
 
 Phenotypes
 ----------

Café
diff --git a/biblio/10.1093_plankt_23.4.415.mdwn b/biblio/10.1093_plankt_23.4.415.mdwn
index 70abeb49..fd6c0a3f 100644
--- a/biblio/10.1093_plankt_23.4.415.mdwn
+++ b/biblio/10.1093_plankt_23.4.415.mdwn
@@ -1,5 +1,5 @@
-[[!meta title=" House Production by Oikopleura dioica (Tunicata, Appendicularia) Under Laboratory Conditions"]]
-[[!tag to_read]]
+[[!meta title="House Production by Oikopleura dioica (Tunicata, Appendicularia) Under Laboratory Conditions"]]
+[[!tag Oikopleura]]
 
 Riki Sato, Yuji Tanaka, Takashi Ishimaru
 
@@ -7,4 +7,4 @@ Journal of Plankton Research, Volume 23, Issue 4, April 2001, Pages 415–423, d
 
 House Production by Oikopleura dioica (Tunicata, Appendicularia) Under Laboratory Conditions
 
-[[!doi 10.1093/plankt/23.4.415 desc="To read"]]
+[[!doi:10.1093/plankt/23.4.415 desc="Generation time of Tôkyô bay's _O. dioica_: 6 days at 15°C, 4 days at 20°C and 3 days at 25°C.  Fed with _I. galbana_ and _Tetraselmis sp._  Individuals produced ~50 houses in their life.  Higher temperature increases house production (from ~0.5 / h at 15°C to ~ 0.8 / h at 25 °C.  Artificial clogging with the diatom _Ditylum_ increased house renewal.."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 96372188..444fa94a 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -387,7 +387,9 @@ Development
    culture conditions might differ.  ~1 day generation time reported in microcosms
    at 29°C in Jamaica ([[Hopcroft and Roff, 1995|biblio/10.1093_plankt_17.2.205]]).
    ~1.2 day generation in the Seto inland sea ([[Uye and Ichino,
-   1995|biblio/10.1016_0022-0981_95_00004-B]]).
+   1995|biblio/10.1016_0022-0981_95_00004-B]]).  Tôkyô bay _O. dioica_ under
+   laboratory condiditons:  6 days at 15°C, 4 days at 20°C and 3 days at 25°C
+   ([[Sato, Tanaka and Ishimaru, 2001|biblio/10.1093_plankt_23.4.415]]).
  - Increased food abundance increases egg number but does not change diameter nor
    generation time ([[Troedsson and coll., 2002|biblio/10.3354_meps243083]]).
    Food reduction before day 4 causes growth arrest (GA), in which all cell cycles
@@ -501,6 +503,8 @@ Physiology
 House
 -----
 
+ - _O. dioica_ individuals produce ~50 houses in their life
+   ([[Sato, Tanaka and Ishimaru, 2001|biblio/10.1093_plankt_23.4.415]]).
  - The house was observed in details with India ink coloration by [[Fenaux
    1986|biblio/10.1007_BF00312043]].  He also observed that, when in the house,
    “the tails beat slowly when the suspended particles were numerous and rapidly
@@ -543,8 +547,8 @@ House
    clogging particles.  An individual stuck to the culture vessel could not inflate
    new houses, but nevertheless synthesised 7 rudiments (stacked on each other) before
    starving ([[Fenaux 1985|biblio/WOSA1985AYN8600012]].
- - Temperature and food availability increase house production
-   ([[Fenaux 1985|biblio/WOSA1985AYN8600012]].
+ - Temperature and food availability increase house production from ~0.4 /h to ~0.8 / h
+   ([[Fenaux 1985|biblio/WOSA1985AYN8600012]], [[Sato, Tanaka and Ishimaru, 2001|biblio/10.1093_plankt_23.4.415]].
 
 Phenotypes
 ----------

Café
diff --git a/biblio/WOSA1985AYN8600012.mdwn b/biblio/WOSA1985AYN8600012.mdwn
new file mode 100644
index 00000000..174366f0
--- /dev/null
+++ b/biblio/WOSA1985AYN8600012.mdwn
@@ -0,0 +1,19 @@
+[[!meta title="Rhythm of secretion of Oikopleurid's houses"]]
+[[!tag Oikopleura]]
+
+Robert Fenaux
+
+Rhythm of secretion of Oikopleurid's houses
+
+Bulletin of Marine Science, Volume 37, Number 2, September 1985, pp. 498-503(6)
+
+An individual unable to expand its houses and feed was shown to have secreted 7
+house rudiments stacked on each other before dying.  Number of houses secreted
+by hour in a 12 h period: 0.17 ± 0.04 at 14°C; 0.23 ± 0.04 at 16°C; 0.30 ± 0.04
+at 18°C; 0.36 ± 0.06 at 20°C and 0.44 ± 0.04 at 22°C.  Increase of food supply
+increases house production.  Individuals in artificial seawater still produce
+and discard houses before dying of starvation.
+
+https://www.ingentaconnect.com/content/umrsmas/bullmar/1985/00000037/00000002/art00012
+
+No PMID, no DOI found. WOS ID: A1985AYN8600012
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index e96d6d0e..96372188 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -539,6 +539,12 @@ House
    epithelium, using multiple microscopy techniques [[Razghandi and coll., 2020|biblio/34041785]].
  - Abandonned houses bring nanoplankton into the copepod food chain
    ([[Alldredge AL, 1972|biblio/17780989]]).
+ - _O. dioica_ discards houses for new ones even in artificial seawater with no
+   clogging particles.  An individual stuck to the culture vessel could not inflate
+   new houses, but nevertheless synthesised 7 rudiments (stacked on each other) before
+   starving ([[Fenaux 1985|biblio/WOSA1985AYN8600012]].
+ - Temperature and food availability increase house production
+   ([[Fenaux 1985|biblio/WOSA1985AYN8600012]].
 
 Phenotypes
 ----------

Syntenic correlation indices.
diff --git a/biblio/12242252.mdwn b/biblio/12242252.mdwn
new file mode 100644
index 00000000..54eebb3e
--- /dev/null
+++ b/biblio/12242252.mdwn
@@ -0,0 +1,23 @@
+[[!meta title="Measures of synteny conservation between species pairs."]]
+[[!tag synteny method]]
+
+Housworth EA, Postlethwait J
+
+Genetics. 2002 Sep;162(1):441-8. doi:10.1093/genetics/162.1.441
+
+Measures of synteny conservation between species pairs.
+
+[[!pmid 12242252 desc="Introduces a syntenic correlation measure, ρ, which is a
+scaled chi-square statistic, and an alternative measure λ with measures “the
+proportion of errors made in assigning a gene to a chromosome in one species
+that can be eliminated by knowing which chromosome the orthologue belongs to in
+the other species.”"]]
+
+“_We introduce a measure of genomic conservation, which we call syntenic
+correlation, which corresponds to a measure of how far the orthologues are from
+being independently scattered in the genomes of the two species. This measure
+is standardized to be between zero, for completely randomized arrangements of
+orthologues between the genomes, and one, for two genomes with perfect synteny
+conservation. Further, this measure can be used to compare genomic distances
+(i.e., Oxford grids) between many pairs of species._”
+
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 9fee169a..1535701c 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -84,6 +84,12 @@ Squid chromosomes still have synteny with scallop, but gene order is scrambled
    orthologue co-occurs close by in the other genome. It varies between 0 (no
    co-occurrence) and 1 (complete gene order conservation)”.
 
+ - [[Housworth and Postlethwait, 2002|biblio/12242252]] defined the syntenic
+   correlation measure ρ, based on chi-square and an alternative λ not based on
+   chi-square.  Both attempt to estimate how wrong we would be to hypothesise
+   that a given gene has its orthologue in a homologous chromosome of a related
+   species.
+
  - “Chains” and “nets” of pairwise alignements between two genomes are described
    in [[Kent and coll, 2003|biblio/14500911]].
 

O. tauri
diff --git a/biblio/16868079.mdwn b/biblio/16868079.mdwn
new file mode 100644
index 00000000..5be80189
--- /dev/null
+++ b/biblio/16868079.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Genome analysis of the smallest free-living eukaryote Ostreococcus tauri unveils many unique features"]]
+[[!tag chromosome genome]]
+
+Derelle E, Ferraz C, Rombauts S, Rouzé P, Worden AZ, Robbens S, Partensky F, Degroeve S, Echeynié S, Cooke R, Saeys Y, Wuyts J, Jabbari K, Bowler C, Panaud O, Piégu B, Ball SG, Ral JP, Bouget FY, Piganeau G, De Baets B, Picard A, Delseny M, Demaille J, Van de Peer Y, Moreau H.
+
+Proc Natl Acad Sci U S A. 2006 Aug 1;103(31):11647-52. doi:10.1073/pnas.0604795103
+
+Genome analysis of the smallest free-living eukaryote _Ostreococcus tauri_ unveils many unique features.
+
+[[!pmid 16868079 desc="Half of chromosome 2 and the whole of chromosome 19 differ from the rest of the genome by a lower GC content (52% instead of 59%) and a higher frequency of repeated regions (they contain 77% of the 417 repeat elements).  Chr2 has also a different codon usage and smaller introns.  The genes on chr19 tend to be less related the “green lineage” (photosynthetic cells that gave rise to plants)."]]
diff --git a/tags/chromosome.mdwn b/tags/chromosome.mdwn
index 74f69441..fa845073 100644
--- a/tags/chromosome.mdwn
+++ b/tags/chromosome.mdwn
@@ -1,3 +1,10 @@
 [[!meta title="pages tagged chromosome"]]
 
+_in progressss_
+
+Two (out of 20) chromosomes in the genome of the unicellular green alga
+_Ostreococcus tauri_ have a markedly different GC and transposable element
+content compared to the others. [[Derelle et al., 2003|biblio/16868079]].
+
+
 [[!inline pages="tagged(chromosome)" limit=0]]

Remove unused tag.
diff --git a/biblio/22422449.mdwn b/biblio/22422449.mdwn
index c795cf45..abba5cbf 100644
--- a/biblio/22422449.mdwn
+++ b/biblio/22422449.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Associations with early-life socio-economic position in adult DNA methylation."]]
-[[!tag olfaction epigenetic cohort environment]]
+[[!tag olfaction epigenetic environment]]
 
 Borghol N, Suderman M, McArdle W, Racine A, Hallett M, Pembrey M, Hertzman C, Power C, Szyf M.
 
diff --git a/tags/cohort.mdwn b/tags/cohort.mdwn
deleted file mode 100644
index 26413828..00000000
--- a/tags/cohort.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged cohort"]]
-
-[[!inline pages="tagged(cohort)" actions="no" archive="yes"
-feedshow=10]]

Typo
diff --git a/tags/Drosophila.mdwn b/tags/Drosophila.mdwn
index ec506cc1..dfa4353d 100644
--- a/tags/Drosophila.mdwn
+++ b/tags/Drosophila.mdwn
@@ -3,7 +3,7 @@
 **  Work in progress **
 
 A phylogeny of ~150 _Drosophila_ species using > 2000 BUSCO genes:
-[[Suvofov et al., 2022|biblio/34788634]].
+[[Suvorov et al., 2022|biblio/34788634]].
 
 ### _pseudoobscura_
 

Droso
diff --git a/biblio/34788634.mdwn b/biblio/34788634.mdwn
new file mode 100644
index 00000000..90c4a52a
--- /dev/null
+++ b/biblio/34788634.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Widespread introgression across a phylogeny of 155 Drosophila genomes"]]
+[[!tag Drosophila]]
+
+Suvorov A, Kim BY, Wang J, Armstrong EE, Peede D, D'Agostino ERR, Price DK, Waddell P, Lang M, Courtier-Orgogozo V, David JR, Petrov D, Matute DR, Schrider DR, Comeault AA.
+
+Curr Biol. 2022 Jan 10;32(1):111-123.e5. doi:10.1016/j.cub.2021.10.052
+
+Widespread introgression across a phylogeny of 155 Drosophila genomes.
+
+[[!pmid 34788634 desc="2,791 BUSCOs extracted from 155 genomes (149 species) to compute a phylogenetic tree.  Introgressions were studied in 9 clades."]]
diff --git a/tags/Drosophila.mdwn b/tags/Drosophila.mdwn
index ac722da8..ec506cc1 100644
--- a/tags/Drosophila.mdwn
+++ b/tags/Drosophila.mdwn
@@ -2,6 +2,9 @@
 
 **  Work in progress **
 
+A phylogeny of ~150 _Drosophila_ species using > 2000 BUSCO genes:
+[[Suvofov et al., 2022|biblio/34788634]].
+
 ### _pseudoobscura_
 
 Analysis of Cox2 sequences of _Drosophila_ species by [[Beckenbach, Wei and Liu

Dentiste
diff --git a/biblio/35588743.mdwn b/biblio/35588743.mdwn
new file mode 100644
index 00000000..1b151467
--- /dev/null
+++ b/biblio/35588743.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Mixing genome annotation methods in a comparative analysis inflates the apparent number of lineage-specific genes."]]
+[[!tag annotation method]]
+
+Weisman CM, Murray AW, Eddy SR.
+
+Curr Biol. 2022 May 12:S0960-9822(22)00721-7. doi:10.1016/j.cub.2022.04.085
+
+Mixing genome annotation methods in a comparative analysis inflates the apparent number of lineage-specific genes.
+
+[[!pmid 35588743 desc="“In all but one of the eight cases in Figure 1, the increase is more than 2-fold, suggesting that the majority of lineage-specific genes inferred in heterogeneous annotations are artifacts of the heterogeneity.”  “As expected, six-frame translation homology searches dramatically reduce the apparent number of lineage-specific genes.”"]]

published
diff --git a/biblio/10.1101_2020.03.16.993428.mdwn b/biblio/10.1101_2020.03.16.993428.mdwn
deleted file mode 100644
index f14b9cc5..00000000
--- a/biblio/10.1101_2020.03.16.993428.mdwn
+++ /dev/null
@@ -1,10 +0,0 @@
-[[!meta title="Overcoming uncollapsed haplotypes in long-read assemblies of non-model organisms"]]
-[[!tag bioRxiv assembly benchmark]]
-
-Nadège Guiglielmoni, Antoine Houtain, Alessandro Derzelle, Karine van Doninck, Jean-François Flot
-
-bioRxiv 2020.03.16.993428; doi: https://doi.org/10.1101/2020.03.16.993428 
-
-Overcoming uncollapsed haplotypes in long-read assemblies of non-model organisms
-
-[[!pmid 10.1101/2020.03.16.993428 desc="Benchark using a bdelloid rotifer.  Performance of most software plateaus over 50× depth. purge_dups performed well on Flye assemblies.  Filtering our shorter reads did not dramatically change the N50 of Flye 2.5 assemblies"]]
diff --git a/biblio/34090340.mdwn b/biblio/34090340.mdwn
new file mode 100644
index 00000000..bc2ee063
--- /dev/null
+++ b/biblio/34090340.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Overcoming uncollapsed haplotypes in long-read assemblies of non-model organisms"]]
+[[!tag assembly benchmark]]
+
+Nadège Guiglielmoni, Antoine Houtain, Alessandro Derzelle, Karine van Doninck, Jean-François Flot
+
+BMC Bioinformatics. 2021 Jun 5;22(1):303. doi:10.1186/s12859-021-04118-3
+
+Overcoming uncollapsed haplotypes in long-read assemblies of non-model organisms
+
+[[!pmid 34090340 desc="Benchark using a bdelloid rotifer.  Performance of most software plateaus over 50× depth. purge_dups performed well on Flye assemblies.  Filtering our shorter reads did not dramatically change the N50 of Flye 2.5 assemblies"]]

Café
diff --git a/biblio/10331260.mdwn b/biblio/10331260.mdwn
new file mode 100644
index 00000000..d79ef5e4
--- /dev/null
+++ b/biblio/10331260.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Evolutionary instability of operon structures disclosed by sequence comparisons of complete microbial genomes."]]
+[[!tag operon]]
+
+Itoh T, Takemoto K, Mori H, Gojobori T.
+
+Mol Biol Evol. 1999 Mar;16(3):332-46. doi:10.1093/oxfordjournals.molbev.a026114
+
+Evolutionary instability of operon structures disclosed by sequence comparisons of complete microbial genomes.
+
+[[!pmid 10331260 desc="Search accross prokaryotes, archea and eukaryotes.  No operon conservation between bacteria and yeast, except perhaps _gal_.  Many operons destroyed in bacteria, although some very conserved ones remain (for instance for ribosomal proteins).  Proposes a partimonious way to estimate operon creation and destruction."]]
diff --git a/biblio/35658077.mdwn b/biblio/35658077.mdwn
new file mode 100644
index 00000000..4f9c3be4
--- /dev/null
+++ b/biblio/35658077.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Repeated translocation of a supergene underlying rapid sex chromosome turnover in Takifugu pufferfish."]]
+[[!tag chromosome sex fish]]
+
+Kabir A, Ieda R, Hosoya S, Fujikawa D, Atsumi K, Tajima S, Nozawa A, Koyama T, Hirase S, Nakamura O, Kadota M, Nishimura O, Kuraku S, Nakamura Y, Kobayashi H, Toyoda A, Tasumi S, Kikuchi K.
+
+Proc Natl Acad Sci U S A. 2022 Jun 7;119(23):e2121469119. doi:10.1073/pnas.2121469119
+
+Repeated translocation of a supergene underlying rapid sex chromosome turnover in Takifugu pufferfish.
+
+[[!pmid 35658077 desc="The genome of the green puffer (Takifugu alboplumbeus or T. niphobles) was assembled.  SNP analysis of multiple species showed that in three fugu species (T. niphobles, T. snyderi and T. vermicularis), the sex determination locus is not _Amrh2_ anymore (like it is in T. rubripes), but a new supergene containing _GsdfY_.  This supergene appears to have moved to a new autosome more than once in the evolutionary history of these species."]]
diff --git a/tags/trans-splicing.mdwn b/tags/trans-splicing.mdwn
index b1a06e15..c4000976 100644
--- a/tags/trans-splicing.mdwn
+++ b/tags/trans-splicing.mdwn
@@ -1,5 +1,7 @@
 [[!meta title="pages tagged trans-splicing"]]
 
