Dernières modifications :

Café
diff --git a/biblio/22919541.mdwn b/biblio/22919541.mdwn
new file mode 100644
index 00000000..79fd2a4e
--- /dev/null
+++ b/biblio/22919541.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Evolution of the FGF Gene Family."]]
+[[!tag Oikopleura]]
+
+Oulion S, Bertrand S, Escriva H.
+
+Int J Evol Biol. 2012;2012:298147. doi:10.1155/2012/298147
+
+Evolution of the FGF Gene Family.
+
+[[!pmid 22919541 desc="“In another urochordate, the larvacean _Oikopleura dioica_, we found six FGF coding genes, among which two can be assigned to the FGF11/12/13/14 subfamily, and one to the FGF9/16/20 subfamily”"]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index e50d170d..f5f35937 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -255,6 +255,7 @@ Genes and pathways
  - _Nk4_, _Hand1/2_ and _FoxF_ (heart development, [[Ferrández-Roldán and coll., 2021|biblio/34789899]]).
  - _O. dioica_ has the miRNA machinery and some miRNAs such as _let-7a_ were detected.  36 % of
    the miRNAs had a length of 22 nt in [[Fu, Adamski and Thompson, 2008|biblio/18339653]].
+ - 6 FGF genes were detected by Oulion, Bertrand and Escriva ([[2012|biblio/22919541]]).
 
 ### Lost
 

Café
diff --git a/tags/mitochondrion.mdwn b/tags/mitochondrion.mdwn
index c31a6fd1..4844f53e 100644
--- a/tags/mitochondrion.mdwn
+++ b/tags/mitochondrion.mdwn
@@ -92,4 +92,6 @@ detrimental ([[Wanrooij and coll., 2020|biblio/32513727]]).
 
 The presence of mtDNA concatemers in nuclear genomes was postulated by [[Balciuniene and Balciunas (2019)|biblio/31244882]].
 
+The Vertebrate Genome Project has a tool to remove NUMTs ([[Rhie and coll., 2021|biblio/30402909]]).
+
 [[!inline pages="tagged(mitochondrion)" limit=0]]

Published
diff --git a/biblio/10.1101_2020.05.22.110833.mdwn b/biblio/10.1101_2020.05.22.110833.mdwn
deleted file mode 100644
index d459d3ff..00000000
--- a/biblio/10.1101_2020.05.22.110833.mdwn
+++ /dev/null
@@ -1,10 +0,0 @@
-[[!meta title="Towards complete and error-free genome assemblies of all vertebrate species"]]
-[[!tag bioRxiv assembly]]
-
-Rhle and many collaborators.
-
-bioRxiv 2020.05.22.110833; doi: https://doi.org/10.1101/2020.05.22.110833
-
-Towards complete and error-free genome assemblies of all vertebrate species
-
-[[!doi 10.1101/2020.05.22.110833 desc="Presents the Vertebrate Genome Project (VGP) pipeline for PacBio and 10X Genomics linked reads.  Contains a module to sort out NUMPs from Mitochondrial DNA."]]
diff --git a/biblio/33911273.mdwn b/biblio/33911273.mdwn
new file mode 100644
index 00000000..4798e0fa
--- /dev/null
+++ b/biblio/33911273.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Towards complete and error-free genome assemblies of all vertebrate species"]]
+[[!tag mitochondrion assembly]]
+
+Rhle and many collaborators.
+
+Nature. 2021 Apr;592(7856):737-746. doi:10.1038/s41586-021-03451-0
+
+Towards complete and error-free genome assemblies of all vertebrate species
+
+[[!pmid 33911273 desc="Presents the Vertebrate Genome Project (VGP) pipeline for PacBio and 10X Genomics linked reads.  Contains a module to sort out NUMTs from Mitochondrial DNA."]]

creating tag page tags/cephalopod
diff --git a/tags/cephalopod.mdwn b/tags/cephalopod.mdwn
new file mode 100644
index 00000000..d1913788
--- /dev/null
+++ b/tags/cephalopod.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged cephalopod"]]
+
+[[!inline pages="tagged(cephalopod)" actions="no" archive="yes"
+feedshow=10]]

Café
diff --git a/biblio/10.1101_2022.09.25.509396.mdwn b/biblio/10.1101_2022.09.25.509396.mdwn
new file mode 100644
index 00000000..e61e4e1a
--- /dev/null
+++ b/biblio/10.1101_2022.09.25.509396.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="RNA recoding in cephalopods tailors microtubule motor protein function"]]
+[[!tag bioRxiv editing cephalopod]]
+
+Kavita J Rangan, Samara L Reck-Peterson
+
+bioRxiv 2022.09.25.509396; doi: https://doi.org/10.1101/2022.09.25.509396
+
+RNA recoding in cephalopods tailors microtubule motor protein function
+
+[[!doi 10.1101/2022.09.25.509396 desc="Editing increases at lower temperatures.  Could that be an adaptation to keep protein flexibility temperature-independant by replacing bulky amino acids with G?"]]

Café
diff --git a/biblio/35880393.mdwn b/biblio/35880393.mdwn
new file mode 100644
index 00000000..65a32373
--- /dev/null
+++ b/biblio/35880393.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Production of retinoic acid by engineered Saccharomyces cerevisiae using an endogenous aldehyde dehydrogenase."]]
+[[!tag synthetic yeast]]
+
+Hu Q, Yu H, Ye L.
+
+Biotechnol Bioeng. 2022 Jul 26. doi:10.1002/bit.28192
+
+Production of retinoic acid by engineered Saccharomyces cerevisiae using an endogenous aldehyde dehydrogenase.
+
+[[!pmid 35880393 desc="Screen for the most efficient aldehyde dehydrogenases to produce retinoic acid in S. cerevisiae strain Y03 identified MmAldh, which was used to scan the yeast genome for an endogenous replacement.  Hfd1 was found, and increasing its copy number lead to the best yields."]]
diff --git a/tags/synthetic.mdwn b/tags/synthetic.mdwn
index 009c3613..120fc94d 100644
--- a/tags/synthetic.mdwn
+++ b/tags/synthetic.mdwn
@@ -2,6 +2,8 @@
 
 _in progress_
 
+## Genomes
+
 Sc3.0 roadmap: [[Dai and coll., 2020|biblio/32791980]].
 
 “Biosynthesis of medicinal tropane alkaloids in yeast”: [[Srinivasan and Smolke and coll., 2020|biblio/32879484]]
@@ -10,4 +12,8 @@ Example of neochromosome synthesis in yeast: [[Postma and coll., 2021|biblio/334
 
 Artificial genome scrambling in yeast 2.0 with loxPsym sites: [[Brooks and coll, 2022|biblio/35239377]].
 
+## Pathway
+
+Increasing the copy number of the endogenous aldehyde dehydrogenase Hfd1 allowed [[Hu, Yu and Ye, 2022|biblio/35880393]] to obtain the best yield of conversion of retinol to retinoic acid..
+
 [[!inline pages="tagged(synthethic)" limit=0]]

cleanup
diff --git a/tags/culture.mdwn b/tags/culture.mdwn
deleted file mode 100644
index 5fab9196..00000000
--- a/tags/culture.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged culture"]]
-
-[[!inline pages="tagged(culture)" actions="no" archive="yes"
-feedshow=10]]

Polyamines
diff --git a/biblio/25096480.mdwn b/biblio/25096480.mdwn
new file mode 100644
index 00000000..8743841d
--- /dev/null
+++ b/biblio/25096480.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="An inverse small molecule screen to design a chemically defined medium supporting long-term growth of Drosophila cell lines."]]
+[[!tag cell_culture method screen]]
+
+Burnette M, Brito-Robinson T, Li J, Zartman J.
+
+Mol Biosyst. 2014 Oct;10(10):2713-23. doi:10.1039/c4mb00155a
+
+An inverse small molecule screen to design a chemically defined medium supporting long-term growth of Drosophila cell lines.
+
+[[!pmid 25096480 desc="“Using this approach we developed an intermediate “ZO Fortified” medium, made up of ZO media supplemented with insulin (5 μg mL−1), trehalose (26.4 mM), l-alanyl-l-glutamine (ala-gln, 12 μM), and l-ascorbic acid 2-phosphate sesquimagnesium salt hydrate (A2P, 0.08 μM), with pH adjusted to 6.75.”  410 compounds were screened.  “All of the repeated positive hits were polyamines (spermine, spermidine, and putrescine)”"]]
diff --git a/tags/cell_culture.mdwn b/tags/cell_culture.mdwn
index 53cadb57..b387b0ce 100644
--- a/tags/cell_culture.mdwn
+++ b/tags/cell_culture.mdwn
@@ -4,7 +4,7 @@ A few notes that just scratch the surface of a vast field…
 
  - [[Echalier and Ohanessian (1969)|biblio/4976834]] reported a culture of _Drosophila_ cells that spontaneously transformed.
  - [[Schneider's (1972)|biblio/4625067]] report of the establishment of the S2 cell line.
- - Polyamines are needed for the long-term passaging of some cell lines ([[Mitsuhashi 1998|biblio/9769143]]).
+ - Polyamines are needed for the long-term passaging of some cell lines ([[Mitsuhashi 1998|biblio/9769143]], [[Burnette and coll., 2014|biblio/25096480]]).
  - [[Marteijn and coll. (2003)|biblio/12474249]] optimised a culture medium using a genetic algorithm.  This methdod
    has been used at least once in invertebrates ([[Munroe and coll. (2019)|biblio/30747414]]).
  - [[Kawamura and coll. (2021)|biblio/33899125]] reported the use of plasmin to establish coral cell lines.

updated PO files
diff --git a/biblio.en.po b/biblio.en.po
index cd30a8bb..1d1f1ffb 100644
--- a/biblio.en.po
+++ b/biblio.en.po
@@ -23,7 +23,7 @@ msgstr ""
 
 #. type: Plain text
 #, no-wrap
-msgid "[[!img wordcloud.png size=\"50%\"]]\n"
+msgid "[[!img wordcloud.png]]\n"
 msgstr ""
 
 #. type: Plain text

Je laisse tomber.
diff --git a/biblio.mdwn b/biblio.mdwn
index f2246934..410cc2ef 100644
--- a/biblio.mdwn
+++ b/biblio.mdwn
@@ -1,7 +1,7 @@
 Bibliographie à la volée.
 =========================
 
-[[!img wordcloud.png size="50%"]]
+[[!img wordcloud.png]]
 
 [[!pagestats pages="tags/*" among="biblio/*"]]
 [[!inline

updated PO files
diff --git a/biblio.en.po b/biblio.en.po
index 623c7a23..cd30a8bb 100644
--- a/biblio.en.po
+++ b/biblio.en.po
@@ -1,7 +1,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2022-09-15 06:27+0000\n"
+"POT-Creation-Date: 2022-09-15 06:28+0000\n"
 "PO-Revision-Date: 2011-01-10 00:08+0900\n"
 "Last-Translator: Charles Plessy <https://launchpad.net/~plessy>\n"
 "Language-Team: Hopla\n"
@@ -23,7 +23,7 @@ msgstr ""
 
 #. type: Plain text
 #, no-wrap
-msgid "[[!img wordcloud.png hspace=\"50%\"]]\n"
+msgid "[[!img wordcloud.png size=\"50%\"]]\n"
 msgstr ""
 
 #. type: Plain text

Dernier essai.
diff --git a/biblio.mdwn b/biblio.mdwn
index 10267344..f2246934 100644
--- a/biblio.mdwn
+++ b/biblio.mdwn
@@ -1,7 +1,7 @@
 Bibliographie à la volée.
 =========================
 
-[[!img wordcloud.png hspace="50%"]]
+[[!img wordcloud.png size="50%"]]
 
 [[!pagestats pages="tags/*" among="biblio/*"]]
 [[!inline

updated PO files
diff --git a/biblio.en.po b/biblio.en.po
index 76afe944..623c7a23 100644
--- a/biblio.en.po
+++ b/biblio.en.po
@@ -1,7 +1,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2022-09-15 06:26+0000\n"
+"POT-Creation-Date: 2022-09-15 06:27+0000\n"
 "PO-Revision-Date: 2011-01-10 00:08+0900\n"
 "Last-Translator: Charles Plessy <https://launchpad.net/~plessy>\n"
 "Language-Team: Hopla\n"
@@ -23,7 +23,7 @@ msgstr ""
 
 #. type: Plain text
 #, no-wrap
-msgid "[[!img wordcloud.png hspace=\"100%\"]]\n"
+msgid "[[!img wordcloud.png hspace=\"50%\"]]\n"
 msgstr ""
 
 #. type: Plain text

Plus petite ?
diff --git a/biblio.mdwn b/biblio.mdwn
index a4e4d7cd..10267344 100644
--- a/biblio.mdwn
+++ b/biblio.mdwn
@@ -1,7 +1,7 @@
 Bibliographie à la volée.
 =========================
 
-[[!img wordcloud.png hspace="100%"]]
+[[!img wordcloud.png hspace="50%"]]
 
 [[!pagestats pages="tags/*" among="biblio/*"]]
 [[!inline

updated PO files
diff --git a/biblio.en.po b/biblio.en.po
index 41cf3baf..76afe944 100644
--- a/biblio.en.po
+++ b/biblio.en.po
@@ -1,7 +1,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2022-09-15 06:17+0000\n"
+"POT-Creation-Date: 2022-09-15 06:26+0000\n"
 "PO-Revision-Date: 2011-01-10 00:08+0900\n"
 "Last-Translator: Charles Plessy <https://launchpad.net/~plessy>\n"
 "Language-Team: Hopla\n"
@@ -23,7 +23,7 @@ msgstr ""
 
 #. type: Plain text
 #, no-wrap
-msgid "[[!img wordcloud.png]]\n"
+msgid "[[!img wordcloud.png hspace=\"100%\"]]\n"
 msgstr ""
 
 #. type: Plain text
@@ -37,7 +37,7 @@ msgstr "[[!pagestats  pages=\"tags/*\" among=\"biblio/*\"]]\n"
 #| "\tpages=\"biblio/* and !biblio/template and !biblio/tous\"\n"
 #| "\tfeeds=\"no\"]]\n"
 msgid ""
-"\tpages=\"biblio/ and !biblio/template and !biblio/tous\"\n"
+"\tpages=\"biblio/* and !biblio/template and !biblio/tous\"\n"
 "\tfeeds=\"no\"]]\n"
 msgstr ""
 "\tpages=\"biblio/* and !biblio/template and !biblio/tous\"\n"

Étoile manquante. Essai de changer la taille de l'image.
diff --git a/biblio.mdwn b/biblio.mdwn
index 30faef47..a4e4d7cd 100644
--- a/biblio.mdwn
+++ b/biblio.mdwn
@@ -1,11 +1,11 @@
 Bibliographie à la volée.
 =========================
 