+_Also check the [[operon]] tag..._
+
 Trans-spplicing of a splice leader from a nematode and a trypanosome was shown
 to be possible in COS cells and HeLa cell extracts by [[Bruzik and Maniatis, 1992|biblio/1465136]].
 

trans-splicing
diff --git a/biblio/20142326.mdwn b/biblio/20142326.mdwn
new file mode 100644
index 00000000..3a597f2d
--- /dev/null
+++ b/biblio/20142326.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Convergent origins and rapid evolution of spliced leader trans-splicing in metazoa: insights from the ctenophora and hydrozoa."]]
+[[!tag trans-splicing]]
+
+Derelle R, Momose T, Manuel M, Da Silva C, Wincker P, Houliston E.
+
+RNA. 2010 Apr;16(4):696-707. doi:10.1261/rna.1975210
+
+Convergent origins and rapid evolution of spliced leader trans-splicing in metazoa: insights from the ctenophora and hydrozoa.
+
+[[!pmid 20142326 desc="“First evidence for SL trans-splicing in ctenophores.” (_Pleurobrachia pileus_ and _Mnemiopsis leidyi_)  “Analysis of data sets for the hydrozoans _H. magnipapillata_ and _C. hemisphaerica_ revealed a high number of SL sequence variants per species.”  The same gene may use different splice leaders.  An adenosine-rich region is found between the trans-splicing site and the transcription initiation site in hydrozoans, but not in other species (including _Oikopleura_."]]
diff --git a/tags/trans-splicing.mdwn b/tags/trans-splicing.mdwn
index 5cfd6dad..b1a06e15 100644
--- a/tags/trans-splicing.mdwn
+++ b/tags/trans-splicing.mdwn
@@ -15,4 +15,9 @@ The splice leader is 16-nt in C. intestinalis ([[Satou et al,
 dioica_ is `TTT(C/T/A)AGA`, which is the same as the cis-splicing acceptor
 with an extra `A` at the end.
 
+Trans-splicing is also found in cnidarians ([[Derelle et al., 2010|biblio/20142326]]).
+
+In hydrozoans, the region between the trans-splicing site and the translation initiation site
+is A-rich ([[Derelle et al., 2010|biblio/20142326]]).
+
 [[!inline pages="tagged(trans-splicing)" actions="no" limit=0]]

typo
diff --git a/biblio/35508532.mdwn b/biblio/35508532.mdwn
index c8a376c9..b3a594b8 100644
--- a/biblio/35508532.mdwn
+++ b/biblio/35508532.mdwn
@@ -7,4 +7,4 @@ Nat Commun. 2022 May 4;13(1):2427. doi:10.1038/s41467-022-29748-w
 
 Genome and transcriptome mechanisms driving cephalopod evolution.
 
-[[!pmid 35508532 desc="Most chromosomes of _Doryteuthis pealeii_ have a direct counterpart in _Euprymna scolopes_ and retained visible synteny with the scallop Mizuhopecten yessoensis_.  In both cases, the gene order in syntenic regions is considerably scrambled."]]
+[[!pmid 35508532 desc="Most chromosomes of _Doryteuthis pealeii_ have a direct counterpart in _Euprymna scolopes_ and retained visible synteny with the scallop _Mizuhopecten yessoensis_.  In both cases, the gene order in syntenic regions is considerably scrambled."]]

Typo
diff --git a/biblio/35108053.mdwn b/biblio/35108053.mdwn
index 00ad2619..668047dd 100644
--- a/biblio/35108053.mdwn
+++ b/biblio/35108053.mdwn
@@ -7,4 +7,4 @@ Sci Adv. 2022 Feb 4;8(5):eabi5884. doi:10.1126/sciadv.abi5884
 
 Deeply conserved synteny and the evolution of metazoan chromosomes.
 
-[[!pmid 35108053 desc="29 ancestral linkage groups (ALG) or 24 bilaterian linkage groups, containg usually less than 100 genes.  Karyotypes change by insertion, fusion or "fusion with mixing" between chromosomes.  Traces of conserved synteny with unicellular genomes (choanoflagellates, ichtyosporeans) were found.]]
+[[!pmid 35108053 desc="29 ancestral linkage groups (ALG) or 24 bilaterian linkage groups, containg usually less than 100 genes.  Karyotypes change by insertion, fusion or "fusion with mixing" between chromosomes.  Traces of conserved synteny with unicellular genomes (choanoflagellates, ichtyosporeans) were found."]]

typo
diff --git a/biblio/35042416.mdwn b/biblio/35042416.mdwn
index 6159ce3b..0b595139 100644
--- a/biblio/35042416.mdwn
+++ b/biblio/35042416.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Multiscale analysis of the randomization limits of the chromosomal gene organization between Lepidoptera and Diptera."]]
-[[!tag Drosphila synteny]]
+[[!tag Drosophila synteny]]
 
 Ranz JM, González PM, Su RN, Bedford SJ, Abreu-Goodger C, Markow T.
 
diff --git a/tags/Drosphila.mdwn b/tags/Drosphila.mdwn
deleted file mode 100644
index f636bc99..00000000
--- a/tags/Drosphila.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged Drosphila"]]
-
-[[!inline pages="tagged(Drosphila)" actions="no" archive="yes"
-feedshow=10]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 2b5aa969..9fee169a 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -29,7 +29,10 @@ of 90 rearrangements per MY (_mel_ / _simulans_) and 226–354 per MY (_sim_ / _
 ([[Chakraborty and coll., 2021|biblio/33563718]]).
 
 In insects, the Osiris gene family shows conservation of synteny over ~400
-million years ([[Sah and coll., 2012|biblio/22384409]]).
+million years ([[Sah and coll., 2012|biblio/22384409]]).  At the same time
+scale (~400 million years), synteny conservation of the X chromosome is also
+visible between fruit flies and cockroaches ([[Meisel, Delclos and Wexler,
+2019|biblio/31806031]]).
 
 Butterfly chromosome still have synteny with Muller elements ([[Ranz and coll,
 2022|biblio/35042416]]).

creating tag page tags/Drosphila
diff --git a/tags/Drosphila.mdwn b/tags/Drosphila.mdwn
new file mode 100644
index 00000000..f636bc99
--- /dev/null
+++ b/tags/Drosphila.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged Drosphila"]]
+
+[[!inline pages="tagged(Drosphila)" actions="no" archive="yes"
+feedshow=10]]

Oublié je-ne-sais quandÃÃ
diff --git a/biblio/35042416.mdwn b/biblio/35042416.mdwn
new file mode 100644
index 00000000..6159ce3b
--- /dev/null
+++ b/biblio/35042416.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Multiscale analysis of the randomization limits of the chromosomal gene organization between Lepidoptera and Diptera."]]
+[[!tag Drosphila synteny]]
+
+Ranz JM, González PM, Su RN, Bedford SJ, Abreu-Goodger C, Markow T.
+
+Proc Biol Sci. 2022 Jan 26;289(1967):20212183. doi:10.1098/rspb.2021.2183
+
+Multiscale analysis of the randomization limits of the chromosomal gene organization between Lepidoptera and Diptera.
+
+[[!pmid 35042416 desc="Uses 5 to 7000 1-to-1 orthologues to study synteny in insects that speciated ~100 My ago.  Uses a definition of microsynteny with no constrains on orientation, where transposition does not interrupt synteny, and where triplets of orthologues do not need to be in the same order.  A repurposed tissue-specificity index identifies ancestral relationships between chromosomes.  Searched for conserved clusters (Hox etc.) by allowing a distance of 250 kbp between genes, regardless the number of interveining genes.  Found that most clusters still exist, but rearranged."]]

Bursaphelenchus okinawaensis
diff --git a/biblio/33093047.mdwn b/biblio/33093047.mdwn
new file mode 100644
index 00000000..bf118d13
--- /dev/null
+++ b/biblio/33093047.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Telomere-to-Telomere Genome Assembly of _Bursaphelenchus okinawaensis_ Strain SH1."]]
+[[!tag nematode genome]]
+
+Sun S, Shinya R, Dayi M, Yoshida A, Sternberg PW, Kikuchi T.
+
+Microbiol Resour Announc. 2020 Oct 22;9(43):e01000-20. doi:10.1128/MRA.01000-20
+
+Telomere-to-Telomere Genome Assembly of _Bursaphelenchus okinawaensis_ Strain SH1.
+
+[[!pmid 33093047 desc="70 Mb genome, 6 chromosomes, enriched for repeats at the arms ends.  Hi-C contact map shows strong interaction between all the central regions of the chromosomes."]]
diff --git a/tags/nematode.mdwn b/tags/nematode.mdwn
index b1d7870a..8d95f5bb 100644
--- a/tags/nematode.mdwn
+++ b/tags/nematode.mdwn
@@ -45,4 +45,8 @@
    genome sequence is evloving towards effective haploidy ([[Abad and coll.,
    2008|biblio/18660804]]).
 
+ - _Bursaphelenchus okinawaensis_ has a genome of 70 Mb in 6 chromosomes of similar length.
+   The Hi-C contact map shows strong interaction between the centre of all chromosomes
+   ([[Sun and coll., 2020|biblio/33093047]]).
+
 [[!inline pages="tagged(nematode)" limit=0]]

Café
diff --git a/biblio/35585232.mdwn b/biblio/35585232.mdwn
new file mode 100644
index 00000000..4e22bbc3
--- /dev/null
+++ b/biblio/35585232.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Fast and efficient DNA replication with purified human proteins."]]
+[[!tag replication]]
+
+Baris Y, Taylor MRG, Aria V, Yeeles JTP.
+
+Nature. 2022 Jun;606(7912):204-210. doi:10.1038/s41586-022-04759-1
+
+Fast and efficient DNA replication with purified human proteins.
+
+[[!pmid 35585232 desc="A minimal human replisome comprising only CMG, Polε and PCNA has a speed of 1.67 kb min−1.  Addition of AND-1, TIM–TIPIN, CLASPIN and CTF18–RFC increases that speed to 4.41 kb min−1, “which is over twice the mean rate and towards the upper limit of observed fork rate distributions measured in human cells”."]]
diff --git a/tags/replication.mdwn b/tags/replication.mdwn
index 9bffe547..cf7a1c03 100644
--- a/tags/replication.mdwn
+++ b/tags/replication.mdwn
@@ -1,4 +1,3 @@
 [[!meta title="pages tagged replication"]]
 
-[[!inline pages="tagged(replication)" actions="no" archive="yes"
-feedshow=10]]
+[[!inline pages="tagged(replication)" actions="no" limit=0]]

SyRI
diff --git a/biblio/31842948.mdwn b/biblio/31842948.mdwn
new file mode 100644
index 00000000..dbf41f32
--- /dev/null
+++ b/biblio/31842948.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Goel M, Sun H, Jiao WB, Schneeberger K. SyRI: finding genomic rearrangements and local sequence differences from whole-genome assemblies."]]
+[[!tag software genome synteny]]
+
+Goel M, Sun H, Jiao WB, Schneeberger K.
+
+Genome Biol. 2019 Dec 16;20(1):277. doi:10.1186/s13059-019-1911-0
+
+SyRI: finding genomic rearrangements and local sequence differences from whole-genome assemblies.
+
+[[!pmid 31842948 desc="Identifies inversions, translocations, duplications, etc., but requires that the two genomes have the same number of chromosomes and that they are oriented the same direction."]]
diff --git a/tags/assembly.mdwn b/tags/assembly.mdwn
index 987f4ede..efd9bd6c 100644
--- a/tags/assembly.mdwn
+++ b/tags/assembly.mdwn
@@ -91,7 +91,8 @@ AUGUSTUS can be trained for a new species with transcriptome data, as explained
 by [[Hoff and Stanke, 2018|biblio/30466165]].
 
 A reference assembly can be used to search for structural variants in a different
-individual, for instance with NanoSV ([[Cretu Stancu and coll., 2017|biblio/29109544]]).
+individual, for instance with NanoSV ([[Cretu Stancu and coll., 2017|biblio/29109544]])
+or SyRI ([[Goel and coll., 2019|biblio/31842948]]).
 
 In [[2003, Kent and coll.|biblio/14500911]] aligned the human and mouse genome
 together using the BLASTZ and AXTCHAIN software.

creating tag page tags/Brenner
diff --git a/tags/Brenner.mdwn b/tags/Brenner.mdwn
new file mode 100644
index 00000000..40556bc0
--- /dev/null
+++ b/tags/Brenner.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged Brenner"]]
+
+[[!inline pages="tagged(Brenner)" actions="no" archive="yes"
+feedshow=10]]

Café
diff --git a/biblio/4379508.mdwn b/biblio/4379508.mdwn
new file mode 100644
index 00000000..54f9f072
--- /dev/null
+++ b/biblio/4379508.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Collinearity and the genetic code"]]
+[[!tag review Brenner]]
+
+S Brenner
+
+Proc R Soc Lond B Biol Sci. 1966 Mar 22;164(995):170-80. doi:10.1098/rspb.1966.0021
+
+Collinearity and the genetic code.
+
+[[!pmid 4379508 desc="A very readable review on how it was demonstrated that the DNA codes for the proteins."]]

Inversions.
diff --git a/biblio/11731496.mdwn b/biblio/11731496.mdwn
new file mode 100644
index 00000000..96633d7d
--- /dev/null
+++ b/biblio/11731496.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Twin priming: a proposed mechanism for the creation of inversions in L1 retrotransposition."]]
+[[!tag repeat]]
+
+Ostertag EM, Kazazian HH Jr.
+
+Genome Res. 2001 Dec;11(12):2059-65. doi:10.1101/gr.205701
+
+Twin priming: a proposed mechanism for the creation of inversions in L1 retrotransposition.
+
+[[!pmid 11731496 desc="The RNA is primed by the L1 reverse-transcriptase at both sides of the endonucleotide cleavage, resulting in a partial or complete inversion flanked by a tandem site duplication."]]

Café
diff --git a/biblio/10.1101_2022.05.25.493221.mdwn b/biblio/10.1101_2022.05.25.493221.mdwn
new file mode 100644
index 00000000..5ff4aa22
--- /dev/null
+++ b/biblio/10.1101_2022.05.25.493221.mdwn
@@ -0,0 +1,14 @@
+[[!meta title="Laboratory study of Fritillaria lifecycle reveals larvacean commonalities and key morphogenetic events leading to taxon-specific anatomy"]]
+[[!tag bioRxiv Oikopleura]]
+
+Simon Henriet, Anne Elin Aasjord, Daniel Marc Chourrout
+
+bioRxiv https://doi.org/10.1101/2022.05.25.493221 May 25, 2022.
+
+Laboratory study of Fritillaria lifecycle reveals larvacean commonalities and key morphogenetic events leading to taxon-specific anatomy
+
+[[!doi 10.1101/2022.05.25.493221 desc="Possibly parasited by _Sphaeripara_ or
+_Oodinium_.  Fed with _Micromonas_, _Phaeocystis_ and _Synechococcus_ in
+culture. 4 chromosomes are visible in oocytes by DAPI staining.
+Self-fertilization was never observed.  Cellulose-producing cells identified by
+staining with a carbohydrate-binding-module (CBM)."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index b64a39a4..e96d6d0e 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -699,6 +699,7 @@ Culture protocols (incomplete list):
  - Thompson lab protocol: [[Bouquet and coll., 2009|biblio/19461862]].
  - Cañestro lab protocol: [[Martí-Solans and coll., 2015|biblio/25044679]].
  - OIST's culture protocol: [[Masunaga and coll., 2020|biblio/32628172]].
+ - Report of _Fritilaria_ being cultured: [[Henriet, Aasjord and Chourrout, 2022|biblio/10.1101_2022.05.25.493221]].
 
 Food tested in laboratory (totally incomplete list):
 

Café
diff --git a/biblio/35449136.mdwn b/biblio/35449136.mdwn
new file mode 100644
index 00000000..8402741f
--- /dev/null
+++ b/biblio/35449136.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Emergence of novel cephalopod gene regulation and expression through large-scale genome reorganization."]]
+[[!tag genome synteny]]
+
+Emergence of novel cephalopod gene regulation and expression through large-scale genome reorganization.
+
+Nat Commun. 2022 Apr 21;13(1):2172. doi:10.1038/s41467-022-29694-7
+
+Schmidbaur H, Kawaguchi A, Clarence T, Fu X, Hoang OP, Zimmermann B, Ritschard EA, Weissenbacher A, Foster JS, Nyholm SV, Bates PA, Albertin CB, Tanaka E, Simakov O.
+
+[[!pmid 35449136 desc="Defines “microsyntenic blocks as at least three or more co-occurring orthologous genes with up to five intervening genes with no constraints on their collinearity”. Found 505 microsyntenies unique to cephalopods and 275 unique to metazooans.  “Genes in cephalopod-specific microsyntenies do not tend to be co-expressed, despite their tight co-localization”  “In contrast [to cephalopod-specific microsyntenies], conserved metazoan microsyntenies show significant (Wilcoxon test, p ≤ 0.001) co-expression when compared to simulated microsyntenies”"]]

Café
diff --git a/biblio/35508532.mdwn b/biblio/35508532.mdwn
new file mode 100644
index 00000000..c8a376c9
--- /dev/null
+++ b/biblio/35508532.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Genome and transcriptome mechanisms driving cephalopod evolution."]]
+[[!tag genome synteny]]
+
+Albertin CB, Medina-Ruiz S, Mitros T, Schmidbaur H, Sanchez G, Wang ZY, Grimwood J, Rosenthal JJC, Ragsdale CW, Simakov O, Rokhsar DS.
+
+Nat Commun. 2022 May 4;13(1):2427. doi:10.1038/s41467-022-29748-w
+
+Genome and transcriptome mechanisms driving cephalopod evolution.
+
+[[!pmid 35508532 desc="Most chromosomes of _Doryteuthis pealeii_ have a direct counterpart in _Euprymna scolopes_ and retained visible synteny with the scallop Mizuhopecten yessoensis_.  In both cases, the gene order in syntenic regions is considerably scrambled."]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index a073079e..2b5aa969 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -51,6 +51,9 @@ but not other fungi such as yeast, “genes are conserved within homologous
 chromosomes, but with randomized orders and orientations“ and call that
 phenomenon “mesosynteny”.
 
+Squid chromosomes still have synteny with scallop, but gene order is scrambled
+([[Albertin and coll., 2022|biblio/35508532]]).
+
 ### Ancestral karyotpyes
 
  - The ancestral mammalian genome has 30 chromosomes ([[Zhou and coll., 2021|biblio/33408411]]).

Now in PubMed.
diff --git a/biblio/10.1101_2020.12.23.423594.mdwn b/biblio/33752599.mdwn
similarity index 94%
rename from biblio/10.1101_2020.12.23.423594.mdwn
rename to biblio/33752599.mdwn
index 77093509..88029aa7 100644
--- a/biblio/10.1101_2020.12.23.423594.mdwn
+++ b/biblio/33752599.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="SLIDR and SLOPPR: Flexible identification of spliced leader trans-splicing and prediction of eukaryotic operons from RNA-Seq data"]]
-[[!tag Oikopleura bioRxiv]]
+[[!tag Oikopleura trans-splicing]]
 
 Marius Wenzel, Berndt Mueller, Jonathan Pettitt
 
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index f30ea46a..b64a39a4 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -319,7 +319,7 @@ Transcriptome
    The SL gene is found downstream of the 5S RNA gene, which is repeated multiple
    times in the genome.  The 3′ acceptor site has a strong UUU(C/U/A)AG consensus.
    Reported intercistronic regions are short: <30 nt ([[Ganot et al., 2004|biblio/15314184]])
-   or ~33 nt ([[Wenzel, Mueller and Pettitt, 2020|biblio/10.1101_2020.12.23.423594]]).
+   or ~33 nt ([[Wenzel, Mueller and Pettitt, 2020|biblio/33752599]]).
  - The splice leader found in the Norwegian strain by ([[Ganot et al., 2004|biblio/15314184]])
    was found indentical in a Japanese strain by ([[Wang and coll., 2015|biblio/26032664]]).
  - A study using CAGE found that 39% of annotated gene models are trans-spliced with the

Trans-splicing.
diff --git a/tags/trans-splicing.mdwn b/tags/trans-splicing.mdwn
index 0a750e29..5cfd6dad 100644
--- a/tags/trans-splicing.mdwn
+++ b/tags/trans-splicing.mdwn
@@ -5,10 +5,14 @@ to be possible in COS cells and HeLa cell extracts by [[Bruzik and Maniatis, 199
 
 Trans-splicing was discovered in tunicates by [[Vandenberghe, Meedel and Hastings, 2001|biblio/11159910]].
 
-The splice leader is 16-nt in C. intestinalis ([[Satou et al, 2006|biblio/16822859]]) and 40-nt in O. dioica ([[Ganot et al., 2004|biblio/15314184]]).
-
 A splice leader was found in the endosymbiotic amoeba _Paulinella
 chromatophora_ by [[Nowack and coll, 2016|biblio/27791007]], and characterised
 by [[Matsuo and coll., 2018|biblio/30024971]].
 
+The splice leader is 16-nt in C. intestinalis ([[Satou et al,
+2006|biblio/16822859]]) and 40-nt in O. dioica ([[Ganot et al.,
+2004|biblio/15314184]]).  The trans-splicing acceptor consensus site in _O.
+dioica_ is `TTT(C/T/A)AGA`, which is the same as the cis-splicing acceptor
+with an extra `A` at the end.
+
 [[!inline pages="tagged(trans-splicing)" actions="no" limit=0]]

Polyadenylation signal.
diff --git a/biblio/15314184.mdwn b/biblio/15314184.mdwn
index cb28db59..8785436b 100644
--- a/biblio/15314184.mdwn
+++ b/biblio/15314184.mdwn
@@ -7,4 +7,4 @@ Mol Cell Biol. 2004 Sep;24(17):7795-805. doi:10.1128/MCB.24.17.7795-7805.2004
 
 Spliced-Leader RNA trans Splicing in a Chordate, Oikopleura dioica, with a Compact Genome.
 
-[[!pmid 15314184 desc="5′ splice leader (SL) found in 90/158 ESTs containing a start codon.  The SL RNA is found downstream of the 5S RNA in at least 40 occurences, and aproximately 2/3 of all the 5S rRNA genes.  Its sequence is ACTCATCCCATTTTTGAGTCCGATTTCGATTGTCTAACAG. O. doica is the first chordate where gene operons have been described.  Intercistronic regions are very short (<30 nt).  “In comparing 52 distinct trans-splice acceptor sites to 605 cis-splice acceptor sites, the same consensus sequence, TTT(C/T/A)AG, was observed at both intron and intercistronic region 3′ ends. A notable difference from cis splicing was that most exons trans spliced to the leader (133 of 145) started with an adenosine, whereas the start of cis-spliced exons did not show any nucleotide preference”"]]
+[[!pmid 15314184 desc="5′ splice leader (SL) found in 90/158 ESTs containing a start codon.  The SL RNA is found downstream of the 5S RNA in at least 40 occurences, and aproximately 2/3 of all the 5S rRNA genes.  Its sequence is `ACTCATCCCATTTTTGAGTCCGATTTCGATTGTCTAACAG`. O. doica is the first chordate where gene operons have been described.  Intercistronic regions are very short (<30 nt).  “In comparing 52 distinct trans-splice acceptor sites to 605 cis-splice acceptor sites, the same consensus sequence, `TTT(C/T/A)AG`, was observed at both intron and intercistronic region 3′ ends. A notable difference from cis splicing was that most exons trans spliced to the leader (133 of 145) started with an adenosine, whereas the start of cis-spliced exons did not show any nucleotide preference.”  In the cycD operon, only the last gene (cycD) has a `AAUAAA` polyadenylation signal."]]

Trans-splicing consensus site.
diff --git a/biblio/15314184.mdwn b/biblio/15314184.mdwn
index 7d63dcd1..cb28db59 100644
--- a/biblio/15314184.mdwn
+++ b/biblio/15314184.mdwn
@@ -7,4 +7,4 @@ Mol Cell Biol. 2004 Sep;24(17):7795-805. doi:10.1128/MCB.24.17.7795-7805.2004
 
 Spliced-Leader RNA trans Splicing in a Chordate, Oikopleura dioica, with a Compact Genome.
 
-[[!pmid 15314184 desc="5′ splice leader (SL) found in 90/158 ESTs containing a start codon.  The SL RNA is found downstream of the 5S RNA in at least 40 occurences, and aproximately 2/3 of all the 5S rRNA genes.  Its sequence is ACTCATCCCATTTTTGAGTCCGATTTCGATTGTCTAACAG. O. doica is the first chordate where gene operons have been described.  Intercistronic regions are very short (<30 nt)."]]
+[[!pmid 15314184 desc="5′ splice leader (SL) found in 90/158 ESTs containing a start codon.  The SL RNA is found downstream of the 5S RNA in at least 40 occurences, and aproximately 2/3 of all the 5S rRNA genes.  Its sequence is ACTCATCCCATTTTTGAGTCCGATTTCGATTGTCTAACAG. O. doica is the first chordate where gene operons have been described.  Intercistronic regions are very short (<30 nt).  “In comparing 52 distinct trans-splice acceptor sites to 605 cis-splice acceptor sites, the same consensus sequence, TTT(C/T/A)AG, was observed at both intron and intercistronic region 3′ ends. A notable difference from cis splicing was that most exons trans spliced to the leader (133 of 145) started with an adenosine, whereas the start of cis-spliced exons did not show any nucleotide preference”"]]

Remove the 'operon' tag in favor of the 'trans-splicing' tag.
diff --git a/biblio/15314184.mdwn b/biblio/15314184.mdwn
index f03ae638..7d63dcd1 100644
--- a/biblio/15314184.mdwn
+++ b/biblio/15314184.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Spliced-Leader RNA trans Splicing in a Chordate, Oikopleura dioica, with a Compact Genome."]]
-[[!tag trans-splicing Oikopleura operon]]
+[[!tag trans-splicing Oikopleura]]
 
 Ganot P, Kallesøe T, Reinhardt R, Chourrout D, Thompson EM.
 
diff --git a/tags/operon.mdwn b/tags/operon.mdwn
deleted file mode 100644
index cbea2bd3..00000000
--- a/tags/operon.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged operon"]]
-
-[[!inline pages="tagged(operon)" actions="no" archive="yes"
-feedshow=10]]

Café
diff --git a/biblio/15826240.mdwn b/biblio/15826240.mdwn
new file mode 100644
index 00000000..79730ecb
--- /dev/null
+++ b/biblio/15826240.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="The caspase family in urochordates: distinct evolutionary fates in ascidians and larvaceans."]]
+[[!tag Oikopleura]]
+
+Weill M, Philips A, Chourrout D, Fort P.
+
+Biol Cell. 2005 Nov;97(11):857-66. doi:10.1042/BC20050018
+
+The caspase family in urochordates: distinct evolutionary fates in ascidians and larvaceans.
+
+[[!pmid 15826240 desc="_O. dioica_ has three caspases, all related to the CSP3/7 family."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 4d10951f..f30ea46a 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -294,6 +294,7 @@ Genes and pathways
    [[Ferrández-Roldán and coll., 2021|biblio/34789899]]).
  - None of the genes encoding Bcl-2 proteins or their BH3-only ligands could be found
    in _O. dioica_ [[Suraweera and coll., 2022|biblio/35409052]].
+ - Three caspases related to the CSP3/7 family were found by [[Weil and coll, 2005|biblio/15826240]].
 
 Epigenome
 ---------
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 2b6a156f..a073079e 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -31,6 +31,9 @@ of 90 rearrangements per MY (_mel_ / _simulans_) and 226–354 per MY (_sim_ / _
 In insects, the Osiris gene family shows conservation of synteny over ~400
 million years ([[Sah and coll., 2012|biblio/22384409]]).
 
+Butterfly chromosome still have synteny with Muller elements ([[Ranz and coll,
+2022|biblio/35042416]]).
+
 The indian munjac has only 3 chromosomes, which are the result of fusions in
 the past ~5 My.  The chinese munjak has undergone much less fusions.  In most
 cases, long-range chromosome structure (Hi-C) is not conserved between theses

alamaison
diff --git a/biblio/35422045.mdwn b/biblio/35422045.mdwn
new file mode 100644
index 00000000..20bd0f45
--- /dev/null
+++ b/biblio/35422045.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Chromosome evolution and the genetic basis of agronomically important traits in greater yam."]]
+[[!tag chromosome repeat centromere]]
+
+Bredeson JV, Lyons JB, Oniyinde IO, Okereke NR, Kolade O, Nnabue I, Nwadili CO, Hřibová E, Parker M, Nwogha J, Shu S, Carlson J, Kariba R, Muthemba S, Knop K, Barton GJ, Sherwood AV, Lopez-Montes A, Asiedu R, Jamnadass R, Muchugi A, Goodstein D, Egesi CN, Featherston J, Asfaw A, Simpson GG, Doležel J, Hendre PS, Van Deynze A, Kumar PL, Obidiegwu JE, Bhattacharjee R, Rokhsar DS.
+
+Nat Commun. 2022 Apr 14;13(1):2001. doi:10.1038/s41467-022-29114-w
+
+Chromosome evolution and the genetic basis of agronomically important traits in greater yam.
+
+[[!pmid 35422045 desc="Very broad peri-centromeric regions containg mostly repeats and confining the genes in the subtelomeric regions."]]

alamaison
diff --git a/tags/centromere.mdwn b/tags/centromere.mdwn
index b1444e75..d5500840 100644
--- a/tags/centromere.mdwn
+++ b/tags/centromere.mdwn
@@ -8,6 +8,8 @@ _Work in progress_
    centromeres ([[Melters and coll., 2013|biblio/23363705]]).
  - In the three-spine stickleback, the centromere sequence of chrX differs from
    the one of chrY ([[Peichel and coll., 2020|biblio/32684159]]).
+ - The pericentromeric regions of _Dioscorea alata_ can comprise most of the
+   chromosome length [[Bredeson and coll., 2022|biblio/35422045]].
 
 ## Visualisation
 

apoptosis
diff --git a/biblio/35409052.mdwn b/biblio/35409052.mdwn
new file mode 100644
index 00000000..f9e738ab
--- /dev/null
+++ b/biblio/35409052.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Metazoans and Intrinsic Apoptosis: An Evolutionary Analysis of the Bcl-2 Family."]]
+[[!tag Oikopleura]]
+
+Suraweera CD, Banjara S, Hinds MG, Kvansakul M.
+
+Int J Mol Sci. 2022 Mar 28;23(7):3691. doi:10.3390/ijms23073691
+
+Metazoans and Intrinsic Apoptosis: An Evolutionary Analysis of the Bcl-2 Family.
+
+[[!pmid 35409052 desc="_Oikopleura dioica_ has lost all the Bcl-2 genes as well as their BH3-only ligands."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 268eb633..4d10951f 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -292,6 +292,8 @@ Genes and pathways
    [[Kienle, Kloepper and Fasshauer, 2016|biblio/27756227]]).
  - _Mesp_, _Ets1/2b_, _Gata4/5/6_, _Mek1/2_,  _Hand-r_ and _Tbx1/10_ (heart development,
    [[Ferrández-Roldán and coll., 2021|biblio/34789899]]).
+ - None of the genes encoding Bcl-2 proteins or their BH3-only ligands could be found
+   in _O. dioica_ [[Suraweera and coll., 2022|biblio/35409052]].
 
 Epigenome
 ---------

Corrections
diff --git a/tags/LAST.mdwn b/tags/LAST.mdwn
index 8157f372..8a7d8a81 100644
--- a/tags/LAST.mdwn
+++ b/tags/LAST.mdwn
@@ -5,7 +5,7 @@ _bibliography in progress..._
  - Whole-genome alignments with reversed sequences as negative controls showed
    that e-value filtering is not enough to remove spurious alignments of tandem
    repeat which therefore need to be masked ([[Frith MC, Hamada M and Horton P.,
-   2011|bilbio/20144198]]).
+   2011|biblio/20144198]]).
 
  - `lastdb` can use various seeding schemes to build its index.  [[Frith and
    Noé (2014)|biblio/24493737]] discuss some of them.  The `RY` seeds are made
@@ -33,7 +33,7 @@ _bibliography in progress..._
    of expansion of tandem repeats, after alignment with `last-split`.
 
  - LAST can align DNA sequences to protein databases using a 64 x 21 substitution
-   matrix [[Yao and Frith, 2020|biblio/10.1101_2021.01.25.428050]].
+   matrix [[Yao and Frith, 2020|biblio/10.1007_978-3-030-74432-8_11]].
 
  - JRA (Joint Read Alignment) uses LAST [[Shrestha and coll., 2018|biblio/29182778]].
 