-[[!img wordcloud.png]]
+[[!img wordcloud.png hspace="100%"]]
 
 [[!pagestats pages="tags/*" among="biblio/*"]]
 [[!inline
-	pages="biblio/ and !biblio/template and !biblio/tous"
+	pages="biblio/* and !biblio/template and !biblio/tous"
 	feeds="no"]]
 
 Voir [[tous les articles|biblio/tous]].

updated PO files
diff --git a/biblio.en.po b/biblio.en.po
index 3ffa4f02..41cf3baf 100644
--- a/biblio.en.po
+++ b/biblio.en.po
@@ -1,7 +1,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2022-09-15 06:13+0000\n"
+"POT-Creation-Date: 2022-09-15 06:17+0000\n"
 "PO-Revision-Date: 2011-01-10 00:08+0900\n"
 "Last-Translator: Charles Plessy <https://launchpad.net/~plessy>\n"
 "Language-Team: Hopla\n"
@@ -23,7 +23,7 @@ msgstr ""
 
 #. type: Plain text
 #, no-wrap
-msgid "[[!img biblio/wordcloud.png]]\n"
+msgid "[[!img wordcloud.png]]\n"
 msgstr ""
 
 #. type: Plain text
@@ -37,7 +37,7 @@ msgstr "[[!pagestats  pages=\"tags/*\" among=\"biblio/*\"]]\n"
 #| "\tpages=\"biblio/* and !biblio/template and !biblio/tous\"\n"
 #| "\tfeeds=\"no\"]]\n"
 msgid ""
-"\tpages=\"biblio/*.mdwn and !biblio/template and !biblio/tous\"\n"
+"\tpages=\"biblio/ and !biblio/template and !biblio/tous\"\n"
 "\tfeeds=\"no\"]]\n"
 msgstr ""
 "\tpages=\"biblio/* and !biblio/template and !biblio/tous\"\n"

On essaye encore de ne pas montrer de lien vers l'image.
diff --git a/biblio.mdwn b/biblio.mdwn
index e5683ec5..30faef47 100644
--- a/biblio.mdwn
+++ b/biblio.mdwn
@@ -1,11 +1,11 @@
 Bibliographie à la volée.
 =========================
 
-[[!img biblio/wordcloud.png]]
+[[!img wordcloud.png]]
 
 [[!pagestats pages="tags/*" among="biblio/*"]]
 [[!inline
-	pages="biblio/*.mdwn and !biblio/template and !biblio/tous"
+	pages="biblio/ and !biblio/template and !biblio/tous"
 	feeds="no"]]
 
 Voir [[tous les articles|biblio/tous]].
diff --git a/biblio/wordcloud.png b/wordcloud.png
similarity index 100%
rename from biblio/wordcloud.png
rename to wordcloud.png

updated PO files
diff --git a/biblio.en.po b/biblio.en.po
index 1c22933e..3ffa4f02 100644
--- a/biblio.en.po
+++ b/biblio.en.po
@@ -1,7 +1,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2022-09-15 06:11+0000\n"
+"POT-Creation-Date: 2022-09-15 06:13+0000\n"
 "PO-Revision-Date: 2011-01-10 00:08+0900\n"
 "Last-Translator: Charles Plessy <https://launchpad.net/~plessy>\n"
 "Language-Team: Hopla\n"
@@ -32,9 +32,12 @@ msgid "[[!pagestats pages=\"tags/*\" among=\"biblio/*\"]]\n"
 msgstr "[[!pagestats  pages=\"tags/*\" among=\"biblio/*\"]]\n"
 
 #. type: Plain text
-#, no-wrap
+#, fuzzy, no-wrap
+#| msgid ""
+#| "\tpages=\"biblio/* and !biblio/template and !biblio/tous\"\n"
+#| "\tfeeds=\"no\"]]\n"
 msgid ""
-"\tpages=\"biblio/* and !biblio/template and !biblio/tous\"\n"
+"\tpages=\"biblio/*.mdwn and !biblio/template and !biblio/tous\"\n"
 "\tfeeds=\"no\"]]\n"
 msgstr ""
 "\tpages=\"biblio/* and !biblio/template and !biblio/tous\"\n"

On ne liste pas les images.
diff --git a/biblio.mdwn b/biblio.mdwn
index c40006ac..e5683ec5 100644
--- a/biblio.mdwn
+++ b/biblio.mdwn
@@ -5,7 +5,7 @@ Bibliographie à la volée.
 
 [[!pagestats pages="tags/*" among="biblio/*"]]
 [[!inline
-	pages="biblio/* and !biblio/template and !biblio/tous"
+	pages="biblio/*.mdwn and !biblio/template and !biblio/tous"
 	feeds="no"]]
 
 Voir [[tous les articles|biblio/tous]].

updated PO files
diff --git a/biblio.en.po b/biblio.en.po
index fafc4fed..1c22933e 100644
--- a/biblio.en.po
+++ b/biblio.en.po
@@ -1,7 +1,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2011-01-13 23:56+0900\n"
+"POT-Creation-Date: 2022-09-15 06:11+0000\n"
 "PO-Revision-Date: 2011-01-10 00:08+0900\n"
 "Last-Translator: Charles Plessy <https://launchpad.net/~plessy>\n"
 "Language-Team: Hopla\n"
@@ -21,6 +21,11 @@ msgstr ""
 "Some bibliography\n"
 "=================\n"
 
+#. type: Plain text
+#, no-wrap
+msgid "[[!img biblio/wordcloud.png]]\n"
+msgstr ""
+
 #. type: Plain text
 #, no-wrap
 msgid "[[!pagestats pages=\"tags/*\" among=\"biblio/*\"]]\n"

Word cloud.
git grep -h '\[\[\!tag' | sed -e 's/\[\[\!tag//' -e 's/]]//' -e 's/_/ /'
https://www.jasondavies.com/wordcloud/
diff --git a/biblio.mdwn b/biblio.mdwn
index 47059eb7..c40006ac 100644
--- a/biblio.mdwn
+++ b/biblio.mdwn
@@ -1,6 +1,8 @@
 Bibliographie à la volée.
 =========================
 
+[[!img biblio/wordcloud.png]]
+
 [[!pagestats pages="tags/*" among="biblio/*"]]
 [[!inline
 	pages="biblio/* and !biblio/template and !biblio/tous"
diff --git a/biblio/wordcloud.png b/biblio/wordcloud.png
new file mode 100644
index 00000000..4f827303
Binary files /dev/null and b/biblio/wordcloud.png differ

Consolidate extraction and purification tags.
diff --git a/biblio/30669388.mdwn b/biblio/30669388.mdwn
index 74c3c509..7d0c9084 100644
--- a/biblio/30669388.mdwn
+++ b/biblio/30669388.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="A High-Quality De Novo Genome Assembly from a Single Mosquito using PacBio Sequencing"]]
-[[!tag genome assembly mosquito method extraction]]
+[!tag genome assembly mosquito method purification]]
 
 Sarah Kingan, Haynes Heaton, Juliana Cudini, Christine Lambert, Primo Baybayan, Brendan Galvin, Richard Durbin, Jonas Korlach, Mara Lawniczak
 
diff --git a/biblio/8969838.mdwn b/biblio/8969838.mdwn
index 742f59e4..12ef381e 100644
--- a/biblio/8969838.mdwn
+++ b/biblio/8969838.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="RT-PCR without RNA isolation."]]
-[[!tag RNA extraction RT-PCR DTT]]
+[[!tag RNA purification RT-PCR DTT]]
 
 Klebe RJ, Grant GM, Grant AM, Garcia MA, Giambernardi TA, Taylor GP.
 
diff --git a/tags/extraction.mdwn b/tags/extraction.mdwn
deleted file mode 100644
index 4ee4f87e..00000000
--- a/tags/extraction.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged extraction"]]
-
-[[!inline pages="tagged(extraction)" actions="no" archive="yes"
-feedshow=10]]

salting out
diff --git a/biblio/35312712.mdwn b/biblio/35312712.mdwn
new file mode 100644
index 00000000..9e8adb4e
--- /dev/null
+++ b/biblio/35312712.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Comparison of six methods for Loa loa genomic DNA extraction."]]
+[[!tag method purification]]
+
+Dieki R, Nsi Emvo E, Akue JP.
+
+PLoS One. 2022 Mar 21;17(3):e0265582. doi:10.1371/journal.pone.0265582
+
+Comparison of six methods for Loa loa genomic DNA extraction.
+
+[[!pmid 35312712 desc="Higher yield with the salting out method than with the phenol-chloroform method."]]

Polyamines.
diff --git a/tags/cell_culture.mdwn b/tags/cell_culture.mdwn
index 25a0c4c3..53cadb57 100644
--- a/tags/cell_culture.mdwn
+++ b/tags/cell_culture.mdwn
@@ -4,6 +4,7 @@ A few notes that just scratch the surface of a vast field…
 
  - [[Echalier and Ohanessian (1969)|biblio/4976834]] reported a culture of _Drosophila_ cells that spontaneously transformed.
  - [[Schneider's (1972)|biblio/4625067]] report of the establishment of the S2 cell line.
+ - Polyamines are needed for the long-term passaging of some cell lines ([[Mitsuhashi 1998|biblio/9769143]]).
  - [[Marteijn and coll. (2003)|biblio/12474249]] optimised a culture medium using a genetic algorithm.  This methdod
    has been used at least once in invertebrates ([[Munroe and coll. (2019)|biblio/30747414]]).
  - [[Kawamura and coll. (2021)|biblio/33899125]] reported the use of plasmin to establish coral cell lines.

Consolidate tags cell_culture and cell_line.
diff --git a/biblio/12474249.mdwn b/biblio/12474249.mdwn
index 0b1b128e..33f74698 100644
--- a/biblio/12474249.mdwn
+++ b/biblio/12474249.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Optimization of a feed medium for fed-batch culture of insect cells using a genetic algorithm"]]
-[[!tag method machine_learning cell_culture cell_line]]
+[[!tag method machine_learning cell_culture]]
 
 Marteijn RC, Jurrius O, Dhont J, de Gooijer CD, Tramper J, Martens DE.
 
diff --git a/biblio/33899125.mdwn b/biblio/33899125.mdwn
index d235c3c5..0382efef 100644
--- a/biblio/33899125.mdwn
+++ b/biblio/33899125.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Establishing Sustainable Cell Lines of a Coral, Acropora tenuis."]]
-[[!tag coral cell_culture cell_line]]
+[[!tag coral cell_culture]]
 
 Kawamura K, Nishitsuji K, Shoguchi E, Fujiwara S, Satoh N.
 
diff --git a/biblio/4625067.mdwn b/biblio/4625067.mdwn
index c2029723..dafa0a29 100644
--- a/biblio/4625067.mdwn
+++ b/biblio/4625067.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Cell lines derived from late embryonic stages of Drosophila melanogaster."]]
-[[!tag Drosophila cell_line]]
+[[!tag Drosophila cell_culture]]
 
 Schneider I.
 
diff --git a/biblio/4976834.mdwn b/biblio/4976834.mdwn
index 23c9d7ae..6bb579a6 100644
--- a/biblio/4976834.mdwn
+++ b/biblio/4976834.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Isolement, en culture in vivo, de lignées cellulaires diploïdes de Drosophila melanogaster."]]
-[[!tag Drosophila cell_line]]
+[[!tag Drosophila cell_culture]]
 
 Echalier G, Ohanessian A.
 
diff --git a/tags/cell_culture.mdwn b/tags/cell_culture.mdwn
index 99b886f2..25a0c4c3 100644
--- a/tags/cell_culture.mdwn
+++ b/tags/cell_culture.mdwn
@@ -1,4 +1,11 @@
 [[!meta title="pages tagged cell culture"]]
 
-[[!inline pages="tagged(cell_culture)" actions="no" archive="yes"
-feedshow=10]]
+A few notes that just scratch the surface of a vast field…
+
+ - [[Echalier and Ohanessian (1969)|biblio/4976834]] reported a culture of _Drosophila_ cells that spontaneously transformed.
+ - [[Schneider's (1972)|biblio/4625067]] report of the establishment of the S2 cell line.
+ - [[Marteijn and coll. (2003)|biblio/12474249]] optimised a culture medium using a genetic algorithm.  This methdod
+   has been used at least once in invertebrates ([[Munroe and coll. (2019)|biblio/30747414]]).
+ - [[Kawamura and coll. (2021)|biblio/33899125]] reported the use of plasmin to establish coral cell lines.
+
+[[!inline pages="tagged(cell_culture)" limit=0]]
diff --git a/tags/cell_line.mdwn b/tags/cell_line.mdwn
deleted file mode 100644
index 9a073fbd..00000000
--- a/tags/cell_line.mdwn
+++ /dev/null
@@ -1,11 +0,0 @@
-[[!meta title="pages tagged cell line"]]
-
-A few notes that just scratch the surface of a vast field…
-
- - [[Echalier and Ohanessian (1969)|biblio/4976834]] reported a culture of _Drosophila_ cells that spontaneously transformed.
- - [[Schneider's (1972)|biblio/4625067]] report of the establishment of the S2 cell line.
- - [[Marteijn and coll. (2003)|biblio/12474249]] optimised a culture medium using a genetic algorithm.  This methdod
-   has been used at least once in invertebrates ([[Munroe and coll. (2019)|biblio/30747414]]).
- - [[Kawamura and coll. (2021)|biblio/33899125]] reported the use of plasmin to establish coral cell lines.
-
-[[!inline pages="tagged(cell_line)" limit=0]]

Café
diff --git a/biblio/9769143.mdwn b/biblio/9769143.mdwn
new file mode 100644
index 00000000..4313d084
--- /dev/null
+++ b/biblio/9769143.mdwn
@@ -0,0 +1,12 @@
+[[!meta title="Polyamine as a growth promoter for cultured insect cells."]]
+[[!tag cell_culture]]
+
+Mitsuhashi J.
+
+In Vitro Cell Dev Biol Anim. 1998 Sep;34(8):619-21. doi:10.1007/s11626-996-0007-9
+
+Polyamine as a growth promoter for cultured insect cells.
+
+[[!pmid 9769143 desc="At least one of putrescine, spermidine and spermine at 2
+µg per 1000 ml need to be in the culture medium of NIH-SaPe-4 cells (from the
+fly _Boettcherisca peregrina_) could be passaged more than 10 times."]]