Café
diff --git a/biblio/20144198.mdwn b/biblio/20144198.mdwn
new file mode 100644
index 00000000..30d63bb9
--- /dev/null
+++ b/biblio/20144198.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Parameters for accurate genome alignment."]]
+[[!tag LAST genome alignment]]
+
+Frith MC, Hamada M, Horton P.
+
+BMC Bioinformatics. 2010 Feb 9;11:80. doi: 10.1186/1471-2105-11-80
+
+Parameters for accurate genome alignment.
+
+[[!pmid 20144198 desc="Aligned genomes after reversing (not reverse-complementing) them as a negative controls.  In these comparisons, all alignments are spurious.  A large number of spurious alignments were found, and this could be reduced by masking tandem repeats.  Spuriously alignments in tandem repeats get abnormally high scores. “Bad” scoring matrices tend to extend alignments with spurious low-quality arms.  The X-drop parameter prevents the aligner from extending alignments too far, but high X-drop values can cause small alignments to be discarded by some software because the score becomes negative."]]
diff --git a/tags/LAST.mdwn b/tags/LAST.mdwn
index f8ec88ea..8157f372 100644
--- a/tags/LAST.mdwn
+++ b/tags/LAST.mdwn
@@ -2,6 +2,11 @@
 
 _bibliography in progress..._
 
+ - Whole-genome alignments with reversed sequences as negative controls showed
+   that e-value filtering is not enough to remove spurious alignments of tandem
+   repeat which therefore need to be masked ([[Frith MC, Hamada M and Horton P.,
+   2011|bilbio/20144198]]).
+
  - `lastdb` can use various seeding schemes to build its index.  [[Frith and
    Noé (2014)|biblio/24493737]] discuss some of them.  The `RY` seeds are made
    of non-overlapping words using the two-letter alphabet `R` = `A|G`, `Y` =

creating tag page tags/damage
diff --git a/tags/damage.mdwn b/tags/damage.mdwn
new file mode 100644
index 00000000..e81411aa
--- /dev/null
+++ b/tags/damage.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged damage"]]
+
+[[!inline pages="tagged(damage)" actions="no" archive="yes"
+feedshow=10]]

Café
diff --git a/biblio/26052046.mdwn b/biblio/26052046.mdwn
new file mode 100644
index 00000000..cc175e38
--- /dev/null
+++ b/biblio/26052046.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Activity-Induced DNA Breaks Govern the Expression of Neuronal Early-Response Genes."]]
+[[!tag neuron damage expression]]
+
+Cell. 2015 Jun 18;161(7):1592-605. doi:10.1016/j.cell.2015.05.032
+
+Madabhushi R, Gao F, Pfenning AR, Pan L, Yamakawa S, Seo J, Rueda R, Phan TX, Yamakawa H, Pao PC, Stott RT, Gjoneska E, Nott A, Cho S, Kellis M, Tsai LH.
+
+Activity-Induced DNA Breaks Govern the Expression of Neuronal Early-Response Genes. 
+
+[[!pmid 26052046 desc="Double-strand breaks (DSBs) caused by the topoisomerase inhibitor etoposide induces early-response genes in neurons.  The radiomimetic drugs neocarzinostatin and bleomycin, and the PARP inhibitor Olaparib did cause induction.  Inhibition of DSB signalling with the ATM (ataxia telangiectasia mutated) inhibitor KU55933 did not suppress the induction.  Knockdown of topoisomerase IIβ suppressed the induction.  CRISPR-Cas9 DNA cleavage micmicked and rescued the induction.  Topoisomerase IIβ and the breaks are enriched near CTCF binding sites.  Tyrosyl DNA phosphodiesterase 2 (TDP2) is also enriched at the promoter of immediate early genes."]]

Black sea
diff --git a/biblio/10.1017_S0025315405011410.mdwn b/biblio/10.1017_S0025315405011410.mdwn
new file mode 100644
index 00000000..78fcf8a9
--- /dev/null
+++ b/biblio/10.1017_S0025315405011410.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Changes in appendicularian Oikopleura dioica abundance caused by invasion of alien ctenophores in the Black Sea"]]
+[[!tag Oikopleura]]
+
+Shiganova, T. (2005).
+
+Journal of the Marine Biological Association of the United Kingdom, 85(3), 477-494. doi:10.1017/S0025315405011410
+
+Changes in appendicularian Oikopleura dioica abundance caused by invasion of alien ctenophores in the Black Sea.
+
+[[!doi 10.1017/S0025315405011410 desc="Comparison of _O. dioica_ populations before and after invasion of the ctenophores _Mnemiopsis leidyi_ and _Beroe ovata_.  In 1957, _O. dioica_ peaked in May in the Western Black sea.  In 1979 in peaked from June to November near Sevastopol.  In 1969 there was one peak in May–June and one in August.  In 1991–6, abundance of _O. dioica_ was strongly reduced while _M. leidyi_ was proliferating.  In 1999 and following years, after _B. ovata_ invastion, _M leidyi_ populations were strongly reduced and _O. dioica_ abundance returned to high levels."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 1e8bc757..268eb633 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -587,6 +587,10 @@ Ecology
    whether the viruses are digested.
  - Houses and fecal pellets of _Oikopleura_ species are consumed by eel larvae
    ([[Mochioka and Iwamizu, 1996|biblio/10.1007_BF00353257]]).
+ - In the Black Sea, invasion of _O. dioica's predator_ _Mnemiopsis leidyi_ (a
+   ctenophore) decimated its population, which was restored to higher levels by the
+   subsequent invasion of the predator's predator _Beroe ovata_. [[Shiganova,
+   2005|biblio/10.1017_S0025315405011410]].
 
 ### Distribution in and near Japan
 
@@ -670,7 +674,8 @@ Ecology
    ([[Berry and coll., 2019|biblio/30735490]])
  - TARA Oceans ([[Vorobev and coll., 2020|biblio/32205368]]),
    [[Delmont and coll., biblio/10.1101_2020.10.15.341214v2]].
- - In the southern Black sea in 2006–2007 ([[Üstün, Bat and Besiktepe, 2016|biblio/PG_0485]]).
+ - In the southern Black sea in 2006–2007 ([[Üstün, Bat and Besiktepe, 2016|biblio/PG_0485]])
+   and in the northern Black sea ([[Shiganova 2005|biblio/10.1017_S0025315405011410]].
 
 ### In the past:
 

Café
diff --git a/biblio/18339653.mdwn b/biblio/18339653.mdwn
new file mode 100644
index 00000000..ca534d93
--- /dev/null
+++ b/biblio/18339653.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Altered miRNA repertoire in the simplified chordate, Oikopleura dioica."]]
+[[!tag Oikopleura miRNA]]
+
+Altered miRNA repertoire in the simplified chordate, _Oikopleura dioica_.
+
+Mol Biol Evol. 2008 Jun;25(6):1067-80. doi:10.1093/molbev/msn060
+
+Fu X, Adamski M, Thompson EM.
+
+[[!pmid desc="miRNA array spotted on N+ membranes.  Confirms the existence of Drosha, DGCR8, Dicer, and 3 AGO proteins. “Five compact clusters containing 15 miRNAs were identified, and the distance between adjacent members was systematically less than 100 bp.” 36% of the miRNAs were long of 22 nucleotides.  “many O. dioica miRNAs were found to be located in the antisense orientation of a protein-coding gene, often opposite the sense strand of an intron.”  “let-7a [...] was not detected during embryogenesis but was observed in the postmetamorphic oikoplastic epithelium.”"]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index a76d2bf7..1e8bc757 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -253,6 +253,8 @@ Genes and pathways
    were found; they might have been created by retrotransposition
    ([[Martí-Solans and coll., 2021|biblio/34179025]]).
  - _Nk4_, _Hand1/2_ and _FoxF_ (heart development, [[Ferrández-Roldán and coll., 2021|biblio/34789899]]).
+ - _O. dioica_ has the miRNA machinery and some miRNAs such as _let-7a_ were detected.  36 % of
+   the miRNAs had a length of 22 nt in [[Fu, Adamski and Thompson, 2008|biblio/18339653]].
 
 ### Lost
 

Café
diff --git a/biblio/31311886.mdwn b/biblio/31311886.mdwn
new file mode 100644
index 00000000..16fd4fef
--- /dev/null
+++ b/biblio/31311886.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Causes and Effects of Loss of Classical Nonhomologous End Joining Pathway in Parasitic Eukaryotes."]]
+[[!tag review repair Oikopleura]]
+
+Nenarokova A, Záhonová K, Krasilnikova M, Gahura O, McCulloch R, Zíková A, Yurchenko V, Lukeš J.
+
+mBio. 2019 Jul 16;10(4):e01541-19. doi:10.1128/mBio.01541-19
+
+Causes and Effects of Loss of Classical Nonhomologous End Joining Pathway in Parasitic Eukaryotes.
+
+[[!pmid 31311886 desc="Reviews possible advantages of losing the C-NHEJ pathway, such as reduction of transposon movement, reduction of genome size and change of genome structure, and insertion of short new sequence in proteins.  Focus on parasites but some facts about Oikopleura are highlighted for comparison purposes."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 3ef6ee5b..a76d2bf7 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -270,6 +270,8 @@ Genes and pathways
    conserved from yeast to mammals) is undetectable ([[Denoeud et al., 2010|biblio/21097902]]).
    An alternative or microhomology (MH)-driven end joining pathway is active
    and triggers microdeletions at the joining site ([[Deng, Henriet and Chourrout, 2018|biblio/30293719]]).
+   Loss of C-NHEJ is often associated with parasitism, which is not the case in
+   _Oikopleura_ (review in [[Nenarokova and coll., 2019|biblio/31311886]]).
  - In line with the above, “There is no H2AX homolog in O. dioica.” (H2AX is
    implicated in DNA repair).  [[Moosmann and coll., 2011|biblio/21756361]]
  - The minor spliceosome could not be found in _Oikopleura_'s genome ([[Marz

updated PO files
diff --git a/Joules.en.po b/Joules.en.po
index b75dae18..bc02163d 100644
--- a/Joules.en.po
+++ b/Joules.en.po
@@ -7,7 +7,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2022-03-03 12:24+0000\n"
+"POT-Creation-Date: 2022-03-10 11:47+0000\n"
 "PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
 "Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
 "Language-Team: LANGUAGE <LL@li.org>\n"
@@ -37,7 +37,7 @@ msgstr ""
 
 #. type: Plain text
 msgid ""
-"Ici je vais tout convertir en [Joules](https://fr.wikipedia.org/wiki/Joule), "
+"Ici je vais tout convertir en [joules](https://fr.wikipedia.org/wiki/Joule), "
 "l'unité du Système International, pour mieux comparer.  Je vais poster "
 "chacun de mes calculs avec le tag [#Joules](https://framapiaf.org/tags/"
 "Joules) sur Framapiaf."
@@ -109,3 +109,27 @@ msgid ""
 "intercontinental (20 000 km) et quatre voyages domestiques entre Okinawa et "
 "Tôkyô (4 × 2000 km).  Donc environ 840 litres par an, donc 2 400 MJ."
 msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"Ma part dans la facture télécoms familiale, internet plus téléphonie mobile, "
+"est d'environ 5000 yens.  Je n'ai aucune idée précise de la quantité "
+"d'énergie utilisée.  Mais on peut estimer une limite supérieure: si cet "
+"argent était entièrement dépensé en électricité par les opérateurs, et "
+"qu'ils la payaient au même prix que nous cela ferait environ 160 kWh, ou "
+"environ 600 MJ.  Dans la pratique, ils ont d'autre coûts, et on se situe "
+"probablement à un dixième ou moins du maximum.  Bien entendu, ces chiffres "
+"ne tiennent pas compte du fait que côté centres de données qui nous "
+"fournissent le « contenu », la dépense énergétique est énorme."
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"Je consomme entre 6 et 7 mètres cubes d'eau par mois pour un prix d'environ "
+"1000 yens, qui include la production et le retraitement.  Un rapport de "
+"l'observatoire de l'eau de la Seine-et-Marne, de 2016, estime entre 1.6 et "
+"16 % la part énergétique de la facture d'eau.  En extrapolant avec ma "
+"facture d'électricité, 100 yens font environ 11 MJ.  L'eau est précieuse et "
+"les effets de son gaspillage sont différents de ceux du gaspillage de "
+"l'énergie."
+msgstr ""

Télécoms et eau.
diff --git a/Joules.md b/Joules.md
index 6f771d73..641b8e72 100644
--- a/Joules.md
+++ b/Joules.md
@@ -8,7 +8,7 @@ contexte: calories pour la nourriture ou kilowatt-heures pour l'électricité, e
 on n'a pas l'habitude d'estimer quelle quantité d'énergie on a retiré d'un
 litre d'essence ou d'un mètre cube de gaz…
 
-Ici je vais tout convertir en [Joules](https://fr.wikipedia.org/wiki/Joule),
+Ici je vais tout convertir en [joules](https://fr.wikipedia.org/wiki/Joule),
 l'unité du Système International, pour mieux comparer.  Je vais poster chacun
 de mes calculs avec le tag [#Joules](https://framapiaf.org/tags/Joules) sur
 Framapiaf.
@@ -61,3 +61,19 @@ Framapiaf.
    intercontinental (20 000 km) et quatre voyages domestiques entre Okinawa et
    Tôkyô (4 × 2000 km).  Donc environ 840 litres par an, donc 2 400 MJ.
 
+ - Ma part dans la facture télécoms familiale, internet plus téléphonie
+   mobile, est d'environ 5000 yens.  Je n'ai aucune idée précise de la quantité
+   d'énergie utilisée.  Mais on peut estimer une limite supérieure: si cet
+   argent était entièrement dépensé en électricité par les opérateurs, et qu'ils
+   la payaient au même prix que nous cela ferait environ
+   160 kWh, ou environ 600 MJ.  Dans la pratique, ils ont d'autre coûts, et on
+   se situe probablement à un dixième ou moins du maximum.  Bien
+   entendu, ces chiffres ne tiennent pas compte du fait que côté centres de
+   données qui nous fournissent le « contenu », la dépense énergétique est énorme.
+
+ - Je consomme entre 6 et 7 mètres cubes d'eau par mois pour un prix d'environ
+   1000 yens, qui include la production et le retraitement.  Un rapport de
+   l'observatoire de l'eau de la Seine-et-Marne, de 2016, estime entre 1.6 et 16 %
+   la part énergétique de la facture d'eau.  En extrapolant avec ma facture
+   d'électricité, 100 yens font environ 11 MJ.  L'eau est précieuse et les effets
+   de son gaspillage sont différents de ceux du gaspillage de l'énergie.

Café
diff --git a/biblio/10.3354_meps301149.mdwn b/biblio/10.3354_meps301149.mdwn
new file mode 100644
index 00000000..e67bca81
--- /dev/null
+++ b/biblio/10.3354_meps301149.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Influence of body mass, food concentration, temperature and filtering activity on the oxygen uptake of the appendicularian Oikopleura dioica"]]
+[[!tag Oikopleura]]
+
+Fabien Lombard, Antoine Sciandra and Gabriel Gorsky
+
+MEPS 301:149-158 (2005) doi:10.3354/meps301149 
+
+Influence of body mass, food concentration, temperature and filtering activity on the oxygen uptake of the appendicularian Oikopleura dioica
+
+[[!doi 10.3354/meps301149 desc="Using the Bergen lab strain.  Culture at 15 ± 1°C.  Fed with _Isochrisis galbana_ and _Thalassiosira pseudonana_.  Food was lyophilised for oxygen measurements, so that it does not respirate.  Animals with new house and empty stomach were used in the experiments.  Animals and food were placed in oxygen-saturated water, and the remaining oxygen was measured with a polaro-graphic oxygen meter at the end of the experiment.  Some animals wer aesthetized with tricaine methanesulfonate (Sandoz MS-222).  Animals receiving more food consume more oxygen, but also become larger.  After correction for body weight, food concentration did not influence respiration.  Anesthesia reduces respiration by 33%.  Animals consume more oxygen at 22°C than at 15°C."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 246fb151..3ef6ee5b 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -487,6 +487,9 @@ Physiology
    (2005)|biblio/10.1111_j.1744-7410.2001.tb00038.x]]).
  - Yellow color can be caused by bacterial infection.  [[Flood (1991)|biblio/24817302]]
    observed rod-shaped bacteria (0.6 or 0.4 µm-wide) in _O. doica_ or _O. vanhoeffeni_.
+ - Oxygen consumption increases with temperature (15°C vs 22°C) and activity (anesthesised
+   vs control animals).  It scales with body weigth, and not with food concentration after
+   correcting for body weight ([[Lombard, Sciandra and Gorsky, 2005|biblio/10.3354_meps301149]]).
 
 House
 -----

Published
diff --git a/biblio/10.1007_978-3-030-74432-8_11.mdwn b/biblio/10.1007_978-3-030-74432-8_11.mdwn
new file mode 100644
index 00000000..56b5705a
--- /dev/null
+++ b/biblio/10.1007_978-3-030-74432-8_11.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Improved DNA-versus-Protein Homology Search for Protein Fossils"]]
+[[!tag LAST repeat]]
+
+Yin Yao, Martin C. Frith
+
+In: Martín-Vide C., Vega-Rodríguez M.A., Wheeler T. (eds) Algorithms for Computational Biology. AlCoB 2021. Lecture Notes in Computer Science, vol 12715. Springer, Cham. DOI:10.1007/978-3-030-74432-8_11
+
+Improved DNA-versus-Protein Homology Search for Protein Fossils
+
+[[!doi 10.1007/978-3-030-74432-8_11 desc="Uses a 64 x 21 substitution matrix and automatically learns the genetic code.  Detected fossils of the polinton and DIRS/Ngaro repeat elements in the human genome.  10 times faster than blastx."]]
diff --git a/biblio/10.1101_2021.01.25.428050.mdwn b/biblio/10.1101_2021.01.25.428050.mdwn
deleted file mode 100644
index b9592bb0..00000000
--- a/biblio/10.1101_2021.01.25.428050.mdwn
+++ /dev/null
@@ -1,10 +0,0 @@
-[[!meta title="Improved DNA-versus-Protein Homology Search for Protein Fossils"]]
-[[!tag bioRxiv LAST repeat]]
-
-Yin Yao, Martin C. Frith
-
-bioRxiv 2021.01.25.428050; doi: https://doi.org/10.1101/2021.01.25.428050
-
-Improved DNA-versus-Protein Homology Search for Protein Fossils
-
-[[!doi 10.1101/2021.01.25.428050 desc="Uses a 64 x 21 substitution matrix and automatically learns the genetic code.  Detected fossils of the polinton and DIRS/Ngaro repeat elements in the human genome.  10 times faster than blastx."]]

Café
diff --git a/biblio/10.1101_2022.03.01.482560.mdwn b/biblio/10.1101_2022.03.01.482560.mdwn
new file mode 100644
index 00000000..52525776
--- /dev/null
+++ b/biblio/10.1101_2022.03.01.482560.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Global ecological and biogeochemical impacts of pelagic tunicates"]]
+[[!tag bioRxiv]]
+
+Jessica Y Luo, Charles A. Stock, Natasha Henschke, John P. Dunne and Todd D. O'Brien
+
+Posted March 04, 2022.
+
+Global ecological and biogeochemical impacts of pelagic tunicates
+
+[[!doi 10.1101/2022.03.01.482560 desc="“Our results suggest that pelagic tunicates play important trophic roles in both directly competing with microzooplankton and indirectly shunting carbon export away from the microbial loop.”"]]

Café
diff --git a/biblio/35239377.mdwn b/biblio/35239377.mdwn
new file mode 100644
index 00000000..2a385643
--- /dev/null
+++ b/biblio/35239377.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Transcriptional neighborhoods regulate transcript isoform lengths and expression levels."]]
+[[!tag yeast synthetic variants]]
+
+Brooks AN, Hughes AL, Clauder-Münster S, Mitchell LA, Boeke JD, Steinmetz LM.
+
+Science. 2022 Mar 4;375(6584):1000-1005. doi: 10.1126/science.abg0162
+
+Transcriptional neighborhoods regulate transcript isoform lengths and expression levels.
+
+[[!pmid 35239377 desc="“a synthetic yeast genome (Sc2.0) was designed to encode a Cre-dependent system known as synthetic chromosome rearrangement and modification by LoxP-mediated evolution (SCRaMbLE), which can generate stochastic genomic rearrangements on demand directly in its genome. These rearrangements occur at 34 base pair (bp)–loxPsym sites inserted 3 bp downstream of the stop codon of all nonessential CDSs.”"]]
diff --git a/tags/synthetic.mdwn b/tags/synthetic.mdwn
index 06d8d9a3..009c3613 100644
--- a/tags/synthetic.mdwn
+++ b/tags/synthetic.mdwn
@@ -8,4 +8,6 @@ Sc3.0 roadmap: [[Dai and coll., 2020|biblio/32791980]].
 
 Example of neochromosome synthesis in yeast: [[Postma and coll., 2021|biblio/33423048]].
 
+Artificial genome scrambling in yeast 2.0 with loxPsym sites: [[Brooks and coll, 2022|biblio/35239377]].
+
 [[!inline pages="tagged(synthethic)" limit=0]]

updated PO files
diff --git a/Joules.en.po b/Joules.en.po
index 54fdea53..b75dae18 100644
--- a/Joules.en.po
+++ b/Joules.en.po
@@ -7,7 +7,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2022-02-27 07:07+0000\n"
+"POT-Creation-Date: 2022-03-03 12:24+0000\n"
 "PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
 "Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
 "Language-Team: LANGUAGE <LL@li.org>\n"
@@ -72,3 +72,40 @@ msgid ""
 "déduis que je consomme environ 300 MJ par mois.  Reste à savoir: l'énergie "
 "dépensée pour me fournir cette nourriture…"
 msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"Pour nous chauffer et nous rafraîchir, pour utiliser nos appareils électro-"
+"ménagers, et nos médias à écrans, nous consommons environ 300 kWh "
+"d'électricité par mois.  Mettons que ça fait 100 pour moi.  Une puissance de "
+"1 Watt, c'est 1 Joule par seconde.  Donc 100 kWh font 360 MJ.  Une grande "
+"partie de cette énergie provient de centrales à charbon et il faut de "
+"l'énergie pour l'extraire et le transporter.  Une partie de l'électricité "
+"produite se dissipe en chaleur dans le réseau électrique.  Ma consommation "
+"réelle est donc supérieure à ce que m'annonce le compteur."
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"Pour cuisiner, chauffer notre eau de lavage, et sécher nos habits, nous "
+"utilisons environ 12 mètres cube de gaz par mois, donc 4 pour ma part.  Il "
+"existe différents types de gaz domestique, et une partie de l'énergie "
+"dégagée par la combustion se perd par l'émission de vapeur d'eau.  Les "
+"chiffres donnés sur Wikipédia sont pour une température ambiante de zéro "
+"degrés, ce qui n'est pas le cas dans notre appartement.  Néanmoins, une "
+"estimation à un chiffre significatif de 40 MJ par mètre cube paraît "
+"acceptable.  Donc 160 MJ pour ma consommation mensuelle.  Et comme pour les "
+"autres énergies, je ne sais pas combien d'énergie supplémentaire il faut "
+"dépenser pour me fournir ce gaz."
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"On estime la consommation des avions modernes entre 2 et 4 litres de "
+"kérosène par 100 kilomètres et par passager.  Son pouvoir calorifique n'est "
+"pas très différent ce celui de l'essence de nos voitures, mettons 34 MJ par "
+"litre (43 MJ/kg pour densité de 0.8).  La différence avec la voiture, c'est "
+"qu'on fait beaucoup plus de kilomètres en avion.  Je fais environ un voyage "
+"intercontinental (20 000 km) et quatre voyages domestiques entre Okinawa et "
+"Tôkyô (4 × 2000 km).  Donc environ 840 litres par an, donc 2 400 MJ."
+msgstr ""

France is in the air...
diff --git a/Joules.md b/Joules.md
index 1515c7d2..6f771d73 100644
--- a/Joules.md
+++ b/Joules.md
@@ -44,12 +44,20 @@ Framapiaf.
 
  - Pour cuisiner, chauffer notre eau de lavage, et sécher nos habits, nous
    utilisons environ 12 mètres cube de gaz par mois, donc 4 pour ma part.
-   Il existe différents types de gaz domesique, et une partie de l'énergie
-   dégagée par la combusion se perd par l'émission de vapeur d'eau.  Les chiffres
+   Il existe différents types de gaz domestique, et une partie de l'énergie
+   dégagée par la combustion se perd par l'émission de vapeur d'eau.  Les chiffres
    donnés sur Wikipédia sont pour une température ambiante de zéro degrés, ce
-   qui n'est pas le cas dans notre apppartement.  Néanmoins, une estimation à un
+   qui n'est pas le cas dans notre appartement.  Néanmoins, une estimation à un
    chiffre significatif de 40 MJ par mètre cube paraît acceptable.  Donc 160 MJ
    pour ma consommation mensuelle.  Et comme pour les autres énergies, je ne
    sais pas combien d'énergie supplémentaire il faut dépenser pour me fournir
    ce gaz.
 
+ - On estime la consommation des avions modernes entre 2 et 4 litres de
+   kérosène par 100 kilomètres et par passager.  Son pouvoir calorifique n'est
+   pas très différent ce celui de l'essence de nos voitures, mettons 34 MJ par
+   litre (43 MJ/kg pour densité de 0.8).  La différence avec la voiture, c'est
+   qu'on fait beaucoup plus de kilomètres en avion.  Je fais environ un voyage
+   intercontinental (20 000 km) et quatre voyages domestiques entre Okinawa et
+   Tôkyô (4 × 2000 km).  Donc environ 840 litres par an, donc 2 400 MJ.
+

Et le gaz ? -- Lofofora, Holidays in France
diff --git a/Joules.md b/Joules.md
index 07265368..1515c7d2 100644
--- a/Joules.md
+++ b/Joules.md
@@ -42,3 +42,14 @@ Framapiaf.
    dissipe en chaleur dans le réseau électrique.  Ma consommation réelle est donc
    supérieure à ce que m'annonce le compteur.
 
+ - Pour cuisiner, chauffer notre eau de lavage, et sécher nos habits, nous
+   utilisons environ 12 mètres cube de gaz par mois, donc 4 pour ma part.
+   Il existe différents types de gaz domesique, et une partie de l'énergie
+   dégagée par la combusion se perd par l'émission de vapeur d'eau.  Les chiffres
+   donnés sur Wikipédia sont pour une température ambiante de zéro degrés, ce
+   qui n'est pas le cas dans notre apppartement.  Néanmoins, une estimation à un
+   chiffre significatif de 40 MJ par mètre cube paraît acceptable.  Donc 160 MJ
+   pour ma consommation mensuelle.  Et comme pour les autres énergies, je ne
+   sais pas combien d'énergie supplémentaire il faut dépenser pour me fournir
+   ce gaz.
+

Électricité
diff --git a/Joules.md b/Joules.md
index 885a50ce..07265368 100644
--- a/Joules.md
+++ b/Joules.md
@@ -32,3 +32,13 @@ Framapiaf.
    En approximant ça à ma consommation quotidienne, j'en déduis que je consomme
    environ 300 MJ par mois.  Reste à savoir: l'énergie dépensée pour me fournir
    cette nourriture…
+
+ - Pour nous chauffer et nous rafraîchir, pour utiliser nos appareils
+   électro-ménagers, et nos médias à écrans, nous consommons environ 300 kWh
+   d'électricité par mois.  Mettons que ça fait 100 pour moi.  Une puissance de
+   1 Watt, c'est 1 Joule par seconde.  Donc 100 kWh font 360 MJ.  Une grande
+   partie de cette énergie provient de centrales à charbon et il faut de l'énergie
+   pour l'extraire et le transporter.  Une partie de l'électricité produite se
+   dissipe en chaleur dans le réseau électrique.  Ma consommation réelle est donc
+   supérieure à ce que m'annonce le compteur.
+

updated PO files
diff --git a/Joules.en.po b/Joules.en.po
index 4df4876e..54fdea53 100644
--- a/Joules.en.po
+++ b/Joules.en.po
@@ -7,7 +7,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2022-02-26 12:58+0000\n"
+"POT-Creation-Date: 2022-02-27 07:07+0000\n"
 "PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
 "Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
 "Language-Team: LANGUAGE <LL@li.org>\n"
@@ -58,3 +58,17 @@ msgid ""
 "mois, avec une voiture parcourant 25 kilomètres par litre, ça fait 24 litres "
 "par mois, donc environ 800 MJ par mois."
 msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"Je n'ai aucune idée précise de la quantité d'énergie que j'ingère chaque "
+"jour.  Mon pèse-personne, calibré pour une masse corporelle japonaise, me "
+"recommande de manger 1700 kilocalories par jour.  C'est gross-modo mon "
+"métabolisme de base d'après les chiffres résumés par l'ANSES dans on avis "
+"suivant la saisine 2012-SA-0103.  Dans ce même document, les besoins d'un "
+"homme de mon age « modérément actif » sont un peu au dessus de 2500 kcal par "
+"jour.  Une calorie vaut environ 4.2 Joules.  10 000 kJoules valent un peu "
+"moins de 2400 kcal.  En approximant ça à ma consommation quotidienne, j'en "
+"déduis que je consomme environ 300 MJ par mois.  Reste à savoir: l'énergie "
+"dépensée pour me fournir cette nourriture…"
+msgstr ""

Bouf
diff --git a/Joules.md b/Joules.md
index 86213c61..885a50ce 100644
--- a/Joules.md
+++ b/Joules.md
@@ -21,3 +21,14 @@ Framapiaf.
  - Je roule 30 kilomètres par jour pour aller travailler, environ 20 jours par
    mois, avec une voiture parcourant 25 kilomètres par litre, ça fait 24 litres
    par mois, donc environ 800 MJ par mois.
+
+ - Je n'ai aucune idée précise de la quantité d'énergie que j'ingère chaque jour.
+   Mon pèse-personne, calibré pour une masse corporelle japonaise, me recommande de
+   manger 1700 kilocalories par jour.  C'est gross-modo mon métabolisme de base
+   d'après les chiffres résumés par l'ANSES dans on avis suivant la saisine
+   2012-SA-0103.  Dans ce même document, les besoins d'un homme de mon age
+   « modérément actif » sont un peu au dessus de 2500 kcal par jour.  Une calorie
+   vaut environ 4.2 Joules.  10 000 kJoules valent un peu moins de 2400 kcal.
+   En approximant ça à ma consommation quotidienne, j'en déduis que je consomme
+   environ 300 MJ par mois.  Reste à savoir: l'énergie dépensée pour me fournir
+   cette nourriture…

updated PO files
diff --git a/Joules.en.po b/Joules.en.po
index 3ec68754..4df4876e 100644
--- a/Joules.en.po
+++ b/Joules.en.po
@@ -7,7 +7,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2022-02-26 12:05+0000\n"
+"POT-Creation-Date: 2022-02-26 12:58+0000\n"
 "PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
 "Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
 "Language-Team: LANGUAGE <LL@li.org>\n"
@@ -31,19 +31,30 @@ msgstr ""
 msgid ""
 "On estime souvent l'énergie consommée en unités différentes suivant le "
 "contexte: calories pour la nourriture ou kilowatt-heures pour l'électricité, "
-"et on n'a pas l'habiture d'estimer quelle quantité d'énergie on a retiré "
+"et on n'a pas l'habitude d'estimer quelle quantité d'énergie on a retiré "
 "d'un litre d'essence ou d'un mètre cube de gaz…"
 msgstr ""
 
 #. type: Plain text
-msgid "Ici je vais tout convertir en joules, pour mieux comparer."
+msgid ""
+"Ici je vais tout convertir en [Joules](https://fr.wikipedia.org/wiki/Joule), "
+"l'unité du Système International, pour mieux comparer.  Je vais poster "
+"chacun de mes calculs avec le tag [#Joules](https://framapiaf.org/tags/"
+"Joules) sur Framapiaf."
 msgstr ""
 
 #. type: Bullet: ' - '
 msgid ""
 "« _L'énergie contenue dans l'essence est d'environ 33 600 000 joules par "
 "litre, ou 46 700 000 joules par kilogramme (de pouvoir calorifique "
-"supérieur)._ » "
-"([Wikipedia](https://fr.wikipedia.org/wiki/Essence_(hydrocarbure)).  Reste à "
-"savoir: l'énergie consommée pour produire ce litre d'essence…"
+"supérieur)._ » ([Wikipedia](https://fr.wikipedia.org/wiki/"
+"Essence_(hydrocarbure)).  Reste à savoir: l'énergie consommée pour produire "
+"ce litre d'essence…"
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"Je roule 30 kilomètres par jour pour aller travailler, environ 20 jours par "
+"mois, avec une voiture parcourant 25 kilomètres par litre, ça fait 24 litres "
+"par mois, donc environ 800 MJ par mois."
 msgstr ""

En voiture !
diff --git a/Joules.md b/Joules.md
index 0a67e5f1..86213c61 100644
--- a/Joules.md
+++ b/Joules.md
@@ -5,12 +5,19 @@ _(Rédaction en progrès)_
 
 On estime souvent l'énergie consommée en unités différentes suivant le
 contexte: calories pour la nourriture ou kilowatt-heures pour l'électricité, et
-on n'a pas l'habiture d'estimer quelle quantité d'énergie on a retiré d'un
+on n'a pas l'habitude d'estimer quelle quantité d'énergie on a retiré d'un
 litre d'essence ou d'un mètre cube de gaz…
 
-Ici je vais tout convertir en joules, pour mieux comparer.
+Ici je vais tout convertir en [Joules](https://fr.wikipedia.org/wiki/Joule),
+l'unité du Système International, pour mieux comparer.  Je vais poster chacun
+de mes calculs avec le tag [#Joules](https://framapiaf.org/tags/Joules) sur
+Framapiaf.
 