Après café
diff --git a/biblio/m088p297.mdwn b/biblio/m088p297.mdwn
new file mode 100644
index 00000000..859a8104
--- /dev/null
+++ b/biblio/m088p297.mdwn
@@ -0,0 +1,14 @@
+[[!meta title="Lipid and lipid class content of the pelagic tunicate Oikopleura vanhoeffeni"]]
+[[!tag ]]
+
+Deibel, D., Cavaletto, J. F., Riehl, M., Gardner, W. S.
+
+Lipid and lipid class content of the pelagic tunicate _Oikopleura vanhoeffeni_.
+
+MEPS 88:297-302, 1992
+
+Phospholipids represent the large majority of _O. vanhoeffeni_'s lipids.
+“Sterol esters, wax esters, methyl esters and diglycerides were never found”.
+
+https://www.int-res.com/abstracts/meps/v88/
+https://www.int-res.com/articles/meps/88/m088p297.pdf
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 4c9263eb..e50d170d 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -288,7 +288,7 @@ Genes and pathways
    inner kinetochore cound not be found in the genome by ([[Feng and coll.,
    2019|biblio/31306061]]).
  - _Nodal_ is not found in _O. dioica_'s genome ([[Onuma and coll., 2020|biblio/32029598]]).
- - Peroxysomes and genes related to them ([[Žárský and Tachezy, 2015|biblio/26700421]];
+ - Peroxisomes and genes related to them ([[Žárský and Tachezy, 2015|biblio/26700421]];
    [[Kienle, Kloepper and Fasshauer, 2016|biblio/27756227]]).
  - _Mesp_, _Ets1/2b_, _Gata4/5/6_, _Mek1/2_,  _Hand-r_ and _Tbx1/10_ (heart development,
    [[Ferrández-Roldán and coll., 2021|biblio/34789899]]).
@@ -500,6 +500,9 @@ Physiology
  - Oxygen consumption increases with temperature (15°C vs 22°C) and activity (anesthesised
    vs control animals).  It scales with body weigth, and not with food concentration after
    correcting for body weight ([[Lombard, Sciandra and Gorsky, 2005|biblio/10.3354_meps301149]]).
+ - In line with the absence of peroxisomes in _O. dioica_, no wax esters
+   (storage lipids) were found in _O vanhoeffenni_, which is mostly containing
+   phospholipids [[Deibel and coll.,1992|biblio/m088p297]].
 
 House
 -----

Typo
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index f01b0f49..4c9263eb 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -444,7 +444,7 @@ Development
    Postlethwait (2000)|biblio/10753519]]).
  - Notochord cell precursors express _Brachyury_ like in other chordates
    ([[Bassham and Postlethwait (2000)|biblio/10753519]]).
- - Adult notochord cells proliferate ([[Søviknes and Glover, 2008|biblio/18258772]).
+ - Adult notochord cells proliferate ([[Søviknes and Glover, 2008|biblio/18258772]]).
  - Expression of development genes is retarded by polyunsaturated aldehydes produced
    by diatoms ([[Torres-Águila and coll., 2018|biblio/30272001]]).
  - Epithelial cells divide by mitosis during embryogenesis.  Once the final number

Notochord cell proliferation in the adult.
diff --git a/biblio/18258772.mdwn b/biblio/18258772.mdwn
new file mode 100644
index 00000000..c9ebd136
--- /dev/null
+++ b/biblio/18258772.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Continued growth and cell proliferation into adulthood in the notochord of the appendicularian Oikopleura dioica."]]
+[[!tag Oikopleura H3S10p]]
+
+Søviknes AM, Glover JC.
+
+Biol Bull. 2008 Feb;214(1):17-28. doi:10.2307/25066656
+
+Continued growth and cell proliferation into adulthood in the notochord of the appendicularian _Oikopleura dioica_.
+
+[[!pmid 18258772 desc="Actin stained with phalloidin, DNA stained with To-Pro-3, and BrdU stained with antibodies.  Dual H2S10p and BrdU staining in the adult notochord suggest cell proliferation."]]
diff --git a/tags/H3S10p.mdwn b/tags/H3S10p.mdwn
index 267b4cbd..3a389252 100644
--- a/tags/H3S10p.mdwn
+++ b/tags/H3S10p.mdwn
@@ -6,4 +6,8 @@ Dmitrov (2003)|biblio/12917355]] for review.
 Figure 1j of [[Ganot P1, Kallesøe T, Thompson EM (2007)|biblio/17123503]] shows
 H3S10p staining of meiotic chromosomes in π-conformation in mature oocytes.
 
+The monoclonal antibody 9706S used in [[Søviknes and Glover
+(2008)|biblio/18258772]] stains the phosphorylated serine 10 on histone 3.
+Double-staining with BrdU in the notocord suggests adult cell proliferation.
+
 [[!inline pages="tagged(H3S10p)" limit=0]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 4b589086..f01b0f49 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -444,6 +444,7 @@ Development
    Postlethwait (2000)|biblio/10753519]]).
  - Notochord cell precursors express _Brachyury_ like in other chordates
    ([[Bassham and Postlethwait (2000)|biblio/10753519]]).
+ - Adult notochord cells proliferate ([[Søviknes and Glover, 2008|biblio/18258772]).
  - Expression of development genes is retarded by polyunsaturated aldehydes produced
    by diatoms ([[Torres-Águila and coll., 2018|biblio/30272001]]).
  - Epithelial cells divide by mitosis during embryogenesis.  Once the final number

Add tag.
diff --git a/biblio/32085510.mdwn b/biblio/32085510.mdwn
index 7fb36d0b..9ffdef98 100644
--- a/biblio/32085510.mdwn
+++ b/biblio/32085510.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Animal, Fungi, and Plant Genome Sequences Harbor Different Non-Canonical Splice Sites."]]
-[[!tag Oikopleura]]
+[[!tag Oikopleura splicing]]
 
 Frey K, Pucker B.
 

Re-typo.
diff --git a/biblio/27756227.mdwn b/biblio/27756227.mdwn
index e78f5b84..3de86e31 100644
--- a/biblio/27756227.mdwn
+++ b/biblio/27756227.mdwn
@@ -7,4 +7,4 @@ BMC Evol Biol. 2016 Oct 18;16(1):215.
 
 Shedding light on the expansion and diversification of the Cdc48 protein family during the rise of the eukaryotic cell.
 
-[[!pmid 27756227 desc="Also reports the loss of peroxysomal genes in _Oikopleura_."]]
+[[!pmid 27756227 desc="Also reports the loss of peroxisomal genes in _Oikopleura_."]]

Typo
diff --git a/biblio/27756227.mdwn b/biblio/27756227.mdwn
index 4a11fe91..e78f5b84 100644
--- a/biblio/27756227.mdwn
+++ b/biblio/27756227.mdwn
@@ -7,4 +7,4 @@ BMC Evol Biol. 2016 Oct 18;16(1):215.
 
 Shedding light on the expansion and diversification of the Cdc48 protein family during the rise of the eukaryotic cell.
 
-[[!pmid 27756227 desc="Also reports the loss of peroximal genes in _Oikopleura_."]]
+[[!pmid 27756227 desc="Also reports the loss of peroxysomal genes in _Oikopleura_."]]

Medium optimisation.
diff --git a/biblio/12474249.mdwn b/biblio/12474249.mdwn
index 33f74698..0b1b128e 100644
--- a/biblio/12474249.mdwn
+++ b/biblio/12474249.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Optimization of a feed medium for fed-batch culture of insect cells using a genetic algorithm"]]
-[[!tag method machine_learning cell_culture]]
+[[!tag method machine_learning cell_culture cell_line]]
 
 Marteijn RC, Jurrius O, Dhont J, de Gooijer CD, Tramper J, Martens DE.
 
diff --git a/biblio/30747414.mdwn b/biblio/30747414.mdwn
new file mode 100644
index 00000000..dbb43ef1
--- /dev/null
+++ b/biblio/30747414.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Genetic algorithm as an optimization tool for the development of sponge cell culture media"]]
+[[!tag cell_culture machine_learning]]
+
+In Vitro Cell Dev Biol Anim. 2019 Mar;55(3):149-158. doi:10.1007/s11626-018-00317-0
+
+Munroe S, Sandoval K, Martens DE, Sipkema D, Pomponi SA.
+
+Genetic algorithm as an optimization tool for the development of sponge cell culture media
+
+[[!pmid 30747414 desc="4 generations of 30 experiments each screening the concentrations of all amino acids."]]
diff --git a/tags/cell_line.mdwn b/tags/cell_line.mdwn
index b3df749e..9a073fbd 100644
--- a/tags/cell_line.mdwn
+++ b/tags/cell_line.mdwn
@@ -4,6 +4,8 @@ A few notes that just scratch the surface of a vast field…
 
  - [[Echalier and Ohanessian (1969)|biblio/4976834]] reported a culture of _Drosophila_ cells that spontaneously transformed.
  - [[Schneider's (1972)|biblio/4625067]] report of the establishment of the S2 cell line.
- - [[Kawamura and coll (2021)|biblio/33899125]] reported the use of plasmin to establish coral cell lines.
+ - [[Marteijn and coll. (2003)|biblio/12474249]] optimised a culture medium using a genetic algorithm.  This methdod
+   has been used at least once in invertebrates ([[Munroe and coll. (2019)|biblio/30747414]]).
+ - [[Kawamura and coll. (2021)|biblio/33899125]] reported the use of plasmin to establish coral cell lines.
 
 [[!inline pages="tagged(cell_line)" limit=0]]

Retire one more tag.
diff --git a/biblio/20868489.mdwn b/biblio/20868489.mdwn
index bfc37a0b..c5927f58 100644
--- a/biblio/20868489.mdwn
+++ b/biblio/20868489.mdwn
@@ -1,3 +1,3 @@
 [[!meta title="An arthropod cis-regulatory element functioning in sensory organ precursor development dates back to the Cambrian."]]
-[[!tag enhancer sequence-conservation Drosophila]]
+[[!tag enhancer Drosophila]]
 [[!pmid 20868489 desc="The atonal sensory organ precursor enhancer (SOPE)"]]
diff --git a/tags/sequence-conservation.mdwn b/tags/sequence-conservation.mdwn
deleted file mode 100644
index 715a5bdf..00000000
--- a/tags/sequence-conservation.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged sequence-conservation"]]
-
-[[!inline pages="tagged(sequence-conservation)" actions="no" archive="yes"
-feedshow=10]]

Retiring the polyamides tag.
diff --git a/biblio/29192133.mdwn b/biblio/29192133.mdwn
index 4bf72d69..72bda7ee 100644
--- a/biblio/29192133.mdwn
+++ b/biblio/29192133.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Synthetic transcription elongation factors license transcription across repressive chromatin."]]
-[[!tag drug elongation polyamides]]
+[[!tag drug elongation]]
 
 Erwin GS, Grieshop MP, Ali A, Qi J, Lawlor M, Kumar D, Ahmad I, McNally A,
 Teider N, Worringer K, Sivasankaran R, Syed DN, Eguchi A, Ashraf M, Jeffery J, Xu
diff --git a/tags/polyamides.mdwn b/tags/polyamides.mdwn
deleted file mode 100644
index 0c75a041..00000000
--- a/tags/polyamides.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged polyamides"]]
-
-[[!inline pages="tagged(polyamides)" actions="no" archive="yes"
-feedshow=10]]

Retiring the rabbit tag.
diff --git a/biblio/10.1016_0005-2787_73_90317-1.mdwn b/biblio/10.1016_0005-2787_73_90317-1.mdwn
index 764677a6..a9532cb2 100644
--- a/biblio/10.1016_0005-2787_73_90317-1.mdwn
+++ b/biblio/10.1016_0005-2787_73_90317-1.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="The guanylation of transfer RNA: An enzymatic reaction"]]
-[[!tag rabbit reticulocyte tRNA guanylation]]
+[[!tag reticulocyte tRNA guanylation]]
 
 Walter R. Farkas, W.David Hankins, Ram Singh
 
diff --git a/tags/rabbit.mdwn b/tags/rabbit.mdwn
deleted file mode 100644
index 0d04fc27..00000000
--- a/tags/rabbit.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged rabbit"]]
-
-[[!inline pages="tagged(rabbit)" actions="no" archive="yes"
-feedshow=10]]

One more optimisation.
diff --git a/biblio/12474249.mdwn b/biblio/12474249.mdwn
new file mode 100644
index 00000000..33f74698
--- /dev/null
+++ b/biblio/12474249.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Optimization of a feed medium for fed-batch culture of insect cells using a genetic algorithm"]]
+[[!tag method machine_learning cell_culture]]
+
+Marteijn RC, Jurrius O, Dhont J, de Gooijer CD, Tramper J, Martens DE.
+
+Biotechnol Bioeng. 2003 Feb 5;81(3):269-78. doi:10.1002/bit.10465
+
+Optimization of a feed medium for fed-batch culture of insect cells using a genetic algorithm
+
+[[!pmid 12474249 desc="11 parameters encoded in 5 bits each.  4 generations of 20 experiments each.  _Helicoverpa zea_ cell-line HzAm1."]]

Correct tag
diff --git a/biblio/14677708.mdwn b/biblio/14677708.mdwn
index 77a3f875..5ce36a87 100644
--- a/biblio/14677708.mdwn
+++ b/biblio/14677708.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Optimization of a fermentation medium using neural networks and genetic algorithms"]]
-[[!tag method screen model machine learning]]
+[[!tag method screen model machine_learning]]
 
 Nagata Y, Chu KH
 
diff --git a/tags/learning.mdwn b/tags/learning.mdwn
deleted file mode 100644
index 628ce11c..00000000
--- a/tags/learning.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged learning"]]
-
-[[!inline pages="tagged(learning)" actions="no" archive="yes"
-feedshow=10]]
diff --git a/tags/machine.mdwn b/tags/machine.mdwn
deleted file mode 100644
index 94a991cd..00000000
--- a/tags/machine.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged machine"]]
-
-[[!inline pages="tagged(machine)" actions="no" archive="yes"
-feedshow=10]]

creating tag page tags/learning
diff --git a/tags/learning.mdwn b/tags/learning.mdwn
new file mode 100644
index 00000000..628ce11c
--- /dev/null
+++ b/tags/learning.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged learning"]]
+
+[[!inline pages="tagged(learning)" actions="no" archive="yes"
+feedshow=10]]

creating tag page tags/machine
diff --git a/tags/machine.mdwn b/tags/machine.mdwn
new file mode 100644
index 00000000..94a991cd
--- /dev/null
+++ b/tags/machine.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged machine"]]
+
+[[!inline pages="tagged(machine)" actions="no" archive="yes"
+feedshow=10]]

Screens
diff --git a/biblio/14677708.mdwn b/biblio/14677708.mdwn
new file mode 100644
index 00000000..77a3f875
--- /dev/null
+++ b/biblio/14677708.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Optimization of a fermentation medium using neural networks and genetic algorithms"]]
+[[!tag method screen model machine learning]]
+
+Nagata Y, Chu KH
+
+Biotechnol Lett. 2003 Nov;25(21):1837-42. doi:10.1023/a:1026225526558
+
+Optimization of a fermentation medium using neural networks and genetic algorithms
+
+[[!pmid 14677708 desc="Fermentation reaction producing hydantoinase. Four reagent concentrations can vary: molasses, NH4NO3, NaH2PO4 and MnCl2.  Data from 27 experiments was used to train a 4-6-1 neural network, and data from 3 other experiments was used to validate it.  A genetic algorithm was used to screen the predictions of the network for optimal fermentation.  It converged after 200–500 generations."]]
diff --git a/biblio/27180805.mdwn b/biblio/27180805.mdwn
index f54dc076..a2fa63a6 100644
--- a/biblio/27180805.mdwn
+++ b/biblio/27180805.mdwn
@@ -9,4 +9,4 @@ Hope JJ, Robins NP, Hush MR.
 