  - « _L'énergie contenue dans l'essence est d'environ 33 600 000 joules par
    litre, ou 46 700 000 joules par kilogramme (de pouvoir calorifique
    supérieur)._ » ([Wikipedia](https://fr.wikipedia.org/wiki/Essence_(hydrocarbure)).
    Reste à savoir: l'énergie consommée pour produire ce litre d'essence…
+
+ - Je roule 30 kilomètres par jour pour aller travailler, environ 20 jours par
+   mois, avec une voiture parcourant 25 kilomètres par litre, ça fait 24 litres
+   par mois, donc environ 800 MJ par mois.

updated PO files
diff --git a/Joules.en.po b/Joules.en.po
new file mode 100644
index 00000000..3ec68754
--- /dev/null
+++ b/Joules.en.po
@@ -0,0 +1,49 @@
+# SOME DESCRIPTIVE TITLE
+# Copyright (C) YEAR Free Software Foundation, Inc.
+# This file is distributed under the same license as the PACKAGE package.
+# FIRST AUTHOR <EMAIL@ADDRESS>, YEAR.
+#
+#, fuzzy
+msgid ""
+msgstr ""
+"Project-Id-Version: PACKAGE VERSION\n"
+"POT-Creation-Date: 2022-02-26 12:05+0000\n"
+"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
+"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
+"Language-Team: LANGUAGE <LL@li.org>\n"
+"Language: \n"
+"MIME-Version: 1.0\n"
+"Content-Type: text/plain; charset=UTF-8\n"
+"Content-Transfer-Encoding: 8bit\n"
+
+#. type: Plain text
+#, no-wrap
+msgid ""
+"Ma consommation énergétique en joules\n"
+"=====================================\n"
+msgstr ""
+
+#. type: Plain text
+msgid "_(Rédaction en progrès)_"
+msgstr ""
+
+#. type: Plain text
+msgid ""
+"On estime souvent l'énergie consommée en unités différentes suivant le "
+"contexte: calories pour la nourriture ou kilowatt-heures pour l'électricité, "
+"et on n'a pas l'habiture d'estimer quelle quantité d'énergie on a retiré "
+"d'un litre d'essence ou d'un mètre cube de gaz…"
+msgstr ""
+
+#. type: Plain text
+msgid "Ici je vais tout convertir en joules, pour mieux comparer."
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"« _L'énergie contenue dans l'essence est d'environ 33 600 000 joules par "
+"litre, ou 46 700 000 joules par kilogramme (de pouvoir calorifique "
+"supérieur)._ » "
+"([Wikipedia](https://fr.wikipedia.org/wiki/Essence_(hydrocarbure)).  Reste à "
+"savoir: l'énergie consommée pour produire ce litre d'essence…"
+msgstr ""

Ma consommation énergétique.
diff --git a/Joules.md b/Joules.md
new file mode 100644
index 00000000..0a67e5f1
--- /dev/null
+++ b/Joules.md
@@ -0,0 +1,16 @@
+Ma consommation énergétique en joules
+=====================================
+
+_(Rédaction en progrès)_
+
+On estime souvent l'énergie consommée en unités différentes suivant le
+contexte: calories pour la nourriture ou kilowatt-heures pour l'électricité, et
+on n'a pas l'habiture d'estimer quelle quantité d'énergie on a retiré d'un
+litre d'essence ou d'un mètre cube de gaz…
+
+Ici je vais tout convertir en joules, pour mieux comparer.
+
+ - « _L'énergie contenue dans l'essence est d'environ 33 600 000 joules par
+   litre, ou 46 700 000 joules par kilogramme (de pouvoir calorifique
+   supérieur)._ » ([Wikipedia](https://fr.wikipedia.org/wiki/Essence_(hydrocarbure)).
+   Reste à savoir: l'énergie consommée pour produire ce litre d'essence…

Merge remote-tracking branch 'refs/remotes/origin/master'
E
diff --git "a/Debian/debi\303\242neries/media-types-2022.en.po" "b/Debian/debi\303\242neries/media-types-2022.en.po"
index f67714cc..e21800fd 100644
--- "a/Debian/debi\303\242neries/media-types-2022.en.po"
+++ "b/Debian/debi\303\242neries/media-types-2022.en.po"
@@ -7,7 +7,7 @@ msgid ""
 msgstr ""
 "Project-Id-Version: \n"
 "POT-Creation-Date: 2022-02-24 13:10+0000\n"
-"PO-Revision-Date: 2022-02-24 22:01+0900\n"
+"PO-Revision-Date: 2022-02-24 22:12+0900\n"
 "Last-Translator: \n"
 "Language-Team: \n"
 "Language: en\n"
@@ -32,25 +32,11 @@ msgid "[[!tag Debian]]\n"
 msgstr "[[!tag Debian]]\n"
 
 #. type: Plain text
-#, fuzzy, no-wrap
-#| msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
+#, no-wrap
 msgid "[[!meta title=\"Types media, cuvée 2022.\"]]\n"
 msgstr "[[!meta title=\"New media types in 2022\"]]\n"
 
 #. type: Plain text
-#, fuzzy
-#| msgid ""
-#| "En début d'année j'ai mis à jour une centaine de [types de media]"
-#| "(https://fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des "
-#| "extensions de nom de fichier dans le fichier `/etc/mine.types`, "
-#| "distribué par le paquet [[!debpkg media-types]].  La plupart des "
-#| "[changements](https://metadata.ftp-master.debian.org/changelogs//main/m/"
-#| "media-types/media-types_5.0.0_changelog)  sont des additions en "
-#| "provenance des déclarations récentes à'[IANA](https://www.iana.org/"
-#| "assignments/media-types).  Les thèmes les plus répendus sont les "
-#| "télécomunications, la sécurité informatique, le commerce, la santé, "
-#| "et l'automatisation industrielle.  L'énorme majorité provient du monde "
-#| "occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
 msgid ""
 "En début d'année j'ai mis à jour une centaine de [types de media](https://fr."
 "wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de nom de "

updated PO files
diff --git "a/Debian/debi\303\242neries/media-types-2022.en.po" "b/Debian/debi\303\242neries/media-types-2022.en.po"
index f67714cc..da6e3db4 100644
--- "a/Debian/debi\303\242neries/media-types-2022.en.po"
+++ "b/Debian/debi\303\242neries/media-types-2022.en.po"
@@ -6,7 +6,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: \n"
-"POT-Creation-Date: 2022-02-24 13:10+0000\n"
+"POT-Creation-Date: 2022-02-24 13:12+0000\n"
 "PO-Revision-Date: 2022-02-24 22:01+0900\n"
 "Last-Translator: \n"
 "Language-Team: \n"
@@ -54,7 +54,7 @@ msgstr "[[!meta title=\"New media types in 2022\"]]\n"
 msgid ""
 "En début d'année j'ai mis à jour une centaine de [types de media](https://fr."
 "wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de nom de "
-"fichier dans le fichier `/etc/mine.types`, distribué par le paquet [[!debpkg "
+"fichier dans le fichier `/etc/mime.types`, distribué par le paquet [[!debpkg "
 "media-types]].  La plupart des [changements](https://metadata.ftp-master."
 "debian.org/changelogs//main/m/media-types/media-types_5.0.0_changelog)  sont "
 "des additions en provenance des déclarations récentes à'[IANA](https://www."

Typo
diff --git "a/Debian/debi\303\242neries/media-types-2022.mdwn" "b/Debian/debi\303\242neries/media-types-2022.mdwn"
index 5e60f21a..9db316d0 100644
--- "a/Debian/debi\303\242neries/media-types-2022.mdwn"
+++ "b/Debian/debi\303\242neries/media-types-2022.mdwn"
@@ -6,7 +6,7 @@
 
 En début d'année j'ai mis à jour une centaine de [types de
 media](https://fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des
-extensions de nom de fichier dans le fichier `/etc/mine.types`, distribué
+extensions de nom de fichier dans le fichier `/etc/mime.types`, distribué
 par le paquet [[!debpkg media-types]].  La plupart des
 [changements](https://metadata.ftp-master.debian.org/changelogs//main/m/media-types/media-types_5.0.0_changelog)
 sont des additions en provenance des déclarations récentes

updated PO files
diff --git "a/Debian/debi\303\242neries/media-types-2022.en.po" "b/Debian/debi\303\242neries/media-types-2022.en.po"
index dd75779f..f67714cc 100644
--- "a/Debian/debi\303\242neries/media-types-2022.en.po"
+++ "b/Debian/debi\303\242neries/media-types-2022.en.po"
@@ -6,7 +6,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: \n"
-"POT-Creation-Date: 2022-02-24 13:02+0000\n"
+"POT-Creation-Date: 2022-02-24 13:10+0000\n"
 "PO-Revision-Date: 2022-02-24 22:01+0900\n"
 "Last-Translator: \n"
 "Language-Team: \n"
@@ -34,7 +34,7 @@ msgstr "[[!tag Debian]]\n"
 #. type: Plain text
 #, fuzzy, no-wrap
 #| msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
-msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
+msgid "[[!meta title=\"Types media, cuvée 2022.\"]]\n"
 msgstr "[[!meta title=\"New media types in 2022\"]]\n"
 
 #. type: Plain text

Espace blanc.
diff --git "a/Debian/debi\303\242neries/media-types-2022.mdwn" "b/Debian/debi\303\242neries/media-types-2022.mdwn"
index 6881159a..5e60f21a 100644
--- "a/Debian/debi\303\242neries/media-types-2022.mdwn"
+++ "b/Debian/debi\303\242neries/media-types-2022.mdwn"
@@ -2,12 +2,12 @@
 [[!meta updated="Thu, 24 Feb 2022 21:32:36 +0900"]]
 [[!tag Debian]]
 
-[[!meta title="Types media, cuvée 2022"]]
+[[!meta title="Types media, cuvée 2022."]]
 
 En début d'année j'ai mis à jour une centaine de [types de
 media](https://fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des
-extensions de nom de fichier dans le fichier `/etc/mine.types`, distribué par
-le paquet [[!debpkg media-types]].  La plupart des
+extensions de nom de fichier dans le fichier `/etc/mine.types`, distribué
+par le paquet [[!debpkg media-types]].  La plupart des
 [changements](https://metadata.ftp-master.debian.org/changelogs//main/m/media-types/media-types_5.0.0_changelog)
 sont des additions en provenance des déclarations récentes
 à'[IANA](https://www.iana.org/assignments/media-types).  Les thèmes les plus

updated PO files
diff --git "a/Debian/debi\303\242neries/media-types-2022.en.po" "b/Debian/debi\303\242neries/media-types-2022.en.po"
index ea368732..dd75779f 100644
--- "a/Debian/debi\303\242neries/media-types-2022.en.po"
+++ "b/Debian/debi\303\242neries/media-types-2022.en.po"
@@ -6,7 +6,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: \n"
-"POT-Creation-Date: 2022-02-24 12:59+0000\n"
+"POT-Creation-Date: 2022-02-24 13:02+0000\n"
 "PO-Revision-Date: 2022-02-24 22:01+0900\n"
 "Last-Translator: \n"
 "Language-Team: \n"
@@ -32,23 +32,36 @@ msgid "[[!tag Debian]]\n"
 msgstr "[[!tag Debian]]\n"
 
 #. type: Plain text
-#, no-wrap
-msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
+#, fuzzy, no-wrap
+#| msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
+msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
 msgstr "[[!meta title=\"New media types in 2022\"]]\n"
 
 #. type: Plain text
+#, fuzzy
+#| msgid ""
+#| "En début d'année j'ai mis à jour une centaine de [types de media]"
+#| "(https://fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des "
+#| "extensions de nom de fichier dans le fichier `/etc/mine.types`, "
+#| "distribué par le paquet [[!debpkg media-types]].  La plupart des "
+#| "[changements](https://metadata.ftp-master.debian.org/changelogs//main/m/"
+#| "media-types/media-types_5.0.0_changelog)  sont des additions en "
+#| "provenance des déclarations récentes à'[IANA](https://www.iana.org/"
+#| "assignments/media-types).  Les thèmes les plus répendus sont les "
+#| "télécomunications, la sécurité informatique, le commerce, la santé, "
+#| "et l'automatisation industrielle.  L'énorme majorité provient du monde "
+#| "occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
 msgid ""
-"En début d'année j'ai mis à jour une centaine de [types de media](https://"
-"fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de "
-"nom de fichier dans le fichier `/etc/mine.types`, distribué par le paquet "
-"[[!debpkg media-types]].  La plupart des [changements](https://metadata.ftp-"
-"master.debian.org/changelogs//main/m/media-types/media-"
-"types_5.0.0_changelog)  sont des additions en provenance des déclarations "
-"récentes à'[IANA](https://www.iana.org/assignments/media-types).  Les "
-"thèmes les plus répendus sont les télécomunications, la sécurité "
-"informatique, le commerce, la santé, et l'automatisation industrielle.  "
-"L'énorme majorité provient du monde occidental.  Le reste du monde a-t-il "
-"décidé d'avancer sans nous ?"
+"En début d'année j'ai mis à jour une centaine de [types de media](https://fr."
+"wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de nom de "
+"fichier dans le fichier `/etc/mine.types`, distribué par le paquet [[!debpkg "
+"media-types]].  La plupart des [changements](https://metadata.ftp-master."
+"debian.org/changelogs//main/m/media-types/media-types_5.0.0_changelog)  sont "
+"des additions en provenance des déclarations récentes à'[IANA](https://www."
+"iana.org/assignments/media-types).  Les thèmes les plus répendus sont les "
+"télécomunications, la sécurité informatique, le commerce, la santé, et "
+"l'automatisation industrielle.  L'énorme majorité provient du monde "
+"occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
 msgstr ""
 "At the beginning of this year I updated a hundred of [media types](https://"
 "en.wikipedia.org/wiki/Media_type) associated with file name extensions in "

Eng
diff --git "a/Debian/debi\303\242neries/media-types-2022.en.po" "b/Debian/debi\303\242neries/media-types-2022.en.po"
index f6d1d003..ea368732 100644
--- "a/Debian/debi\303\242neries/media-types-2022.en.po"
+++ "b/Debian/debi\303\242neries/media-types-2022.en.po"
@@ -7,7 +7,7 @@ msgid ""
 msgstr ""
 "Project-Id-Version: \n"
 "POT-Creation-Date: 2022-02-24 12:59+0000\n"
-"PO-Revision-Date: 2022-02-24 21:46+0900\n"
+"PO-Revision-Date: 2022-02-24 22:01+0900\n"
 "Last-Translator: \n"
 "Language-Team: \n"
 "Language: en\n"
@@ -32,23 +32,11 @@ msgid "[[!tag Debian]]\n"
 msgstr "[[!tag Debian]]\n"
 
 #. type: Plain text
-#, fuzzy, no-wrap
-#| msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
+#, no-wrap
 msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
 msgstr "[[!meta title=\"New media types in 2022\"]]\n"
 
 #. type: Plain text
-#, fuzzy
-#| msgid ""
-#| "En début d'année j'ai mis à jour une centaine de [types de media](https://"
-#| "fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de "
-#| "nom de fichier dans le fichier `/etc/media.types`, distribué par le "
-#| "paquet [[!debpkg media-types]].  La plupart des changements sont des "
-#| "additions en provenance des déclarations récentes à'[IANA](https://www."
-#| "iana.org/assignments/media-types).  Les thèmes les plus répendus sont les "
-#| "télécomunications, la sécurité informatique, le commerce, la santé, et "
-#| "l'automatisation industrielle.  L'énorme majorité provient du monde "
-#| "occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
 msgid ""
 "En début d'année j'ai mis à jour une centaine de [types de media](https://"
 "fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de "
@@ -65,9 +53,10 @@ msgstr ""
 "At the beginning of this year I updated a hundred of [media types](https://"
 "en.wikipedia.org/wiki/Media_type) associated with file name extensions in "
 "the file called `/etc/mime.types`, distributed by the [[!debpkg media-"
-"types]] package.  Most changes are additions originating from recent "
-"submissions to the [IANA](https://www.iana.org/assignments/media-types). "
-"Amon the themes that caught my attention, there are telecommunications, "
-"computer security, commerce, healthcare and industrial automation. The vast "
-"majority of the update come from western provenance.  Did the rest of the "
-"World decide to move ahead without us?"
+"types]] package.  Most [changes](https://metadata.ftp-master.debian.org/"
+"changelogs//main/m/media-types/media-types_5.0.0_changelog) are additions "
+"originating from recent submissions to the [IANA](https://www.iana.org/"
+"assignments/media-types). Amon the themes that caught my attention, there "
+"are telecommunications, computer security, commerce, healthcare and "
+"industrial automation. The vast majority of the update come from western "
+"provenance.  Did the rest of the World decide to move ahead without us?"

updated PO files
diff --git "a/Debian/debi\303\242neries/media-types-2022.en.po" "b/Debian/debi\303\242neries/media-types-2022.en.po"
index e201148d..f6d1d003 100644
--- "a/Debian/debi\303\242neries/media-types-2022.en.po"
+++ "b/Debian/debi\303\242neries/media-types-2022.en.po"
@@ -6,7 +6,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: \n"
-"POT-Creation-Date: 2022-02-24 12:48+0000\n"
+"POT-Creation-Date: 2022-02-24 12:59+0000\n"
 "PO-Revision-Date: 2022-02-24 21:46+0900\n"
 "Last-Translator: \n"
 "Language-Team: \n"
@@ -52,13 +52,15 @@ msgstr "[[!meta title=\"New media types in 2022\"]]\n"
 msgid ""
 "En début d'année j'ai mis à jour une centaine de [types de media](https://"
 "fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de "
-"nom de fichier dans le fichier `/etc/media.types`, distribué par le paquet "
-"[[!debpkg media-types]].  La plupart des changements sont des additions en "
-"provenance des déclarations récentes à'[IANA](https://www.iana.org/"
-"assignments/media-types).  Les thèmes les plus répendus sont les "
-"télécomunications, la sécurité informatique, le commerce, la santé, et "
-"l'automatisation industrielle.  L'énorme majorité provient du monde "
-"occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
+"nom de fichier dans le fichier `/etc/mine.types`, distribué par le paquet "
+"[[!debpkg media-types]].  La plupart des [changements](https://metadata.ftp-"
+"master.debian.org/changelogs//main/m/media-types/media-"
+"types_5.0.0_changelog)  sont des additions en provenance des déclarations "
+"récentes à'[IANA](https://www.iana.org/assignments/media-types).  Les "
+"thèmes les plus répendus sont les télécomunications, la sécurité "
+"informatique, le commerce, la santé, et l'automatisation industrielle.  "
+"L'énorme majorité provient du monde occidental.  Le reste du monde a-t-il "
+"décidé d'avancer sans nous ?"
 msgstr ""
 "At the beginning of this year I updated a hundred of [media types](https://"
 "en.wikipedia.org/wiki/Media_type) associated with file name extensions in "

Correction et lien
diff --git "a/Debian/debi\303\242neries/media-types-2022.mdwn" "b/Debian/debi\303\242neries/media-types-2022.mdwn"
index 9dc8c46c..6881159a 100644
--- "a/Debian/debi\303\242neries/media-types-2022.mdwn"
+++ "b/Debian/debi\303\242neries/media-types-2022.mdwn"
@@ -6,9 +6,10 @@
 
 En début d'année j'ai mis à jour une centaine de [types de
 media](https://fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des
-extensions de nom de fichier dans le fichier `/etc/media.types`, distribué par
-le paquet [[!debpkg media-types]].  La plupart des changements sont des
-additions en provenance des déclarations récentes
+extensions de nom de fichier dans le fichier `/etc/mine.types`, distribué par
+le paquet [[!debpkg media-types]].  La plupart des
+[changements](https://metadata.ftp-master.debian.org/changelogs//main/m/media-types/media-types_5.0.0_changelog)
+sont des additions en provenance des déclarations récentes
 à'[IANA](https://www.iana.org/assignments/media-types).  Les thèmes les plus
 répendus sont les télécomunications, la sécurité informatique, le commerce, la
 santé, et l'automatisation industrielle.  L'énorme majorité provient du monde

updated PO files
diff --git "a/Debian/debi\303\242neries/media-types-2022.en.po" "b/Debian/debi\303\242neries/media-types-2022.en.po"
index e9d52ebc..e201148d 100644
--- "a/Debian/debi\303\242neries/media-types-2022.en.po"
+++ "b/Debian/debi\303\242neries/media-types-2022.en.po"
@@ -6,14 +6,14 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: \n"
-"POT-Creation-Date: 2022-02-24 12:39+0000\n"
+"POT-Creation-Date: 2022-02-24 12:48+0000\n"
 "PO-Revision-Date: 2022-02-24 21:46+0900\n"
+"Last-Translator: \n"
+"Language-Team: \n"
 "Language: en\n"
 "MIME-Version: 1.0\n"
 "Content-Type: text/plain; charset=UTF-8\n"
 "Content-Transfer-Encoding: 8bit\n"
-"Last-Translator: \n"
-"Language-Team: \n"
 "X-Generator: Poedit 2.4.2\n"
 
 #. type: Plain text
@@ -32,21 +32,33 @@ msgid "[[!tag Debian]]\n"
 msgstr "[[!tag Debian]]\n"
 
 #. type: Plain text
-#, no-wrap
-msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
+#, fuzzy, no-wrap
+#| msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
+msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
 msgstr "[[!meta title=\"New media types in 2022\"]]\n"
 
 #. type: Plain text
+#, fuzzy
+#| msgid ""
+#| "En début d'année j'ai mis à jour une centaine de [types de media](https://"
+#| "fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de "
+#| "nom de fichier dans le fichier `/etc/media.types`, distribué par le "
+#| "paquet [[!debpkg media-types]].  La plupart des changements sont des "
+#| "additions en provenance des déclarations récentes à'[IANA](https://www."
+#| "iana.org/assignments/media-types).  Les thèmes les plus répendus sont les "
+#| "télécomunications, la sécurité informatique, le commerce, la santé, et "
+#| "l'automatisation industrielle.  L'énorme majorité provient du monde "
+#| "occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
 msgid ""
-"En début d'année j'ai mis à jour une centaine de [types de media](https://fr."
-"wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de nom de "
-"fichier dans le fichier `/etc/media.types`, distribué par le paquet [[!"
-"debpkg media-types]].  La plupart des changements sont des additions en "
-"provenance des déclarations récentes à'[IANA](https://www.iana.org/"
-"assignments/media-types).  Les thèmes les plus répendus sont les "
-"télécomunications, la sécurité informatique, le commerce, la santé, et "
-"l'automatisation industrielle.  L'énorme majorité provient du monde "
-"occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
+"En début d'année j'ai mis à jour une centaine de [types de media](https://"
+"fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de "
+"nom de fichier dans le fichier `/etc/media.types`, distribué par le paquet "
+"[[!debpkg media-types]].  La plupart des changements sont des additions en "
+"provenance des déclarations récentes à'[IANA](https://www.iana.org/"
+"assignments/media-types).  Les thèmes les plus répendus sont les "
+"télécomunications, la sécurité informatique, le commerce, la santé, et "
+"l'automatisation industrielle.  L'énorme majorité provient du monde "
+"occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
 msgstr ""
 "At the beginning of this year I updated a hundred of [media types](https://"
 "en.wikipedia.org/wiki/Media_type) associated with file name extensions in "

En English
diff --git "a/Debian/debi\303\242neries/media-types-2022.en.po" "b/Debian/debi\303\242neries/media-types-2022.en.po"
index 958fd0fb..e9d52ebc 100644
--- "a/Debian/debi\303\242neries/media-types-2022.en.po"
+++ "b/Debian/debi\303\242neries/media-types-2022.en.po"
@@ -3,48 +3,57 @@
 # This file is distributed under the same license as the PACKAGE package.
 # FIRST AUTHOR <EMAIL@ADDRESS>, YEAR.
 #
-#, fuzzy
 msgid ""
 msgstr ""
-"Project-Id-Version: PACKAGE VERSION\n"
+"Project-Id-Version: \n"
 "POT-Creation-Date: 2022-02-24 12:39+0000\n"
-"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
-"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
-"Language-Team: LANGUAGE <LL@li.org>\n"
-"Language: \n"
+"PO-Revision-Date: 2022-02-24 21:46+0900\n"
+"Language: en\n"
 "MIME-Version: 1.0\n"
 "Content-Type: text/plain; charset=UTF-8\n"
 "Content-Transfer-Encoding: 8bit\n"
+"Last-Translator: \n"
+"Language-Team: \n"
+"X-Generator: Poedit 2.4.2\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!meta date=\"Thu, 24 Feb 2022 21:32:36 +0900\"]]\n"
-msgstr ""
+msgstr "[[!meta date=\"Thu, 24 Feb 2022 21:32:36 +0900\"]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!meta updated=\"Thu, 24 Feb 2022 21:32:36 +0900\"]]\n"
-msgstr ""
+msgstr "[[!meta updated=\"Thu, 24 Feb 2022 21:32:36 +0900\"]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!tag Debian]]\n"
-msgstr ""
+msgstr "[[!tag Debian]]\n"
 
 #. type: Plain text
 #, no-wrap
 msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
-msgstr ""
+msgstr "[[!meta title=\"New media types in 2022\"]]\n"
 
 #. type: Plain text
 msgid ""
-"En début d'année j'ai mis à jour une centaine de [types de "
-"media](https://fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des "
-"extensions de nom de fichier dans le fichier `/etc/media.types`, distribué "
-"par le paquet [[!debpkg media-types]].  La plupart des changements sont des "
-"additions en provenance des déclarations récentes "
-"à'[IANA](https://www.iana.org/assignments/media-types).  Les thèmes les plus "
-"répendus sont les télécomunications, la sécurité informatique, le commerce, "
-"la santé, et l'automatisation industrielle.  L'énorme majorité provient du "
-"monde occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
+"En début d'année j'ai mis à jour une centaine de [types de media](https://fr."
+"wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des extensions de nom de "
+"fichier dans le fichier `/etc/media.types`, distribué par le paquet [[!"
+"debpkg media-types]].  La plupart des changements sont des additions en "
+"provenance des déclarations récentes à'[IANA](https://www.iana.org/"
+"assignments/media-types).  Les thèmes les plus répendus sont les "
+"télécomunications, la sécurité informatique, le commerce, la santé, et "
+"l'automatisation industrielle.  L'énorme majorité provient du monde "
+"occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
 msgstr ""
+"At the beginning of this year I updated a hundred of [media types](https://"
+"en.wikipedia.org/wiki/Media_type) associated with file name extensions in "
+"the file called `/etc/mime.types`, distributed by the [[!debpkg media-"
+"types]] package.  Most changes are additions originating from recent "
+"submissions to the [IANA](https://www.iana.org/assignments/media-types). "
+"Amon the themes that caught my attention, there are telecommunications, "
+"computer security, commerce, healthcare and industrial automation. The vast "
+"majority of the update come from western provenance.  Did the rest of the "
+"World decide to move ahead without us?"

updated PO files
diff --git "a/Debian/debi\303\242neries/media-types-2022.en.po" "b/Debian/debi\303\242neries/media-types-2022.en.po"
new file mode 100644
index 00000000..958fd0fb
--- /dev/null
+++ "b/Debian/debi\303\242neries/media-types-2022.en.po"
@@ -0,0 +1,50 @@
+# SOME DESCRIPTIVE TITLE
+# Copyright (C) YEAR Free Software Foundation, Inc.
+# This file is distributed under the same license as the PACKAGE package.
+# FIRST AUTHOR <EMAIL@ADDRESS>, YEAR.
+#
+#, fuzzy
+msgid ""
+msgstr ""
+"Project-Id-Version: PACKAGE VERSION\n"
+"POT-Creation-Date: 2022-02-24 12:39+0000\n"
+"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
+"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
+"Language-Team: LANGUAGE <LL@li.org>\n"
+"Language: \n"
+"MIME-Version: 1.0\n"
+"Content-Type: text/plain; charset=UTF-8\n"
+"Content-Transfer-Encoding: 8bit\n"
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!meta date=\"Thu, 24 Feb 2022 21:32:36 +0900\"]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!meta updated=\"Thu, 24 Feb 2022 21:32:36 +0900\"]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!tag Debian]]\n"
+msgstr ""
+
+#. type: Plain text
+#, no-wrap
+msgid "[[!meta title=\"Types media, cuvée 2022\"]]\n"
+msgstr ""
+
+#. type: Plain text
+msgid ""
+"En début d'année j'ai mis à jour une centaine de [types de "
+"media](https://fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des "
+"extensions de nom de fichier dans le fichier `/etc/media.types`, distribué "
+"par le paquet [[!debpkg media-types]].  La plupart des changements sont des "
+"additions en provenance des déclarations récentes "
+"à'[IANA](https://www.iana.org/assignments/media-types).  Les thèmes les plus "
+"répendus sont les télécomunications, la sécurité informatique, le commerce, "
+"la santé, et l'automatisation industrielle.  L'énorme majorité provient du "
+"monde occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?"
+msgstr ""

Le type média nouveau est arrivé
diff --git "a/Debian/debi\303\242neries/media-types-2022.mdwn" "b/Debian/debi\303\242neries/media-types-2022.mdwn"
new file mode 100644
index 00000000..9dc8c46c
--- /dev/null
+++ "b/Debian/debi\303\242neries/media-types-2022.mdwn"
@@ -0,0 +1,15 @@
+[[!meta date="Thu, 24 Feb 2022 21:32:36 +0900"]]
+[[!meta updated="Thu, 24 Feb 2022 21:32:36 +0900"]]
+[[!tag Debian]]
+
+[[!meta title="Types media, cuvée 2022"]]
+
+En début d'année j'ai mis à jour une centaine de [types de
+media](https://fr.wikipedia.org/wiki/Type_de_m%C3%A9dias) associés à des
+extensions de nom de fichier dans le fichier `/etc/media.types`, distribué par
+le paquet [[!debpkg media-types]].  La plupart des changements sont des
+additions en provenance des déclarations récentes
+à'[IANA](https://www.iana.org/assignments/media-types).  Les thèmes les plus
+répendus sont les télécomunications, la sécurité informatique, le commerce, la
+santé, et l'automatisation industrielle.  L'énorme majorité provient du monde
+occidental.  Le reste du monde a-t-il décidé d'avancer sans nous ?

Café
diff --git a/biblio/10.1101_817783.mdwn b/biblio/10.1101_817783.mdwn
deleted file mode 100644
index 19aeb21e..00000000
--- a/biblio/10.1101_817783.mdwn
+++ /dev/null
@@ -1,10 +0,0 @@
-[[!meta title="Evolution of multiple CDK1 paralogs towards specializations in late cell cycle events in a lineage with fast developing planktonic embryos."]]
-[[!tag Oikopleura bioRxiv]]
-
-bioRxiv 817783; doi: https://doi.org/10.1101/817783 
-
-Xiaofei Ma. Jan Inge Øvrebø, Eric M Thompson.
-
-Evolution of multiple CDK1 paralogs towards specializations in late cell cycle events in a lineage with fast developing planktonic embryos.
-
-[[!doi 10.1101/817783 desc="“Interspecies clustering of CDK1 paralogs [show] conservation of their intron-exon structures”  “_O. dioica_ CDK1a and b locate on the same autosome whereas CDK1c is present on a different autosome that also contains CDK1e. CDK1d is found on the X chromosome where, at a distance of 5 MB, the CycBa locus is also located.”  “The PSTAIRE helix is modified in all Oikopleura CDK1 paralogs whereas Oikopleura CDK2s retain the canonical PSTAIRE sequence. All of the 17 identified Oikopleura CDK1 sequences share the A48S substitution.”"]]
diff --git a/biblio/35155443.mdwn b/biblio/35155443.mdwn
index 17fb5b87..b72efcd0 100644
--- a/biblio/35155443.mdwn
+++ b/biblio/35155443.mdwn
@@ -7,10 +7,17 @@ Front Cell Dev Biol. 2022 Jan 28;9:770939. doi:10.3389/fcell.2021.770939
 
 Evolution of CDK1 Paralog Specializations in a Lineage With Fast Developing Planktonic Embryos.
 
-[[!pmid desc="The last common ancestors of all oiks probably had only one CDK1
-as _Fritillaria borealis_ also has only 1.  Oiks in general have 3 paralogs
-(_a_, _b_, _c_), and _O. dioica_ has 5 (_a_, _b_, _c_, plus _d_ and _e_ which
-appear to originate from _c_).  They are found on chr1 (_c_, _e_), chr2, (_a_,
-_b_) and the XSR of chr3 (_d_).  CycBa is also found on the XSR, and interacts
-with CDK1d for functions essential to meiosis of oocytes.  In contrary to the
-ancestral CDK1 in other animals, the levels of CDK1d oscillate."]]
+[[!pmid 35155443 desc="The last common ancestors of all oiks probably had only
+one CDK1 as _Fritillaria borealis_ also has only 1.  Oiks in general have 3
+paralogs (_a_, _b_, _c_), and _O. dioica_ has 5 (_a_, _b_, _c_, plus _d_ and
+_e_ which appear to originate from _c_).  They are found on chr1 (_c_, _e_),
+chr2, (_a_, _b_) and the XSR of chr3 (_d_).  CycBa is also found on the XSR,
+and interacts with CDK1d for functions essential to meiosis of oocytes.  In
+contrary to the ancestral CDK1 in other animals, the levels of CDK1d oscillate.
+“Interspecies clustering of CDK1 paralogs [show] conservation of their
+intron-exon structures” “O. dioica CDK1a and b locate on the same autosome
+whereas CDK1c is present on a different autosome that also contains CDK1e.
+CDK1d is found on the X chromosome where, at a distance of 5 MB, the CycBa
+locus is also located.” “The PSTAIRE helix is modified in all Oikopleura CDK1
+paralogs whereas Oikopleura CDK2s retain the canonical PSTAIRE sequence. All of
+the 17 identified Oikopleura CDK1 sequences share the A48S substitution.”"]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index a05e4d9f..246fb151 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -211,7 +211,7 @@ Genes and pathways
    [[Feng & Thompson, 2018|biblio/29969934]]).
  - _O. dioica_ CDK1a and b locate on LG2; CDK1c and is CDK1e on LG1.
    CDK1d is on the X chromosome near CycBa.  In _O. albicans_, CDK1a,b and c are
-   on the same chromosome ([[Ma, Øvrebø and Thompson, 2019|biblio/10.1101_817783]]).
+   on the same chromosome ([[Ma, Øvrebø and Thompson, 2022|biblio/35155443]]),
  - _O. dioica_, like other deuterostomes, has acid-sensing ion channels (ASICs).
    They are expressed in the nervous system ([[Lynagh et al., 2018|biblio/30061402]]).
  - Some muscle genes were duplicated in the _Oikopleura_ stem lineage

Café
diff --git a/biblio/35155443.mdwn b/biblio/35155443.mdwn
new file mode 100644
index 00000000..17fb5b87
--- /dev/null
+++ b/biblio/35155443.mdwn
@@ -0,0 +1,16 @@
+[[!meta title="Evolution of CDK1 Paralog Specializations in a Lineage With Fast Developing Planktonic Embryos."]]
+[[!tag Oikopleura cell_cycle H3S28p]]
+
+Ma X, Øvrebø JI, Thompson EM. 
+
+Front Cell Dev Biol. 2022 Jan 28;9:770939. doi:10.3389/fcell.2021.770939
+
+Evolution of CDK1 Paralog Specializations in a Lineage With Fast Developing Planktonic Embryos.
+
+[[!pmid desc="The last common ancestors of all oiks probably had only one CDK1
+as _Fritillaria borealis_ also has only 1.  Oiks in general have 3 paralogs
+(_a_, _b_, _c_), and _O. dioica_ has 5 (_a_, _b_, _c_, plus _d_ and _e_ which
+appear to originate from _c_).  They are found on chr1 (_c_, _e_), chr2, (_a_,
+_b_) and the XSR of chr3 (_d_).  CycBa is also found on the XSR, and interacts
+with CDK1d for functions essential to meiosis of oocytes.  In contrary to the
+ancestral CDK1 in other animals, the levels of CDK1d oscillate."]]
diff --git a/tags/H3S28p.mdwn b/tags/H3S28p.mdwn
index f906bf6c..1963c8f2 100644
--- a/tags/H3S28p.mdwn
+++ b/tags/H3S28p.mdwn
@@ -40,6 +40,9 @@ punctate centromere staining at ”late prophase“, a stronger signal (but hard
 to resolve) at metaphase, a weaker signal at anaphase and a weaker or no signal
 at telophase.  Table S1, listing the antibodies used, is missing.
 