 Fast machine-learning online optimization of ultra-cold-atom experiments.
 
-[[!pmid desc="Primary paper for https://github.com/michaelhush/M-LOOP (Machine-learning online optimization package)"]]
+[[!pmid 27180805 desc="Primary paper for https://github.com/michaelhush/M-LOOP (Machine-learning online optimization package)"]]

Correct date.
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 1535701c..bfe0bfdb 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -22,7 +22,7 @@ which are ~40 MY apart.  “Approximately 75% of SBs stay within the A or B
 compartment”  “Overlaps of TAD boundaries and SB breakpoints in all comparisons
 are highly significant”
 
-[[Ranz and coll., 2001|biblio/11157786]] estimate an evolution rate of 0.9–1.4
+[[Ranz and coll., 2021|biblio/11157786]] estimate an evolution rate of 0.9–1.4
 chromosomal inversions fixed per million years in _Drosophila_.  A comparison
 between _D. mel_ and members of the _simulans_ species complex led to an estimation
 of 90 rearrangements per MY (_mel_ / _simulans_) and 226–354 per MY (_sim_ / _sim_)

One more chr with an outlying GC content.
diff --git a/biblio/35387384.mdwn b/biblio/35387384.mdwn
new file mode 100644
index 00000000..2417db0f
--- /dev/null
+++ b/biblio/35387384.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="High quality genome assembly of the anhydrobiotic midge provides insights on a single chromosome-based emergence of extreme desiccation tolerance."]]
+[[!tag chromosome]]
+
+Yoshida Y, Shaikhutdinov N, Kozlova O, Itoh M, Tagami M, Murata M, Nishiyori-Sueki H, Kojima-Ishiyama M, Noma S, Cherkasov A, Gazizova G, Nasibullina A, Deviatiiarov R, Shagimardanova E, Ryabova A, Yamaguchi K, Bino T, Shigenobu S, Tokumoto S, Miyata Y, Cornette R, Yamada TG, Funahashi A, Tomita M, Gusev O, Kikawada T.
+
+NAR Genom Bioinform. 2022 Apr 5;4(2):lqac029. doi:10.1093/nargab/lqac029
+
+High quality genome assembly of the anhydrobiotic midge provides insights on a single chromosome-based emergence of extreme desiccation tolerance.
+
+[[!pmid 35387384 desc="Sleeping chironomid _Polypedilum vanderplanki_.  Resists dessication.  Its chr4, and the genes it encodes has a lower GC content than the others.  Chr4 harbors genes and loci related to resistance to dehydratation.  “One element that may have caused the diversity in Chromosome 4 is DNA damage. We have previously observed extensive DNA damage during larvae anhydrobiosis and the induction of Rad51, an activator of double strand break repair during recovery”  Discusses that preference for NHEJ might have caused decrease of GC content."]]
diff --git a/tags/chromosome.mdwn b/tags/chromosome.mdwn
index fa845073..288710cd 100644
--- a/tags/chromosome.mdwn
+++ b/tags/chromosome.mdwn
@@ -2,9 +2,14 @@
 
 _in progressss_
 
+## GC content heterogeneity
+
 Two (out of 20) chromosomes in the genome of the unicellular green alga
 _Ostreococcus tauri_ have a markedly different GC and transposable element
 content compared to the others. [[Derelle et al., 2003|biblio/16868079]].
 
+Chr4 in _Polypedilum vanderplanki_ has lower GC content than the others
+([[Yoshida et al., 2022|biblio/35387384]]), and it has been speculated that it
+could have been caused by DNA damage.
 
 [[!inline pages="tagged(chromosome)" limit=0]]

creating tag page tags/vanadium
diff --git a/tags/vanadium.mdwn b/tags/vanadium.mdwn
new file mode 100644
index 00000000..5aeef776
--- /dev/null
+++ b/tags/vanadium.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged vanadium"]]
+
+[[!inline pages="tagged(vanadium)" actions="no" archive="yes"
+feedshow=10]]

vanadium
diff --git a/biblio/10.2108_zsj.13.489.mdwn b/biblio/10.2108_zsj.13.489.mdwn
new file mode 100644
index 00000000..5deb9077
--- /dev/null
+++ b/biblio/10.2108_zsj.13.489.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="The Mechanism of Accumulation of Vanadium by Ascidians: Some Progress towards an Understanding of this Unusual Phenomenon"]]
+[[!tag vanadium Ciona]]
+
+Hitoshi Michibata
+
+Zoological Science, 13(4), 489-502, (1 August 1996) doi:10.2108/zsj.13.489
+
+The Mechanism of Accumulation of Vanadium by Ascidians: Some Progress towards an Understanding of this Unusual Phenomenon
+
+[[!doi 10.2108/zsj.13.489 desc="Vanadium detected by neutron activation that causes γ-ray emission at 1,434 keV.  Blood cells of _Ascidia gemmata_ contained ~350 mM ov vanadium.  Other Phlebobranchia contained 20–60 mM, but _C. intestinalis_ contained only 0.6.  Stolidobranchia contained much lower amounts.  Vanadium-containing cells (vanadocytes) were identified as signet cells.  Sulfonic acid might be the counter ion.  Vanadocyte pH is very low (1.9–4.2).  There exist other low-pH cells that do not contain vanadium.  Accumulation of vanadium may involve a mechanism using a vacuolar-type H+-ATPase.  Vanadium contents of the embryo are low but increase during embryogenesis."]]
diff --git a/tags/Ciona.mdwn b/tags/Ciona.mdwn
index 2ac8eea9..9ac123bc 100644
--- a/tags/Ciona.mdwn
+++ b/tags/Ciona.mdwn
@@ -97,4 +97,9 @@ with respcet to _C. roulei_ ([[Nydam and Harrison, 2010|biblio/20403444]]).
  - Mitochondrial gene order differs even within the _Ciona_ genus ([[Gissi,
    Iannelli and Pesole 2004|biblio/15114417]]).
 
+## Other
+
+Blood cells of _C intestinalis_ (_robusta_?) contain vanadium ([[Michibata,
+1996|biblio/10.2108_zsj.13.489]]).
+
 [[!inline pages="tagged(Ciona)" actions="no" limit=0]]

ITSx
diff --git a/biblio/10.1111_2041-210X.12073.mdwn b/biblio/10.1111_2041-210X.12073.mdwn
index 9edb8cd1..3109ba43 100644
--- a/biblio/10.1111_2041-210X.12073.mdwn
+++ b/biblio/10.1111_2041-210X.12073.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Improved software detection and extraction of ITS1 and ITS2 from ribosomal ITS sequences of fungi and other eukaryotes for analysis of environmental sequencing data."]]
-[[!tag ribosome]]
+[[!tag software ribosome]]
 
 Bengtsson-Palme, J., Ryberg, M., Hartmann, M., Branco, S., Wang, Z., Godhe, A., De Wit, P., Sánchez-García, M., Ebersberger, I., de Sousa, F., Amend, A., Jumpponen, A., Unterseher, M., Kristiansson, E., Abarenkov, K., Bertrand, Y.J.K., Sanli, K., Eriksson, K.M., Vik, U., Veldre, V. and Nilsson, R.H.
 

ITSx
diff --git a/tags/ribosome.mdwn b/tags/ribosome.mdwn
index c0abef21..0a40a88c 100644
--- a/tags/ribosome.mdwn
+++ b/tags/ribosome.mdwn
@@ -1,4 +1,10 @@
 [[!meta title="pages tagged ribosome"]]
 
-[[!inline pages="tagged(ribosome)" actions="no" archive="yes"
-feedshow=10]]
+_in progress_
+
+The [ITSx](https://microbiology.se/software/itsx/) software detects ITS
+sequences from larger rDNA fragments by matching HMMS representing the tail of
+the 18S, the whole 5.8S and the head of the 28S
+([[|biblio/10.1111_2041-210X.12073]]).
+
+[[!inline pages="tagged(ribosome)" limit=0]]

À la maison
diff --git a/biblio/10.1111_2041-210X.12073.mdwn b/biblio/10.1111_2041-210X.12073.mdwn
new file mode 100644
index 00000000..9edb8cd1
--- /dev/null
+++ b/biblio/10.1111_2041-210X.12073.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Improved software detection and extraction of ITS1 and ITS2 from ribosomal ITS sequences of fungi and other eukaryotes for analysis of environmental sequencing data."]]
+[[!tag ribosome]]
+
+Bengtsson-Palme, J., Ryberg, M., Hartmann, M., Branco, S., Wang, Z., Godhe, A., De Wit, P., Sánchez-García, M., Ebersberger, I., de Sousa, F., Amend, A., Jumpponen, A., Unterseher, M., Kristiansson, E., Abarenkov, K., Bertrand, Y.J.K., Sanli, K., Eriksson, K.M., Vik, U., Veldre, V. and Nilsson, R.H.
+
+Methods Ecol Evol, 4: 914-919. 2013
+
+Improved software detection and extraction of ITS1 and ITS2 from ribosomal ITS sequences of fungi and other eukaryotes for analysis of environmental sequencing data. 
+
+[[!doi 10.1111/2041-210X.12073 desc="Fungal HMMs were computed for a 45-base-pair region of the immediate 3′ end of SSU, the 5′ and 3′ ends of 5.8S, and the 5′ end of LSU [...] The SSU is extracted as everything from the 5′ end of the query sequence to the 3′ end of SSU as indicated by the HMM match; the ITS1 is extracted 1 bp downstream from the end of SSU and 1 bp upstream of the start of 5.8S; and so on. [...] we evaluated the proportion of false positives by generating one million random sequences of 550 bp [...] Zero false-positive ‘ITS’ sequences were detected among the random sequences [...] The extractor cannot identify sequences of SSU, 5.8S or LSU shorter than c. 20 bp (25 bp for consistent performance)"]]

syntaxagain
diff --git a/biblio/10.1093_plankt_23.4.415.mdwn b/biblio/10.1093_plankt_23.4.415.mdwn
index 222b6b13..acaf83b6 100644
--- a/biblio/10.1093_plankt_23.4.415.mdwn
+++ b/biblio/10.1093_plankt_23.4.415.mdwn
@@ -7,4 +7,4 @@ Journal of Plankton Research, Volume 23, Issue 4, April 2001, Pages 415–423, d
 
 House Production by Oikopleura dioica (Tunicata, Appendicularia) Under Laboratory Conditions
 
-[[! doi:10.1093/plankt/23.4.415 desc="Generation time of Tôkyô bay's _O. dioica_: 6 days at 15°C, 4 days at 20°C and 3 days at 25°C.  Fed with _I. galbana_ and _Tetraselmis sp._  Individuals produced ~50 houses in their life.  Higher temperature increases house production (from ~0.5 / h at 15°C to ~ 0.8 / h at 25 °C.  Artificial clogging with the diatom _Ditylum_ increased house renewal.."]]
+[[!doi 10.1093/plankt/23.4.415 desc="Generation time of Tôkyô bay's _O. dioica_: 6 days at 15°C, 4 days at 20°C and 3 days at 25°C.  Fed with _I. galbana_ and _Tetraselmis sp._  Individuals produced ~50 houses in their life.  Higher temperature increases house production (from ~0.5 / h at 15°C to ~ 0.8 / h at 25 °C.  Artificial clogging with the diatom _Ditylum_ increased house renewal.."]]

Syntax
diff --git a/biblio/10.1093_plankt_23.4.415.mdwn b/biblio/10.1093_plankt_23.4.415.mdwn
index fd6c0a3f..222b6b13 100644
--- a/biblio/10.1093_plankt_23.4.415.mdwn
+++ b/biblio/10.1093_plankt_23.4.415.mdwn
@@ -7,4 +7,4 @@ Journal of Plankton Research, Volume 23, Issue 4, April 2001, Pages 415–423, d
 
 House Production by Oikopleura dioica (Tunicata, Appendicularia) Under Laboratory Conditions
 
-[[!doi:10.1093/plankt/23.4.415 desc="Generation time of Tôkyô bay's _O. dioica_: 6 days at 15°C, 4 days at 20°C and 3 days at 25°C.  Fed with _I. galbana_ and _Tetraselmis sp._  Individuals produced ~50 houses in their life.  Higher temperature increases house production (from ~0.5 / h at 15°C to ~ 0.8 / h at 25 °C.  Artificial clogging with the diatom _Ditylum_ increased house renewal.."]]
+[[! doi:10.1093/plankt/23.4.415 desc="Generation time of Tôkyô bay's _O. dioica_: 6 days at 15°C, 4 days at 20°C and 3 days at 25°C.  Fed with _I. galbana_ and _Tetraselmis sp._  Individuals produced ~50 houses in their life.  Higher temperature increases house production (from ~0.5 / h at 15°C to ~ 0.8 / h at 25 °C.  Artificial clogging with the diatom _Ditylum_ increased house renewal.."]]

More numbers.
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 444fa94a..4b589086 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -547,8 +547,9 @@ House
    clogging particles.  An individual stuck to the culture vessel could not inflate
    new houses, but nevertheless synthesised 7 rudiments (stacked on each other) before
    starving ([[Fenaux 1985|biblio/WOSA1985AYN8600012]].
- - Temperature and food availability increase house production from ~0.4 /h to ~0.8 / h
-   ([[Fenaux 1985|biblio/WOSA1985AYN8600012]], [[Sato, Tanaka and Ishimaru, 2001|biblio/10.1093_plankt_23.4.415]].
+ - Temperature and food availability increase house production from ~0.2 /h to ~0.4 / h
+   ([[Fenaux 1985|biblio/WOSA1985AYN8600012]], of from ~0.4 /h to ~0.8 / h
+   [[Sato, Tanaka and Ishimaru, 2001|biblio/10.1093_plankt_23.4.415]].
 