+In [[Ma, Øvrebø, and Thompson, 2022|biblio/35155443]] Figure S6, the Abcam
+ab10543 antibody makes broad dots from interphase to meta/anaphase in tadpoles.
+
 The rat monoclonal antibody (Abcam ab10543) stains the centromere-attracting
 body in _O. dioica_, Osaka lab. strain. ([[Nishida and coll.,
 2021|biblio/34755656]]), probably by cross-reactivity.

LAST
diff --git a/biblio/33346833.mdwn b/biblio/33346833.mdwn
new file mode 100644
index 00000000..f27e4371
--- /dev/null
+++ b/biblio/33346833.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Minimally-overlapping words for sequence similarity search."]]
+[[!tag LAST method software alignment]]
+
+Frith MC, Noé L, Kucherov G.
+
+Bioinformatics. 2020 Dec 21;36(22-23):5344–50. doi:10.1093/bioinformatics/btaa1054.
+
+Minimally-overlapping words for sequence similarity search.
+
+[[!pmid 33346833 desc="Sparse seeds made of minimally overlapping words improve the speed with a good tradeoff on sensitivity.  Describes the seeds RY4, …, RY32 used in LAST."]]
diff --git a/tags/LAST.mdwn b/tags/LAST.mdwn
index 49e93fcd..f8ec88ea 100644
--- a/tags/LAST.mdwn
+++ b/tags/LAST.mdwn
@@ -2,8 +2,11 @@
 
 _bibliography in progress..._
 
- - `lastdb` can use various seeding schemes to build its index.
-    [[Frith and Noé (2014)|biblio/24493737]] discuss some of them.
+ - `lastdb` can use various seeding schemes to build its index.  [[Frith and
+   Noé (2014)|biblio/24493737]] discuss some of them.  The `RY` seeds are made
+   of non-overlapping words using the two-letter alphabet `R` = `A|G`, `Y` =
+   `C|T`, to increase speed with a good tradeoff in sensitivity
+   ([[Frith MC, Noé L, Kucherov G, 2020|biblio/33346833]]).
 
  - `last-postmask` ([[Frith, 2011|biblio/22205972]]): discards alignments that
    contain a significant amount of lower-case-masked sequences.

Café
diff --git a/biblio/35108053.mdwn b/biblio/35108053.mdwn
new file mode 100644
index 00000000..00ad2619
--- /dev/null
+++ b/biblio/35108053.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Deeply conserved synteny and the evolution of metazoan chromosomes."]]
+[[!tag synteny]]
+
+Simakov O, Bredeson J, Berkoff K, Marletaz F, Mitros T, Schultz DT, O'Connell BL, Dear P, Martinez DE, Steele RE, Green RE, David CN, Rokhsar DS.
+
+Sci Adv. 2022 Feb 4;8(5):eabi5884. doi:10.1126/sciadv.abi5884
+
+Deeply conserved synteny and the evolution of metazoan chromosomes.
+
+[[!pmid 35108053 desc="29 ancestral linkage groups (ALG) or 24 bilaterian linkage groups, containg usually less than 100 genes.  Karyotypes change by insertion, fusion or "fusion with mixing" between chromosomes.  Traces of conserved synteny with unicellular genomes (choanoflagellates, ichtyosporeans) were found.]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 4f928e37..2b6a156f 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -65,6 +65,9 @@ phenomenon “mesosynteny”.
 
  - The ancestral amniote has 49 chromosomes ([[Sacerdot and coll., 2018|biblio/30333059]]).
 
+ - The ancestral bilaterian had 24 linkage groups according to [[Simakov and
+   coll., 2022|biblio/35108053]].
+
 ### Computational aspects
 
  - [[Rocha (2003)|biblio/14585609]] defines a Gene Order Conservation (GOC)

Café
diff --git a/biblio/34815308.mdwn b/biblio/34815308.mdwn
new file mode 100644
index 00000000..8bb38495
--- /dev/null
+++ b/biblio/34815308.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Comprehensive determination of transcription start sites derived from all RNA polymerases using ReCappable-seq."]]
+[[!tag library method]]
+
+Yan B, Tzertzinis G, Schildkraut I, Ettwiller L.
+
+Genome Res. 2021 Nov 23. doi:10.1101/gr.275784.121
+
+Comprehensive determination of transcription start sites derived from all RNA polymerases using ReCappable-seq.
+
+[[!pmid 34815308 desc="5 µg of total RNAs was decapped with the the yeast scavenger decapping enzyme (yDcpS), and recapped with vaccinia capping enzyme (VCE) and a biotinylated guanosine.  Therefore the protocol enriches for capped, triphosphorylated, diphosphorylated, but not monophosphorylated RNAs.  A control library made on RNA dephosphorylated with CIP was used to infer if a TSS is driven by Pol II or Pol III.  The methyl-triphosphate cap of RN7SK resists to the CIP treatement and causes it to be incorrectly classified Pol II."]]

CNEr
diff --git a/biblio/31449516.mdwn b/biblio/31449516.mdwn
new file mode 100644
index 00000000..b23382ea
--- /dev/null
+++ b/biblio/31449516.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="CNEr: A toolkit for exploring extreme noncoding conservation."]]
+[[!tag enhancer software ]]
+
+Tan G, Polychronopoulos D, Lenhard B.
+
+PLoS Comput Biol. 2019 Aug 26;15(8):e1006940.
+
+CNEr: A toolkit for exploring extreme noncoding conservation.
+
+[[!pmid 31449516 desc="Takes genome alignments in Axt format as input."]]
diff --git a/tags/assembly.mdwn b/tags/assembly.mdwn
index bafbfec1..987f4ede 100644
--- a/tags/assembly.mdwn
+++ b/tags/assembly.mdwn
@@ -77,7 +77,8 @@ and coll., 2015|biblio/25940625]], Marie-Nelly and coll., 2014(not read)).
 
 Assemblies can be aligned with [[last-dotplot|LAST]] or, for SVG export and
 interactive browsing with D-GENIES ([[Cabanettes and Klopp
-2018|biblio/29888139]]).
+2018|biblio/29888139]]).  The CNEr package [[Tan, Polychronopoulos and Lenhard, 2019|biblio/31449516]]
+can be used to search for conserved non-coding elements.
 
 BUSCO ([[Simão and coll., 2015|biblio/26059717]], [[Waterhouse and coll.,
 2017|biblio/29220515]]) assesses the presence of evolutionary conserved

Merge branch 'master' of ssh://charles-plessy-org.branchable.com
Café
diff --git a/biblio/18622036.mdwn b/biblio/18622036.mdwn
new file mode 100644
index 00000000..c27891eb
--- /dev/null
+++ b/biblio/18622036.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Chromosomal rearrangement inferred from comparisons of 12 Drosophila genomes."]]
+[[!tag Drosophila synteny]]
+
+Bhutkar A, Schaeffer SW, Russo SM, Xu M, Smith TF, Gelbart WM.
+
+Genetics. 2008 Jul;179(3):1657-80. doi:10.1534/genetics.107.086108
+
+Chromosomal rearrangement inferred from comparisons of 12 Drosophila genomes.
+
+[[!pmid 18622036 desc="“This analysis reveals between 42 (D. sechellia) and 1430 (D. willistoni) syntenic blocks across various species on the basis of the D. melanogaster gene order.”  “Comparison of syntenic blocks across this large genomic data set confirms that genetic elements are largely (95%) localized to the same Muller element across genus Drosophila species and paracentric inversions serve as the dominant mechanism for shuffling the order of genes along a chromosome.”  “When we infer that a breakpoint is reused we mean that two or more breakage events occurred within the nucleotide interval between blocks, but the events are not necessarily coincident within the breakpoint”"]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 4c67537f..150cfa8c 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -1,8 +1,11 @@
 [[!meta title="pages tagged synteny"]]
 
-[[Drosophila 12 Genomes Consortium (2007)|biblio/17994087]] sequenced
-across the _Drosophila_ genus and showed synteny conservation ranging
-between few large blocks with many genes to many small blocks with few genes.
+[[Drosophila 12 Genomes Consortium (2007)|biblio/17994087]] sequenced across
+the _Drosophila_ genus and showed synteny conservation ranging between few
+large blocks with many genes to many small blocks with few genes.  [[Bhuktar
+and coll. (2008)|biblio/18622036]] counted “between 42 (D. sechellia) and 1430
+(D. willistoni) syntenic blocks across various species on the basis of the D.
+melanogaster gene order”.
 
 [[Carbone and coll. (2014)|biblio/25209798]] found 96 gibbon–human synteny
 breakpoints (~30 per Gb), associated with segmental duplication or Alu element

Café
diff --git a/biblio/34934012.mdwn b/biblio/34934012.mdwn
new file mode 100644
index 00000000..cdbb799c
--- /dev/null
+++ b/biblio/34934012.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="AnchorWave: Sensitive alignment of genomes with high sequence diversity, extensive structural polymorphism, and whole-genome duplication."]]
+[[!tag genome alignment software]]
+
+Song B, Marco-Sola S, Moreto M, Johnson L, Buckler ES, Stitzer MC.
+
+Proc Natl Acad Sci U S A. 2022 Jan 4;119(1):e2113075119. doi:10.1073/pnas.2113075119
+
+AnchorWave: Sensitive alignment of genomes with high sequence diversity, extensive structural polymorphism, and whole-genome duplication. 
+
+[[!pmid desc=""1) Maps a transcriptome to its reference genome.  2) Extracts "anchor" coding sequences.  3) Searches for homologous sequences in the query genome.  4) Realigns the sequences between homologous anchors.  The so-called comparison to LAST is actually a comparison with LAST + AxtChain, that is: it does not use last-split.]]

Café
diff --git a/biblio/34755656.mdwn b/biblio/34755656.mdwn
new file mode 100644
index 00000000..ff545856
--- /dev/null
+++ b/biblio/34755656.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Germline development during embryogenesis of the larvacean, Oikopleura dioica."]]
+[[!tag Oikopleura H3S28p]]
+
+Dev Biol. 2022 Jan;481:188-200. doi:10.1016/j.ydbio.2021.10.009
+
+Nishida H, Matsuo M, Konishi S, Ohno N, Manni L, Onuma TA.
+
+Germline development during embryogenesis of the larvacean, _Oikopleura dioica_.
+
+[[!pmid 34755656 desc="Identified a CAB (centrosome-attracting body) “for the following reasons. (1) There was a clear boundary between the CAB-like region and the general cytoplasm, but the membrane structure did not surround the CAB. (2) It contained an electron-dense matrix that resembled a germplasm. (3) The region was devoid of mitochondria but contained ER. (4) It was present beneath the cell membrane, and the cell surface exhibited microvilli. (5) It was present in the germline lineage cells.”  ”The longest diameter of the CAB was approximately 10 ​μm.“  It was observed between the late 8-cell stage and some 1.5-h embryos, but not after 2h.  It was stained by the H3S28p rat monoclonal antibody (Abcam ab10543) but not by DAPI.  The _snail_ mRNA also colocalises with the CAB's H3S28p staining.  A germ body (GB) “appeared [in PGCs] 13 ​min after the 5th cleavage [and] disappeared 1.5 ​h after fertilization at 20 ​°C.  It is discussed whether the GB and the CAB are or are not the same structure."]]
diff --git a/tags/H3S28p.mdwn b/tags/H3S28p.mdwn
index 7d6c92a2..f906bf6c 100644
--- a/tags/H3S28p.mdwn
+++ b/tags/H3S28p.mdwn
@@ -40,4 +40,8 @@ punctate centromere staining at ”late prophase“, a stronger signal (but hard
 to resolve) at metaphase, a weaker signal at anaphase and a weaker or no signal
 at telophase.  Table S1, listing the antibodies used, is missing.
 
+The rat monoclonal antibody (Abcam ab10543) stains the centromere-attracting
+body in _O. dioica_, Osaka lab. strain. ([[Nishida and coll.,
+2021|biblio/34755656]]), probably by cross-reactivity.
+
 [[!inline pages="tagged(H3S28p)" limit=0]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index e4e9fcb0..a05e4d9f 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -397,6 +397,9 @@ Development
    hindbrain, and spinal cord, but not the midbrain.  No expression of
    _pax2/5/8_ is detected between the _otxa_ + _otxb_ and the _hox1_ territories.
    ([[Cañestro et al., 2005|biblio/16111672]]).
+ - A centromere-attracting body is resoponsible for asymetric cell division in
+   primordial germ cells ([[Nishida and coll., 2021|biblio/34755656]]).  The
+   _snail_ mRNA co-localises with it.
  - The _pum1_ and _vas4_ RNAs show localised expression during development. Prior
    hatching, _pum1_ is found outside the embryo ([[Olsen et al., 2018|biblio/29486709]]).
  - Duplicated developmental genes were found by [[Denoeud et al., 2010|biblio/21097902]],

Papa in the air, wohohowoooowooo
diff --git a/biblio/14500911.mdwn b/biblio/14500911.mdwn
new file mode 100644
index 00000000..b0985a4d
--- /dev/null
+++ b/biblio/14500911.mdwn
@@ -0,0 +1,18 @@
+[[!meta title="Evolution's cauldron: duplication, deletion, and rearrangement in the mouse and human genomes."]]
+[[!tag software method synteny genome alignment variants]]
+
+Kent WJ, Baertsch R, Hinrichs A, Miller W, Haussler D.
+
+Proc Natl Acad Sci U S A. 2003 Sep 30;100(20):11484-9. doi:10.1073/pnas.1932072100
+
+Evolution's cauldron: duplication, deletion, and rearrangement in the mouse and human genomes.
+
+[[!pmid 14500911 desc="Primary paper for chains and nets, built with the BLASTZ and AXTCHAIN programs.  Chains are one-to-many alignments and allow skipping over local inversions.  In human/mouse comparisons, 2.0 inversion per Mbp, median length 814.  Double gaps ≥ 100 per Mbp: 398.6, median length 411.  Chains are called “short” when their span is <100,000 bases (span distribution of short chains apparently bimodal).  579 “long” chains (average length 983 kb) cover 32.9% of the bases in the human genome.  Collectively all chains span 96.3% of the human genome and align to 34.6% of it.  The authors note that the observed distribution of gap lengths violate the usual affine model of aligners."]]
+
+“A chained alignment [is] an ordered sequence of traditional pairwise nucleotide alignments (“blocks”) separated by larger gaps, some of which may be simultaneous gaps in both species. [...] intervening DNA in one species that does not align with the other because it is locally inverted or has been inserted in by lineage-specific translocation or duplication is skipped”
+
+“The chains are then put into a list sorted with the highest-scoring chain first. [...] each iteration taking the next chain off of the list, throwing out the parts of the chain that intersect with bases already covered by previously taken chains, and then marking the bases that are left in the chain as covered. [...] If a chain covers bases that are in a gap in a previously taken chain, it is marked as a child of the previous chain. In this way, a hierarchy of chains is formed that we call a net.”
+
+“To be considered syntenic, a chain has to either have a very high score itself or be embedded in a larger chain, on the same chromosome, and come from the same region as the larger chain. Thus, inversions and tandem duplications are considered syntenic.”
+
+“We define the (human) span of a chain to be the distance in bases in the human genome from the first to the last human base in the chain, including gaps, and we define the size of the chain as the number of aligning bases in it, not including gaps.”
diff --git a/tags/assembly.mdwn b/tags/assembly.mdwn
index 24b4f29f..bafbfec1 100644
--- a/tags/assembly.mdwn
+++ b/tags/assembly.mdwn
@@ -92,4 +92,7 @@ by [[Hoff and Stanke, 2018|biblio/30466165]].
 A reference assembly can be used to search for structural variants in a different
 individual, for instance with NanoSV ([[Cretu Stancu and coll., 2017|biblio/29109544]]).
 
+In [[2003, Kent and coll.|biblio/14500911]] aligned the human and mouse genome
+together using the BLASTZ and AXTCHAIN software.
+
 [[!inline pages="tagged(assembly)" actions="no" limit=0]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index bc987514..a44e3cd9 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -69,4 +69,7 @@ phenomenon “mesosynteny”.
    orthologue co-occurs close by in the other genome. It varies between 0 (no
    co-occurrence) and 1 (complete gene order conservation)”.
 
+ - “Chains” and “nets” of pairwise alignements between two genomes are described
+   in [[Kent and coll, 2003|biblio/14500911]].
+
 [[!inline pages="tagged(synteny)" limit=0]]
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index 75e312bd..5562a25e 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -38,6 +38,9 @@ supported by [[Steinberg and coll in 2012|biblio/22751100]].
 Ectopic recombination of a Galileo element may have caused a recent large-scale
 inversion in _D. buzzati_ ([[Delprat and coll, 2009|biblio/19936241]]).
 
+[[Kent and coll., 2003|biblio/14500911]] reported 2 inversions per Mbp in
+human/mouse comparisons, median length 814. 
+
 ### Software
 
  - _NanoSV_ ([[Cretu Stancu and coll., 2017|biblio/29109544]]) uses nanopore long