 Phenotypes
 ----------

Café
diff --git a/biblio/10.1093_plankt_23.4.415.mdwn b/biblio/10.1093_plankt_23.4.415.mdwn
index 70abeb49..fd6c0a3f 100644
--- a/biblio/10.1093_plankt_23.4.415.mdwn
+++ b/biblio/10.1093_plankt_23.4.415.mdwn
@@ -1,5 +1,5 @@
-[[!meta title=" House Production by Oikopleura dioica (Tunicata, Appendicularia) Under Laboratory Conditions"]]
-[[!tag to_read]]
+[[!meta title="House Production by Oikopleura dioica (Tunicata, Appendicularia) Under Laboratory Conditions"]]
+[[!tag Oikopleura]]
 
 Riki Sato, Yuji Tanaka, Takashi Ishimaru
 
@@ -7,4 +7,4 @@ Journal of Plankton Research, Volume 23, Issue 4, April 2001, Pages 415–423, d
 
 House Production by Oikopleura dioica (Tunicata, Appendicularia) Under Laboratory Conditions
 
-[[!doi 10.1093/plankt/23.4.415 desc="To read"]]
+[[!doi:10.1093/plankt/23.4.415 desc="Generation time of Tôkyô bay's _O. dioica_: 6 days at 15°C, 4 days at 20°C and 3 days at 25°C.  Fed with _I. galbana_ and _Tetraselmis sp._  Individuals produced ~50 houses in their life.  Higher temperature increases house production (from ~0.5 / h at 15°C to ~ 0.8 / h at 25 °C.  Artificial clogging with the diatom _Ditylum_ increased house renewal.."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 96372188..444fa94a 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -387,7 +387,9 @@ Development
    culture conditions might differ.  ~1 day generation time reported in microcosms
    at 29°C in Jamaica ([[Hopcroft and Roff, 1995|biblio/10.1093_plankt_17.2.205]]).
    ~1.2 day generation in the Seto inland sea ([[Uye and Ichino,
-   1995|biblio/10.1016_0022-0981_95_00004-B]]).
+   1995|biblio/10.1016_0022-0981_95_00004-B]]).  Tôkyô bay _O. dioica_ under
+   laboratory condiditons:  6 days at 15°C, 4 days at 20°C and 3 days at 25°C
+   ([[Sato, Tanaka and Ishimaru, 2001|biblio/10.1093_plankt_23.4.415]]).
  - Increased food abundance increases egg number but does not change diameter nor
    generation time ([[Troedsson and coll., 2002|biblio/10.3354_meps243083]]).
    Food reduction before day 4 causes growth arrest (GA), in which all cell cycles
@@ -501,6 +503,8 @@ Physiology
 House
 -----
 
+ - _O. dioica_ individuals produce ~50 houses in their life
+   ([[Sato, Tanaka and Ishimaru, 2001|biblio/10.1093_plankt_23.4.415]]).
  - The house was observed in details with India ink coloration by [[Fenaux
    1986|biblio/10.1007_BF00312043]].  He also observed that, when in the house,
    “the tails beat slowly when the suspended particles were numerous and rapidly
@@ -543,8 +547,8 @@ House
    clogging particles.  An individual stuck to the culture vessel could not inflate
    new houses, but nevertheless synthesised 7 rudiments (stacked on each other) before
    starving ([[Fenaux 1985|biblio/WOSA1985AYN8600012]].
- - Temperature and food availability increase house production
-   ([[Fenaux 1985|biblio/WOSA1985AYN8600012]].
+ - Temperature and food availability increase house production from ~0.4 /h to ~0.8 / h
+   ([[Fenaux 1985|biblio/WOSA1985AYN8600012]], [[Sato, Tanaka and Ishimaru, 2001|biblio/10.1093_plankt_23.4.415]].
 
 Phenotypes
 ----------

Café
diff --git a/biblio/WOSA1985AYN8600012.mdwn b/biblio/WOSA1985AYN8600012.mdwn
new file mode 100644
index 00000000..174366f0
--- /dev/null
+++ b/biblio/WOSA1985AYN8600012.mdwn
@@ -0,0 +1,19 @@
+[[!meta title="Rhythm of secretion of Oikopleurid's houses"]]
+[[!tag Oikopleura]]
+
+Robert Fenaux
+
+Rhythm of secretion of Oikopleurid's houses
+
+Bulletin of Marine Science, Volume 37, Number 2, September 1985, pp. 498-503(6)
+
+An individual unable to expand its houses and feed was shown to have secreted 7
+house rudiments stacked on each other before dying.  Number of houses secreted
+by hour in a 12 h period: 0.17 ± 0.04 at 14°C; 0.23 ± 0.04 at 16°C; 0.30 ± 0.04
+at 18°C; 0.36 ± 0.06 at 20°C and 0.44 ± 0.04 at 22°C.  Increase of food supply
+increases house production.  Individuals in artificial seawater still produce
+and discard houses before dying of starvation.
+
+https://www.ingentaconnect.com/content/umrsmas/bullmar/1985/00000037/00000002/art00012
+
+No PMID, no DOI found. WOS ID: A1985AYN8600012
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index e96d6d0e..96372188 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -539,6 +539,12 @@ House
    epithelium, using multiple microscopy techniques [[Razghandi and coll., 2020|biblio/34041785]].
  - Abandonned houses bring nanoplankton into the copepod food chain
    ([[Alldredge AL, 1972|biblio/17780989]]).
+ - _O. dioica_ discards houses for new ones even in artificial seawater with no
+   clogging particles.  An individual stuck to the culture vessel could not inflate
+   new houses, but nevertheless synthesised 7 rudiments (stacked on each other) before
+   starving ([[Fenaux 1985|biblio/WOSA1985AYN8600012]].
+ - Temperature and food availability increase house production
+   ([[Fenaux 1985|biblio/WOSA1985AYN8600012]].
 
 Phenotypes
 ----------

Syntenic correlation indices.
diff --git a/biblio/12242252.mdwn b/biblio/12242252.mdwn
new file mode 100644
index 00000000..54eebb3e
--- /dev/null
+++ b/biblio/12242252.mdwn
@@ -0,0 +1,23 @@
+[[!meta title="Measures of synteny conservation between species pairs."]]
+[[!tag synteny method]]
+
+Housworth EA, Postlethwait J
+
+Genetics. 2002 Sep;162(1):441-8. doi:10.1093/genetics/162.1.441
+
+Measures of synteny conservation between species pairs.
+
+[[!pmid 12242252 desc="Introduces a syntenic correlation measure, ρ, which is a
+scaled chi-square statistic, and an alternative measure λ with measures “the
+proportion of errors made in assigning a gene to a chromosome in one species
+that can be eliminated by knowing which chromosome the orthologue belongs to in
+the other species.”"]]
+
+“_We introduce a measure of genomic conservation, which we call syntenic
+correlation, which corresponds to a measure of how far the orthologues are from
+being independently scattered in the genomes of the two species. This measure
+is standardized to be between zero, for completely randomized arrangements of
+orthologues between the genomes, and one, for two genomes with perfect synteny
+conservation. Further, this measure can be used to compare genomic distances
+(i.e., Oxford grids) between many pairs of species._”
+
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 9fee169a..1535701c 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -84,6 +84,12 @@ Squid chromosomes still have synteny with scallop, but gene order is scrambled
    orthologue co-occurs close by in the other genome. It varies between 0 (no
    co-occurrence) and 1 (complete gene order conservation)”.
 
+ - [[Housworth and Postlethwait, 2002|biblio/12242252]] defined the syntenic
+   correlation measure ρ, based on chi-square and an alternative λ not based on
+   chi-square.  Both attempt to estimate how wrong we would be to hypothesise
+   that a given gene has its orthologue in a homologous chromosome of a related
+   species.
+
  - “Chains” and “nets” of pairwise alignements between two genomes are described
    in [[Kent and coll, 2003|biblio/14500911]].
 

O. tauri
diff --git a/biblio/16868079.mdwn b/biblio/16868079.mdwn
new file mode 100644
index 00000000..5be80189
--- /dev/null
+++ b/biblio/16868079.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Genome analysis of the smallest free-living eukaryote Ostreococcus tauri unveils many unique features"]]
+[[!tag chromosome genome]]
+
+Derelle E, Ferraz C, Rombauts S, Rouzé P, Worden AZ, Robbens S, Partensky F, Degroeve S, Echeynié S, Cooke R, Saeys Y, Wuyts J, Jabbari K, Bowler C, Panaud O, Piégu B, Ball SG, Ral JP, Bouget FY, Piganeau G, De Baets B, Picard A, Delseny M, Demaille J, Van de Peer Y, Moreau H.
+
+Proc Natl Acad Sci U S A. 2006 Aug 1;103(31):11647-52. doi:10.1073/pnas.0604795103
+
+Genome analysis of the smallest free-living eukaryote _Ostreococcus tauri_ unveils many unique features.
+
+[[!pmid 16868079 desc="Half of chromosome 2 and the whole of chromosome 19 differ from the rest of the genome by a lower GC content (52% instead of 59%) and a higher frequency of repeated regions (they contain 77% of the 417 repeat elements).  Chr2 has also a different codon usage and smaller introns.  The genes on chr19 tend to be less related the “green lineage” (photosynthetic cells that gave rise to plants)."]]
diff --git a/tags/chromosome.mdwn b/tags/chromosome.mdwn
index 74f69441..fa845073 100644
--- a/tags/chromosome.mdwn
+++ b/tags/chromosome.mdwn
@@ -1,3 +1,10 @@
 [[!meta title="pages tagged chromosome"]]
 
+_in progressss_
+
+Two (out of 20) chromosomes in the genome of the unicellular green alga
+_Ostreococcus tauri_ have a markedly different GC and transposable element
+content compared to the others. [[Derelle et al., 2003|biblio/16868079]].
+
+
 [[!inline pages="tagged(chromosome)" limit=0]]

Remove unused tag.
diff --git a/biblio/22422449.mdwn b/biblio/22422449.mdwn
index c795cf45..abba5cbf 100644
--- a/biblio/22422449.mdwn
+++ b/biblio/22422449.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Associations with early-life socio-economic position in adult DNA methylation."]]
-[[!tag olfaction epigenetic cohort environment]]
+[[!tag olfaction epigenetic environment]]
 
 Borghol N, Suderman M, McArdle W, Racine A, Hallett M, Pembrey M, Hertzman C, Power C, Szyf M.
 
diff --git a/tags/cohort.mdwn b/tags/cohort.mdwn
deleted file mode 100644
index 26413828..00000000
--- a/tags/cohort.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged cohort"]]
-
-[[!inline pages="tagged(cohort)" actions="no" archive="yes"
-feedshow=10]]

Typo
diff --git a/tags/Drosophila.mdwn b/tags/Drosophila.mdwn
index ec506cc1..dfa4353d 100644
--- a/tags/Drosophila.mdwn
+++ b/tags/Drosophila.mdwn
@@ -3,7 +3,7 @@
 **  Work in progress **
 
 A phylogeny of ~150 _Drosophila_ species using > 2000 BUSCO genes:
-[[Suvofov et al., 2022|biblio/34788634]].
+[[Suvorov et al., 2022|biblio/34788634]].
 
 ### _pseudoobscura_
 

Droso
diff --git a/biblio/34788634.mdwn b/biblio/34788634.mdwn
new file mode 100644
index 00000000..90c4a52a
--- /dev/null
+++ b/biblio/34788634.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Widespread introgression across a phylogeny of 155 Drosophila genomes"]]
+[[!tag Drosophila]]
+
+Suvorov A, Kim BY, Wang J, Armstrong EE, Peede D, D'Agostino ERR, Price DK, Waddell P, Lang M, Courtier-Orgogozo V, David JR, Petrov D, Matute DR, Schrider DR, Comeault AA.
+
+Curr Biol. 2022 Jan 10;32(1):111-123.e5. doi:10.1016/j.cub.2021.10.052
+
+Widespread introgression across a phylogeny of 155 Drosophila genomes.
+
+[[!pmid 34788634 desc="2,791 BUSCOs extracted from 155 genomes (149 species) to compute a phylogenetic tree.  Introgressions were studied in 9 clades."]]
diff --git a/tags/Drosophila.mdwn b/tags/Drosophila.mdwn
index ac722da8..ec506cc1 100644
--- a/tags/Drosophila.mdwn
+++ b/tags/Drosophila.mdwn
@@ -2,6 +2,9 @@
 
 **  Work in progress **
 
+A phylogeny of ~150 _Drosophila_ species using > 2000 BUSCO genes:
+[[Suvofov et al., 2022|biblio/34788634]].
+
 ### _pseudoobscura_
 
 Analysis of Cox2 sequences of _Drosophila_ species by [[Beckenbach, Wei and Liu

Dentiste
diff --git a/biblio/35588743.mdwn b/biblio/35588743.mdwn
new file mode 100644
index 00000000..1b151467
--- /dev/null
+++ b/biblio/35588743.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Mixing genome annotation methods in a comparative analysis inflates the apparent number of lineage-specific genes."]]
+[[!tag annotation method]]
+
+Weisman CM, Murray AW, Eddy SR.
+
+Curr Biol. 2022 May 12:S0960-9822(22)00721-7. doi:10.1016/j.cub.2022.04.085
+
+Mixing genome annotation methods in a comparative analysis inflates the apparent number of lineage-specific genes.
+
+[[!pmid 35588743 desc="“In all but one of the eight cases in Figure 1, the increase is more than 2-fold, suggesting that the majority of lineage-specific genes inferred in heterogeneous annotations are artifacts of the heterogeneity.”  “As expected, six-frame translation homology searches dramatically reduce the apparent number of lineage-specific genes.”"]]

published
diff --git a/biblio/10.1101_2020.03.16.993428.mdwn b/biblio/10.1101_2020.03.16.993428.mdwn
deleted file mode 100644
index f14b9cc5..00000000
--- a/biblio/10.1101_2020.03.16.993428.mdwn
+++ /dev/null
@@ -1,10 +0,0 @@
-[[!meta title="Overcoming uncollapsed haplotypes in long-read assemblies of non-model organisms"]]
-[[!tag bioRxiv assembly benchmark]]
-
-Nadège Guiglielmoni, Antoine Houtain, Alessandro Derzelle, Karine van Doninck, Jean-François Flot
-
-bioRxiv 2020.03.16.993428; doi: https://doi.org/10.1101/2020.03.16.993428 
-
-Overcoming uncollapsed haplotypes in long-read assemblies of non-model organisms
-
-[[!pmid 10.1101/2020.03.16.993428 desc="Benchark using a bdelloid rotifer.  Performance of most software plateaus over 50× depth. purge_dups performed well on Flye assemblies.  Filtering our shorter reads did not dramatically change the N50 of Flye 2.5 assemblies"]]
diff --git a/biblio/34090340.mdwn b/biblio/34090340.mdwn
new file mode 100644
index 00000000..bc2ee063
--- /dev/null
+++ b/biblio/34090340.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Overcoming uncollapsed haplotypes in long-read assemblies of non-model organisms"]]
+[[!tag assembly benchmark]]
+
+Nadège Guiglielmoni, Antoine Houtain, Alessandro Derzelle, Karine van Doninck, Jean-François Flot
+
+BMC Bioinformatics. 2021 Jun 5;22(1):303. doi:10.1186/s12859-021-04118-3
+
+Overcoming uncollapsed haplotypes in long-read assemblies of non-model organisms
+
+[[!pmid 34090340 desc="Benchark using a bdelloid rotifer.  Performance of most software plateaus over 50× depth. purge_dups performed well on Flye assemblies.  Filtering our shorter reads did not dramatically change the N50 of Flye 2.5 assemblies"]]

Café
diff --git a/biblio/10331260.mdwn b/biblio/10331260.mdwn
new file mode 100644
index 00000000..d79ef5e4
--- /dev/null
+++ b/biblio/10331260.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Evolutionary instability of operon structures disclosed by sequence comparisons of complete microbial genomes."]]
+[[!tag operon]]
+
+Itoh T, Takemoto K, Mori H, Gojobori T.
+
+Mol Biol Evol. 1999 Mar;16(3):332-46. doi:10.1093/oxfordjournals.molbev.a026114
+
+Evolutionary instability of operon structures disclosed by sequence comparisons of complete microbial genomes.
+
+[[!pmid 10331260 desc="Search accross prokaryotes, archea and eukaryotes.  No operon conservation between bacteria and yeast, except perhaps _gal_.  Many operons destroyed in bacteria, although some very conserved ones remain (for instance for ribosomal proteins).  Proposes a partimonious way to estimate operon creation and destruction."]]
diff --git a/biblio/35658077.mdwn b/biblio/35658077.mdwn
new file mode 100644
index 00000000..4f9c3be4
--- /dev/null
+++ b/biblio/35658077.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Repeated translocation of a supergene underlying rapid sex chromosome turnover in Takifugu pufferfish."]]
+[[!tag chromosome sex fish]]
+
+Kabir A, Ieda R, Hosoya S, Fujikawa D, Atsumi K, Tajima S, Nozawa A, Koyama T, Hirase S, Nakamura O, Kadota M, Nishimura O, Kuraku S, Nakamura Y, Kobayashi H, Toyoda A, Tasumi S, Kikuchi K.
+
+Proc Natl Acad Sci U S A. 2022 Jun 7;119(23):e2121469119. doi:10.1073/pnas.2121469119
+
+Repeated translocation of a supergene underlying rapid sex chromosome turnover in Takifugu pufferfish.
+
+[[!pmid 35658077 desc="The genome of the green puffer (Takifugu alboplumbeus or T. niphobles) was assembled.  SNP analysis of multiple species showed that in three fugu species (T. niphobles, T. snyderi and T. vermicularis), the sex determination locus is not _Amrh2_ anymore (like it is in T. rubripes), but a new supergene containing _GsdfY_.  This supergene appears to have moved to a new autosome more than once in the evolutionary history of these species."]]
diff --git a/tags/trans-splicing.mdwn b/tags/trans-splicing.mdwn
index b1a06e15..c4000976 100644
--- a/tags/trans-splicing.mdwn
+++ b/tags/trans-splicing.mdwn
@@ -1,5 +1,7 @@
 [[!meta title="pages tagged trans-splicing"]]
 
+_Also check the [[operon]] tag..._
+
 Trans-spplicing of a splice leader from a nematode and a trypanosome was shown
 to be possible in COS cells and HeLa cell extracts by [[Bruzik and Maniatis, 1992|biblio/1465136]].
 

trans-splicing
diff --git a/biblio/20142326.mdwn b/biblio/20142326.mdwn
new file mode 100644
index 00000000..3a597f2d
--- /dev/null
+++ b/biblio/20142326.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Convergent origins and rapid evolution of spliced leader trans-splicing in metazoa: insights from the ctenophora and hydrozoa."]]
+[[!tag trans-splicing]]
+
+Derelle R, Momose T, Manuel M, Da Silva C, Wincker P, Houliston E.
+
+RNA. 2010 Apr;16(4):696-707. doi:10.1261/rna.1975210
+
+Convergent origins and rapid evolution of spliced leader trans-splicing in metazoa: insights from the ctenophora and hydrozoa.
+
+[[!pmid 20142326 desc="“First evidence for SL trans-splicing in ctenophores.” (_Pleurobrachia pileus_ and _Mnemiopsis leidyi_)  “Analysis of data sets for the hydrozoans _H. magnipapillata_ and _C. hemisphaerica_ revealed a high number of SL sequence variants per species.”  The same gene may use different splice leaders.  An adenosine-rich region is found between the trans-splicing site and the transcription initiation site in hydrozoans, but not in other species (including _Oikopleura_."]]
diff --git a/tags/trans-splicing.mdwn b/tags/trans-splicing.mdwn
index 5cfd6dad..b1a06e15 100644
--- a/tags/trans-splicing.mdwn
+++ b/tags/trans-splicing.mdwn
@@ -15,4 +15,9 @@ The splice leader is 16-nt in C. intestinalis ([[Satou et al,
 dioica_ is `TTT(C/T/A)AGA`, which is the same as the cis-splicing acceptor
 with an extra `A` at the end.
 
+Trans-splicing is also found in cnidarians ([[Derelle et al., 2010|biblio/20142326]]).
+
+In hydrozoans, the region between the trans-splicing site and the translation initiation site
+is A-rich ([[Derelle et al., 2010|biblio/20142326]]).
+
 [[!inline pages="tagged(trans-splicing)" actions="no" limit=0]]

typo
diff --git a/biblio/35508532.mdwn b/biblio/35508532.mdwn
index c8a376c9..b3a594b8 100644
--- a/biblio/35508532.mdwn
+++ b/biblio/35508532.mdwn
@@ -7,4 +7,4 @@ Nat Commun. 2022 May 4;13(1):2427. doi:10.1038/s41467-022-29748-w
 
 Genome and transcriptome mechanisms driving cephalopod evolution.
 
-[[!pmid 35508532 desc="Most chromosomes of _Doryteuthis pealeii_ have a direct counterpart in _Euprymna scolopes_ and retained visible synteny with the scallop Mizuhopecten yessoensis_.  In both cases, the gene order in syntenic regions is considerably scrambled."]]
+[[!pmid 35508532 desc="Most chromosomes of _Doryteuthis pealeii_ have a direct counterpart in _Euprymna scolopes_ and retained visible synteny with the scallop _Mizuhopecten yessoensis_.  In both cases, the gene order in syntenic regions is considerably scrambled."]]

Typo
diff --git a/biblio/35108053.mdwn b/biblio/35108053.mdwn
index 00ad2619..668047dd 100644
--- a/biblio/35108053.mdwn
+++ b/biblio/35108053.mdwn
@@ -7,4 +7,4 @@ Sci Adv. 2022 Feb 4;8(5):eabi5884. doi:10.1126/sciadv.abi5884
 
 Deeply conserved synteny and the evolution of metazoan chromosomes.
 
-[[!pmid 35108053 desc="29 ancestral linkage groups (ALG) or 24 bilaterian linkage groups, containg usually less than 100 genes.  Karyotypes change by insertion, fusion or "fusion with mixing" between chromosomes.  Traces of conserved synteny with unicellular genomes (choanoflagellates, ichtyosporeans) were found.]]
+[[!pmid 35108053 desc="29 ancestral linkage groups (ALG) or 24 bilaterian linkage groups, containg usually less than 100 genes.  Karyotypes change by insertion, fusion or "fusion with mixing" between chromosomes.  Traces of conserved synteny with unicellular genomes (choanoflagellates, ichtyosporeans) were found."]]

typo
diff --git a/biblio/35042416.mdwn b/biblio/35042416.mdwn
index 6159ce3b..0b595139 100644
--- a/biblio/35042416.mdwn
+++ b/biblio/35042416.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Multiscale analysis of the randomization limits of the chromosomal gene organization between Lepidoptera and Diptera."]]
-[[!tag Drosphila synteny]]
+[[!tag Drosophila synteny]]
 
 Ranz JM, González PM, Su RN, Bedford SJ, Abreu-Goodger C, Markow T.
 
diff --git a/tags/Drosphila.mdwn b/tags/Drosphila.mdwn
deleted file mode 100644
index f636bc99..00000000
--- a/tags/Drosphila.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged Drosphila"]]
-
-[[!inline pages="tagged(Drosphila)" actions="no" archive="yes"
-feedshow=10]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 2b5aa969..9fee169a 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -29,7 +29,10 @@ of 90 rearrangements per MY (_mel_ / _simulans_) and 226–354 per MY (_sim_ / _
 ([[Chakraborty and coll., 2021|biblio/33563718]]).
 
 In insects, the Osiris gene family shows conservation of synteny over ~400
-million years ([[Sah and coll., 2012|biblio/22384409]]).
+million years ([[Sah and coll., 2012|biblio/22384409]]).  At the same time
+scale (~400 million years), synteny conservation of the X chromosome is also
+visible between fruit flies and cockroaches ([[Meisel, Delclos and Wexler,
+2019|biblio/31806031]]).
 
 Butterfly chromosome still have synteny with Muller elements ([[Ranz and coll,
 2022|biblio/35042416]]).

creating tag page tags/Drosphila
diff --git a/tags/Drosphila.mdwn b/tags/Drosphila.mdwn
new file mode 100644
index 00000000..f636bc99
--- /dev/null
+++ b/tags/Drosphila.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged Drosphila"]]
+
+[[!inline pages="tagged(Drosphila)" actions="no" archive="yes"
+feedshow=10]]

Oublié je-ne-sais quandÃÃ
diff --git a/biblio/35042416.mdwn b/biblio/35042416.mdwn
new file mode 100644
index 00000000..6159ce3b
--- /dev/null
+++ b/biblio/35042416.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Multiscale analysis of the randomization limits of the chromosomal gene organization between Lepidoptera and Diptera."]]
+[[!tag Drosphila synteny]]
+
+Ranz JM, González PM, Su RN, Bedford SJ, Abreu-Goodger C, Markow T.
+
+Proc Biol Sci. 2022 Jan 26;289(1967):20212183. doi:10.1098/rspb.2021.2183
+
+Multiscale analysis of the randomization limits of the chromosomal gene organization between Lepidoptera and Diptera.
+
+[[!pmid 35042416 desc="Uses 5 to 7000 1-to-1 orthologues to study synteny in insects that speciated ~100 My ago.  Uses a definition of microsynteny with no constrains on orientation, where transposition does not interrupt synteny, and where triplets of orthologues do not need to be in the same order.  A repurposed tissue-specificity index identifies ancestral relationships between chromosomes.  Searched for conserved clusters (Hox etc.) by allowing a distance of 250 kbp between genes, regardless the number of interveining genes.  Found that most clusters still exist, but rearranged."]]

Bursaphelenchus okinawaensis
diff --git a/biblio/33093047.mdwn b/biblio/33093047.mdwn
new file mode 100644
index 00000000..bf118d13
--- /dev/null
+++ b/biblio/33093047.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Telomere-to-Telomere Genome Assembly of _Bursaphelenchus okinawaensis_ Strain SH1."]]
+[[!tag nematode genome]]
+
+Sun S, Shinya R, Dayi M, Yoshida A, Sternberg PW, Kikuchi T.
+
+Microbiol Resour Announc. 2020 Oct 22;9(43):e01000-20. doi:10.1128/MRA.01000-20
+
+Telomere-to-Telomere Genome Assembly of _Bursaphelenchus okinawaensis_ Strain SH1.
+
+[[!pmid 33093047 desc="70 Mb genome, 6 chromosomes, enriched for repeats at the arms ends.  Hi-C contact map shows strong interaction between all the central regions of the chromosomes."]]
diff --git a/tags/nematode.mdwn b/tags/nematode.mdwn
index b1d7870a..8d95f5bb 100644
--- a/tags/nematode.mdwn
+++ b/tags/nematode.mdwn
@@ -45,4 +45,8 @@
    genome sequence is evloving towards effective haploidy ([[Abad and coll.,
    2008|biblio/18660804]]).
 
+ - _Bursaphelenchus okinawaensis_ has a genome of 70 Mb in 6 chromosomes of similar length.
+   The Hi-C contact map shows strong interaction between the centre of all chromosomes
+   ([[Sun and coll., 2020|biblio/33093047]]).
+
 [[!inline pages="tagged(nematode)" limit=0]]

Café
diff --git a/biblio/35585232.mdwn b/biblio/35585232.mdwn
new file mode 100644
index 00000000..4e22bbc3
--- /dev/null
+++ b/biblio/35585232.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Fast and efficient DNA replication with purified human proteins."]]
+[[!tag replication]]
+
+Baris Y, Taylor MRG, Aria V, Yeeles JTP.
+
+Nature. 2022 Jun;606(7912):204-210. doi:10.1038/s41586-022-04759-1
+
+Fast and efficient DNA replication with purified human proteins.
+
+[[!pmid 35585232 desc="A minimal human replisome comprising only CMG, Polε and PCNA has a speed of 1.67 kb min−1.  Addition of AND-1, TIM–TIPIN, CLASPIN and CTF18–RFC increases that speed to 4.41 kb min−1, “which is over twice the mean rate and towards the upper limit of observed fork rate distributions measured in human cells”."]]
diff --git a/tags/replication.mdwn b/tags/replication.mdwn
index 9bffe547..cf7a1c03 100644
--- a/tags/replication.mdwn
+++ b/tags/replication.mdwn
@@ -1,4 +1,3 @@
 [[!meta title="pages tagged replication"]]
 
-[[!inline pages="tagged(replication)" actions="no" archive="yes"
-feedshow=10]]
+[[!inline pages="tagged(replication)" actions="no" limit=0]]

SyRI
diff --git a/biblio/31842948.mdwn b/biblio/31842948.mdwn
new file mode 100644
index 00000000..dbf41f32
--- /dev/null
+++ b/biblio/31842948.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Goel M, Sun H, Jiao WB, Schneeberger K. SyRI: finding genomic rearrangements and local sequence differences from whole-genome assemblies."]]
+[[!tag software genome synteny]]
+
+Goel M, Sun H, Jiao WB, Schneeberger K.
+
+Genome Biol. 2019 Dec 16;20(1):277. doi:10.1186/s13059-019-1911-0
+
+SyRI: finding genomic rearrangements and local sequence differences from whole-genome assemblies.
+
+[[!pmid 31842948 desc="Identifies inversions, translocations, duplications, etc., but requires that the two genomes have the same number of chromosomes and that they are oriented the same direction."]]
diff --git a/tags/assembly.mdwn b/tags/assembly.mdwn
index 987f4ede..efd9bd6c 100644
--- a/tags/assembly.mdwn
+++ b/tags/assembly.mdwn
@@ -91,7 +91,8 @@ AUGUSTUS can be trained for a new species with transcriptome data, as explained
 by [[Hoff and Stanke, 2018|biblio/30466165]].
 
 A reference assembly can be used to search for structural variants in a different
-individual, for instance with NanoSV ([[Cretu Stancu and coll., 2017|biblio/29109544]]).
+individual, for instance with NanoSV ([[Cretu Stancu and coll., 2017|biblio/29109544]])
+or SyRI ([[Goel and coll., 2019|biblio/31842948]]).
 
 In [[2003, Kent and coll.|biblio/14500911]] aligned the human and mouse genome
 together using the BLASTZ and AXTCHAIN software.

creating tag page tags/Brenner
diff --git a/tags/Brenner.mdwn b/tags/Brenner.mdwn
new file mode 100644
index 00000000..40556bc0
--- /dev/null
+++ b/tags/Brenner.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged Brenner"]]
+
+[[!inline pages="tagged(Brenner)" actions="no" archive="yes"
+feedshow=10]]

Café
diff --git a/biblio/4379508.mdwn b/biblio/4379508.mdwn
new file mode 100644
index 00000000..54f9f072
--- /dev/null
+++ b/biblio/4379508.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Collinearity and the genetic code"]]
+[[!tag review Brenner]]
+
+S Brenner
+
+Proc R Soc Lond B Biol Sci. 1966 Mar 22;164(995):170-80. doi:10.1098/rspb.1966.0021
+
+Collinearity and the genetic code.
+
+[[!pmid 4379508 desc="A very readable review on how it was demonstrated that the DNA codes for the proteins."]]

Inversions.
diff --git a/biblio/11731496.mdwn b/biblio/11731496.mdwn
new file mode 100644
index 00000000..96633d7d
--- /dev/null
+++ b/biblio/11731496.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Twin priming: a proposed mechanism for the creation of inversions in L1 retrotransposition."]]
+[[!tag repeat]]
+
+Ostertag EM, Kazazian HH Jr.
+
+Genome Res. 2001 Dec;11(12):2059-65. doi:10.1101/gr.205701
+
+Twin priming: a proposed mechanism for the creation of inversions in L1 retrotransposition.
+
+[[!pmid 11731496 desc="The RNA is primed by the L1 reverse-transcriptase at both sides of the endonucleotide cleavage, resulting in a partial or complete inversion flanked by a tandem site duplication."]]

Café
diff --git a/biblio/10.1101_2022.05.25.493221.mdwn b/biblio/10.1101_2022.05.25.493221.mdwn
new file mode 100644
index 00000000..5ff4aa22
--- /dev/null
+++ b/biblio/10.1101_2022.05.25.493221.mdwn
@@ -0,0 +1,14 @@
+[[!meta title="Laboratory study of Fritillaria lifecycle reveals larvacean commonalities and key morphogenetic events leading to taxon-specific anatomy"]]
+[[!tag bioRxiv Oikopleura]]
+
+Simon Henriet, Anne Elin Aasjord, Daniel Marc Chourrout
+
+bioRxiv https://doi.org/10.1101/2022.05.25.493221 May 25, 2022.
+
+Laboratory study of Fritillaria lifecycle reveals larvacean commonalities and key morphogenetic events leading to taxon-specific anatomy
+
+[[!doi 10.1101/2022.05.25.493221 desc="Possibly parasited by _Sphaeripara_ or
+_Oodinium_.  Fed with _Micromonas_, _Phaeocystis_ and _Synechococcus_ in
+culture. 4 chromosomes are visible in oocytes by DAPI staining.
+Self-fertilization was never observed.  Cellulose-producing cells identified by
+staining with a carbohydrate-binding-module (CBM)."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index b64a39a4..e96d6d0e 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -699,6 +699,7 @@ Culture protocols (incomplete list):
  - Thompson lab protocol: [[Bouquet and coll., 2009|biblio/19461862]].
  - Cañestro lab protocol: [[Martí-Solans and coll., 2015|biblio/25044679]].
  - OIST's culture protocol: [[Masunaga and coll., 2020|biblio/32628172]].
+ - Report of _Fritilaria_ being cultured: [[Henriet, Aasjord and Chourrout, 2022|biblio/10.1101_2022.05.25.493221]].
 
 Food tested in laboratory (totally incomplete list):
 

Café
diff --git a/biblio/35449136.mdwn b/biblio/35449136.mdwn
new file mode 100644
index 00000000..8402741f
--- /dev/null
+++ b/biblio/35449136.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Emergence of novel cephalopod gene regulation and expression through large-scale genome reorganization."]]
+[[!tag genome synteny]]
+
+Emergence of novel cephalopod gene regulation and expression through large-scale genome reorganization.
+
+Nat Commun. 2022 Apr 21;13(1):2172. doi:10.1038/s41467-022-29694-7
+
+Schmidbaur H, Kawaguchi A, Clarence T, Fu X, Hoang OP, Zimmermann B, Ritschard EA, Weissenbacher A, Foster JS, Nyholm SV, Bates PA, Albertin CB, Tanaka E, Simakov O.
+
+[[!pmid 35449136 desc="Defines “microsyntenic blocks as at least three or more co-occurring orthologous genes with up to five intervening genes with no constraints on their collinearity”. Found 505 microsyntenies unique to cephalopods and 275 unique to metazooans.  “Genes in cephalopod-specific microsyntenies do not tend to be co-expressed, despite their tight co-localization”  “In contrast [to cephalopod-specific microsyntenies], conserved metazoan microsyntenies show significant (Wilcoxon test, p ≤ 0.001) co-expression when compared to simulated microsyntenies”"]]

Café
diff --git a/biblio/35508532.mdwn b/biblio/35508532.mdwn
new file mode 100644
index 00000000..c8a376c9
--- /dev/null
+++ b/biblio/35508532.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Genome and transcriptome mechanisms driving cephalopod evolution."]]
+[[!tag genome synteny]]
+
+Albertin CB, Medina-Ruiz S, Mitros T, Schmidbaur H, Sanchez G, Wang ZY, Grimwood J, Rosenthal JJC, Ragsdale CW, Simakov O, Rokhsar DS.
+
+Nat Commun. 2022 May 4;13(1):2427. doi:10.1038/s41467-022-29748-w
+
+Genome and transcriptome mechanisms driving cephalopod evolution.
+
+[[!pmid 35508532 desc="Most chromosomes of _Doryteuthis pealeii_ have a direct counterpart in _Euprymna scolopes_ and retained visible synteny with the scallop Mizuhopecten yessoensis_.  In both cases, the gene order in syntenic regions is considerably scrambled."]]
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index a073079e..2b5aa969 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -51,6 +51,9 @@ but not other fungi such as yeast, “genes are conserved within homologous
 chromosomes, but with randomized orders and orientations“ and call that
 phenomenon “mesosynteny”.
 
+Squid chromosomes still have synteny with scallop, but gene order is scrambled
+([[Albertin and coll., 2022|biblio/35508532]]).
+
 ### Ancestral karyotpyes
 
  - The ancestral mammalian genome has 30 chromosomes ([[Zhou and coll., 2021|biblio/33408411]]).

Now in PubMed.
diff --git a/biblio/10.1101_2020.12.23.423594.mdwn b/biblio/33752599.mdwn
similarity index 94%
rename from biblio/10.1101_2020.12.23.423594.mdwn
rename to biblio/33752599.mdwn
index 77093509..88029aa7 100644
--- a/biblio/10.1101_2020.12.23.423594.mdwn
+++ b/biblio/33752599.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="SLIDR and SLOPPR: Flexible identification of spliced leader trans-splicing and prediction of eukaryotic operons from RNA-Seq data"]]
-[[!tag Oikopleura bioRxiv]]
+[[!tag Oikopleura trans-splicing]]
 
 Marius Wenzel, Berndt Mueller, Jonathan Pettitt
 
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index f30ea46a..b64a39a4 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -319,7 +319,7 @@ Transcriptome
    The SL gene is found downstream of the 5S RNA gene, which is repeated multiple
    times in the genome.  The 3′ acceptor site has a strong UUU(C/U/A)AG consensus.
    Reported intercistronic regions are short: <30 nt ([[Ganot et al., 2004|biblio/15314184]])
-   or ~33 nt ([[Wenzel, Mueller and Pettitt, 2020|biblio/10.1101_2020.12.23.423594]]).
+   or ~33 nt ([[Wenzel, Mueller and Pettitt, 2020|biblio/33752599]]).
  - The splice leader found in the Norwegian strain by ([[Ganot et al., 2004|biblio/15314184]])
    was found indentical in a Japanese strain by ([[Wang and coll., 2015|biblio/26032664]]).
  - A study using CAGE found that 39% of annotated gene models are trans-spliced with the

Trans-splicing.
diff --git a/tags/trans-splicing.mdwn b/tags/trans-splicing.mdwn
index 0a750e29..5cfd6dad 100644
--- a/tags/trans-splicing.mdwn
+++ b/tags/trans-splicing.mdwn
@@ -5,10 +5,14 @@ to be possible in COS cells and HeLa cell extracts by [[Bruzik and Maniatis, 199
 
 Trans-splicing was discovered in tunicates by [[Vandenberghe, Meedel and Hastings, 2001|biblio/11159910]].
 
-The splice leader is 16-nt in C. intestinalis ([[Satou et al, 2006|biblio/16822859]]) and 40-nt in O. dioica ([[Ganot et al., 2004|biblio/15314184]]).
-
 A splice leader was found in the endosymbiotic amoeba _Paulinella
 chromatophora_ by [[Nowack and coll, 2016|biblio/27791007]], and characterised
 by [[Matsuo and coll., 2018|biblio/30024971]].
 
+The splice leader is 16-nt in C. intestinalis ([[Satou et al,
+2006|biblio/16822859]]) and 40-nt in O. dioica ([[Ganot et al.,
+2004|biblio/15314184]]).  The trans-splicing acceptor consensus site in _O.
+dioica_ is `TTT(C/T/A)AGA`, which is the same as the cis-splicing acceptor
+with an extra `A` at the end.
+
 [[!inline pages="tagged(trans-splicing)" actions="no" limit=0]]

Polyadenylation signal.
diff --git a/biblio/15314184.mdwn b/biblio/15314184.mdwn
index cb28db59..8785436b 100644
--- a/biblio/15314184.mdwn
+++ b/biblio/15314184.mdwn
@@ -7,4 +7,4 @@ Mol Cell Biol. 2004 Sep;24(17):7795-805. doi:10.1128/MCB.24.17.7795-7805.2004
 
 Spliced-Leader RNA trans Splicing in a Chordate, Oikopleura dioica, with a Compact Genome.
 
-[[!pmid 15314184 desc="5′ splice leader (SL) found in 90/158 ESTs containing a start codon.  The SL RNA is found downstream of the 5S RNA in at least 40 occurences, and aproximately 2/3 of all the 5S rRNA genes.  Its sequence is ACTCATCCCATTTTTGAGTCCGATTTCGATTGTCTAACAG. O. doica is the first chordate where gene operons have been described.  Intercistronic regions are very short (<30 nt).  “In comparing 52 distinct trans-splice acceptor sites to 605 cis-splice acceptor sites, the same consensus sequence, TTT(C/T/A)AG, was observed at both intron and intercistronic region 3′ ends. A notable difference from cis splicing was that most exons trans spliced to the leader (133 of 145) started with an adenosine, whereas the start of cis-spliced exons did not show any nucleotide preference”"]]
+[[!pmid 15314184 desc="5′ splice leader (SL) found in 90/158 ESTs containing a start codon.  The SL RNA is found downstream of the 5S RNA in at least 40 occurences, and aproximately 2/3 of all the 5S rRNA genes.  Its sequence is `ACTCATCCCATTTTTGAGTCCGATTTCGATTGTCTAACAG`. O. doica is the first chordate where gene operons have been described.  Intercistronic regions are very short (<30 nt).  “In comparing 52 distinct trans-splice acceptor sites to 605 cis-splice acceptor sites, the same consensus sequence, `TTT(C/T/A)AG`, was observed at both intron and intercistronic region 3′ ends. A notable difference from cis splicing was that most exons trans spliced to the leader (133 of 145) started with an adenosine, whereas the start of cis-spliced exons did not show any nucleotide preference.”  In the cycD operon, only the last gene (cycD) has a `AAUAAA` polyadenylation signal."]]

Trans-splicing consensus site.
diff --git a/biblio/15314184.mdwn b/biblio/15314184.mdwn
index 7d63dcd1..cb28db59 100644
--- a/biblio/15314184.mdwn
+++ b/biblio/15314184.mdwn
@@ -7,4 +7,4 @@ Mol Cell Biol. 2004 Sep;24(17):7795-805. doi:10.1128/MCB.24.17.7795-7805.2004
 
 Spliced-Leader RNA trans Splicing in a Chordate, Oikopleura dioica, with a Compact Genome.
 
-[[!pmid 15314184 desc="5′ splice leader (SL) found in 90/158 ESTs containing a start codon.  The SL RNA is found downstream of the 5S RNA in at least 40 occurences, and aproximately 2/3 of all the 5S rRNA genes.  Its sequence is ACTCATCCCATTTTTGAGTCCGATTTCGATTGTCTAACAG. O. doica is the first chordate where gene operons have been described.  Intercistronic regions are very short (<30 nt)."]]
+[[!pmid 15314184 desc="5′ splice leader (SL) found in 90/158 ESTs containing a start codon.  The SL RNA is found downstream of the 5S RNA in at least 40 occurences, and aproximately 2/3 of all the 5S rRNA genes.  Its sequence is ACTCATCCCATTTTTGAGTCCGATTTCGATTGTCTAACAG. O. doica is the first chordate where gene operons have been described.  Intercistronic regions are very short (<30 nt).  “In comparing 52 distinct trans-splice acceptor sites to 605 cis-splice acceptor sites, the same consensus sequence, TTT(C/T/A)AG, was observed at both intron and intercistronic region 3′ ends. A notable difference from cis splicing was that most exons trans spliced to the leader (133 of 145) started with an adenosine, whereas the start of cis-spliced exons did not show any nucleotide preference”"]]

Remove the 'operon' tag in favor of the 'trans-splicing' tag.
diff --git a/biblio/15314184.mdwn b/biblio/15314184.mdwn
index f03ae638..7d63dcd1 100644
--- a/biblio/15314184.mdwn
+++ b/biblio/15314184.mdwn
@@ -1,5 +1,5 @@
 [[!meta title="Spliced-Leader RNA trans Splicing in a Chordate, Oikopleura dioica, with a Compact Genome."]]
-[[!tag trans-splicing Oikopleura operon]]
+[[!tag trans-splicing Oikopleura]]
 
 Ganot P, Kallesøe T, Reinhardt R, Chourrout D, Thompson EM.
 
diff --git a/tags/operon.mdwn b/tags/operon.mdwn
deleted file mode 100644
index cbea2bd3..00000000
--- a/tags/operon.mdwn
+++ /dev/null
@@ -1,4 +0,0 @@
-[[!meta title="pages tagged operon"]]
-
-[[!inline pages="tagged(operon)" actions="no" archive="yes"
-feedshow=10]]

Café
diff --git a/biblio/15826240.mdwn b/biblio/15826240.mdwn
new file mode 100644
index 00000000..79730ecb
--- /dev/null
+++ b/biblio/15826240.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="The caspase family in urochordates: distinct evolutionary fates in ascidians and larvaceans."]]
+[[!tag Oikopleura]]
+
+Weill M, Philips A, Chourrout D, Fort P.
+
+Biol Cell. 2005 Nov;97(11):857-66. doi:10.1042/BC20050018
+
+The caspase family in urochordates: distinct evolutionary fates in ascidians and larvaceans.
+
+[[!pmid 15826240 desc="_O. dioica_ has three caspases, all related to the CSP3/7 family."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 4d10951f..f30ea46a 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -294,6 +294,7 @@ Genes and pathways
    [[Ferrández-Roldán and coll., 2021|biblio/34789899]]).
  - None of the genes encoding Bcl-2 proteins or their BH3-only ligands could be found
    in _O. dioica_ [[Suraweera and coll., 2022|biblio/35409052]].
+ - Three caspases related to the CSP3/7 family were found by [[Weil and coll, 2005|biblio/15826240]].
 
 Epigenome
 ---------
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn
index 2b6a156f..a073079e 100644
--- a/tags/synteny.mdwn
+++ b/tags/synteny.mdwn
@@ -31,6 +31,9 @@ of 90 rearrangements per MY (_mel_ / _simulans_) and 226–354 per MY (_sim_ / _
 In insects, the Osiris gene family shows conservation of synteny over ~400
 million years ([[Sah and coll., 2012|biblio/22384409]]).
 
+Butterfly chromosome still have synteny with Muller elements ([[Ranz and coll,
+2022|biblio/35042416]]).
+
 The indian munjac has only 3 chromosomes, which are the result of fusions in
 the past ~5 My.  The chinese munjak has undergone much less fusions.  In most
 cases, long-range chromosome structure (Hi-C) is not conserved between theses

alamaison
diff --git a/biblio/35422045.mdwn b/biblio/35422045.mdwn
new file mode 100644
index 00000000..20bd0f45
--- /dev/null
+++ b/biblio/35422045.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Chromosome evolution and the genetic basis of agronomically important traits in greater yam."]]
+[[!tag chromosome repeat centromere]]
+
+Bredeson JV, Lyons JB, Oniyinde IO, Okereke NR, Kolade O, Nnabue I, Nwadili CO, Hřibová E, Parker M, Nwogha J, Shu S, Carlson J, Kariba R, Muthemba S, Knop K, Barton GJ, Sherwood AV, Lopez-Montes A, Asiedu R, Jamnadass R, Muchugi A, Goodstein D, Egesi CN, Featherston J, Asfaw A, Simpson GG, Doležel J, Hendre PS, Van Deynze A, Kumar PL, Obidiegwu JE, Bhattacharjee R, Rokhsar DS.
+
+Nat Commun. 2022 Apr 14;13(1):2001. doi:10.1038/s41467-022-29114-w
+
+Chromosome evolution and the genetic basis of agronomically important traits in greater yam.
+
+[[!pmid 35422045 desc="Very broad peri-centromeric regions containg mostly repeats and confining the genes in the subtelomeric regions."]]

alamaison
diff --git a/tags/centromere.mdwn b/tags/centromere.mdwn
index b1444e75..d5500840 100644
--- a/tags/centromere.mdwn
+++ b/tags/centromere.mdwn
@@ -8,6 +8,8 @@ _Work in progress_
    centromeres ([[Melters and coll., 2013|biblio/23363705]]).
  - In the three-spine stickleback, the centromere sequence of chrX differs from
    the one of chrY ([[Peichel and coll., 2020|biblio/32684159]]).
+ - The pericentromeric regions of _Dioscorea alata_ can comprise most of the
+   chromosome length [[Bredeson and coll., 2022|biblio/35422045]].
 
 ## Visualisation
 

apoptosis
diff --git a/biblio/35409052.mdwn b/biblio/35409052.mdwn
new file mode 100644
index 00000000..f9e738ab
--- /dev/null
+++ b/biblio/35409052.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Metazoans and Intrinsic Apoptosis: An Evolutionary Analysis of the Bcl-2 Family."]]
+[[!tag Oikopleura]]
+
+Suraweera CD, Banjara S, Hinds MG, Kvansakul M.
+
+Int J Mol Sci. 2022 Mar 28;23(7):3691. doi:10.3390/ijms23073691
+
+Metazoans and Intrinsic Apoptosis: An Evolutionary Analysis of the Bcl-2 Family.
+
+[[!pmid 35409052 desc="_Oikopleura dioica_ has lost all the Bcl-2 genes as well as their BH3-only ligands."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 268eb633..4d10951f 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -292,6 +292,8 @@ Genes and pathways
    [[Kienle, Kloepper and Fasshauer, 2016|biblio/27756227]]).
  - _Mesp_, _Ets1/2b_, _Gata4/5/6_, _Mek1/2_,  _Hand-r_ and _Tbx1/10_ (heart development,
    [[Ferrández-Roldán and coll., 2021|biblio/34789899]]).
+ - None of the genes encoding Bcl-2 proteins or their BH3-only ligands could be found
+   in _O. dioica_ [[Suraweera and coll., 2022|biblio/35409052]].
 
 Epigenome
 ---------

Corrections
diff --git a/tags/LAST.mdwn b/tags/LAST.mdwn
index 8157f372..8a7d8a81 100644
--- a/tags/LAST.mdwn
+++ b/tags/LAST.mdwn
@@ -5,7 +5,7 @@ _bibliography in progress..._
  - Whole-genome alignments with reversed sequences as negative controls showed
    that e-value filtering is not enough to remove spurious alignments of tandem
    repeat which therefore need to be masked ([[Frith MC, Hamada M and Horton P.,
-   2011|bilbio/20144198]]).
+   2011|biblio/20144198]]).
 
  - `lastdb` can use various seeding schemes to build its index.  [[Frith and
    Noé (2014)|biblio/24493737]] discuss some of them.  The `RY` seeds are made
@@ -33,7 +33,7 @@ _bibliography in progress..._
    of expansion of tandem repeats, after alignment with `last-split`.
 
  - LAST can align DNA sequences to protein databases using a 64 x 21 substitution
-   matrix [[Yao and Frith, 2020|biblio/10.1101_2021.01.25.428050]].
+   matrix [[Yao and Frith, 2020|biblio/10.1007_978-3-030-74432-8_11]].
 
  - JRA (Joint Read Alignment) uses LAST [[Shrestha and coll., 2018|biblio/29182778]].
 

Café
diff --git a/biblio/20144198.mdwn b/biblio/20144198.mdwn
new file mode 100644
index 00000000..30d63bb9
--- /dev/null
+++ b/biblio/20144198.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Parameters for accurate genome alignment."]]
+[[!tag LAST genome alignment]]
+
+Frith MC, Hamada M, Horton P.
+
+BMC Bioinformatics. 2010 Feb 9;11:80. doi: 10.1186/1471-2105-11-80
+
+Parameters for accurate genome alignment.
+
+[[!pmid 20144198 desc="Aligned genomes after reversing (not reverse-complementing) them as a negative controls.  In these comparisons, all alignments are spurious.  A large number of spurious alignments were found, and this could be reduced by masking tandem repeats.  Spuriously alignments in tandem repeats get abnormally high scores. “Bad” scoring matrices tend to extend alignments with spurious low-quality arms.  The X-drop parameter prevents the aligner from extending alignments too far, but high X-drop values can cause small alignments to be discarded by some software because the score becomes negative."]]
diff --git a/tags/LAST.mdwn b/tags/LAST.mdwn
index f8ec88ea..8157f372 100644
--- a/tags/LAST.mdwn
+++ b/tags/LAST.mdwn
@@ -2,6 +2,11 @@
 
 _bibliography in progress..._
 
+ - Whole-genome alignments with reversed sequences as negative controls showed
+   that e-value filtering is not enough to remove spurious alignments of tandem
+   repeat which therefore need to be masked ([[Frith MC, Hamada M and Horton P.,
+   2011|bilbio/20144198]]).
+
  - `lastdb` can use various seeding schemes to build its index.  [[Frith and
    Noé (2014)|biblio/24493737]] discuss some of them.  The `RY` seeds are made
    of non-overlapping words using the two-letter alphabet `R` = `A|G`, `Y` =

creating tag page tags/damage
diff --git a/tags/damage.mdwn b/tags/damage.mdwn
new file mode 100644
index 00000000..e81411aa
--- /dev/null
+++ b/tags/damage.mdwn
@@ -0,0 +1,4 @@
+[[!meta title="pages tagged damage"]]
+
+[[!inline pages="tagged(damage)" actions="no" archive="yes"
+feedshow=10]]

Café
diff --git a/biblio/26052046.mdwn b/biblio/26052046.mdwn
new file mode 100644
index 00000000..cc175e38
--- /dev/null
+++ b/biblio/26052046.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Activity-Induced DNA Breaks Govern the Expression of Neuronal Early-Response Genes."]]
+[[!tag neuron damage expression]]
+
+Cell. 2015 Jun 18;161(7):1592-605. doi:10.1016/j.cell.2015.05.032
+
+Madabhushi R, Gao F, Pfenning AR, Pan L, Yamakawa S, Seo J, Rueda R, Phan TX, Yamakawa H, Pao PC, Stott RT, Gjoneska E, Nott A, Cho S, Kellis M, Tsai LH.
+
+Activity-Induced DNA Breaks Govern the Expression of Neuronal Early-Response Genes. 
+
+[[!pmid 26052046 desc="Double-strand breaks (DSBs) caused by the topoisomerase inhibitor etoposide induces early-response genes in neurons.  The radiomimetic drugs neocarzinostatin and bleomycin, and the PARP inhibitor Olaparib did cause induction.  Inhibition of DSB signalling with the ATM (ataxia telangiectasia mutated) inhibitor KU55933 did not suppress the induction.  Knockdown of topoisomerase IIβ suppressed the induction.  CRISPR-Cas9 DNA cleavage micmicked and rescued the induction.  Topoisomerase IIβ and the breaks are enriched near CTCF binding sites.  Tyrosyl DNA phosphodiesterase 2 (TDP2) is also enriched at the promoter of immediate early genes."]]

Black sea
diff --git a/biblio/10.1017_S0025315405011410.mdwn b/biblio/10.1017_S0025315405011410.mdwn
new file mode 100644
index 00000000..78fcf8a9
--- /dev/null
+++ b/biblio/10.1017_S0025315405011410.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Changes in appendicularian Oikopleura dioica abundance caused by invasion of alien ctenophores in the Black Sea"]]
+[[!tag Oikopleura]]
+
+Shiganova, T. (2005).
+
+Journal of the Marine Biological Association of the United Kingdom, 85(3), 477-494. doi:10.1017/S0025315405011410
+
+Changes in appendicularian Oikopleura dioica abundance caused by invasion of alien ctenophores in the Black Sea.
+
+[[!doi 10.1017/S0025315405011410 desc="Comparison of _O. dioica_ populations before and after invasion of the ctenophores _Mnemiopsis leidyi_ and _Beroe ovata_.  In 1957, _O. dioica_ peaked in May in the Western Black sea.  In 1979 in peaked from June to November near Sevastopol.  In 1969 there was one peak in May–June and one in August.  In 1991–6, abundance of _O. dioica_ was strongly reduced while _M. leidyi_ was proliferating.  In 1999 and following years, after _B. ovata_ invastion, _M leidyi_ populations were strongly reduced and _O. dioica_ abundance returned to high levels."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 1e8bc757..268eb633 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -587,6 +587,10 @@ Ecology
    whether the viruses are digested.
  - Houses and fecal pellets of _Oikopleura_ species are consumed by eel larvae
    ([[Mochioka and Iwamizu, 1996|biblio/10.1007_BF00353257]]).
+ - In the Black Sea, invasion of _O. dioica's predator_ _Mnemiopsis leidyi_ (a
+   ctenophore) decimated its population, which was restored to higher levels by the
+   subsequent invasion of the predator's predator _Beroe ovata_. [[Shiganova,
+   2005|biblio/10.1017_S0025315405011410]].
 
 ### Distribution in and near Japan
 
@@ -670,7 +674,8 @@ Ecology
    ([[Berry and coll., 2019|biblio/30735490]])
  - TARA Oceans ([[Vorobev and coll., 2020|biblio/32205368]]),
    [[Delmont and coll., biblio/10.1101_2020.10.15.341214v2]].
- - In the southern Black sea in 2006–2007 ([[Üstün, Bat and Besiktepe, 2016|biblio/PG_0485]]).
+ - In the southern Black sea in 2006–2007 ([[Üstün, Bat and Besiktepe, 2016|biblio/PG_0485]])
+   and in the northern Black sea ([[Shiganova 2005|biblio/10.1017_S0025315405011410]].
 
 ### In the past:
 

Café
diff --git a/biblio/18339653.mdwn b/biblio/18339653.mdwn
new file mode 100644
index 00000000..ca534d93
--- /dev/null
+++ b/biblio/18339653.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Altered miRNA repertoire in the simplified chordate, Oikopleura dioica."]]
+[[!tag Oikopleura miRNA]]
+
+Altered miRNA repertoire in the simplified chordate, _Oikopleura dioica_.
+
+Mol Biol Evol. 2008 Jun;25(6):1067-80. doi:10.1093/molbev/msn060
+
+Fu X, Adamski M, Thompson EM.
+
+[[!pmid desc="miRNA array spotted on N+ membranes.  Confirms the existence of Drosha, DGCR8, Dicer, and 3 AGO proteins. “Five compact clusters containing 15 miRNAs were identified, and the distance between adjacent members was systematically less than 100 bp.” 36% of the miRNAs were long of 22 nucleotides.  “many O. dioica miRNAs were found to be located in the antisense orientation of a protein-coding gene, often opposite the sense strand of an intron.”  “let-7a [...] was not detected during embryogenesis but was observed in the postmetamorphic oikoplastic epithelium.”"]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index a76d2bf7..1e8bc757 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -253,6 +253,8 @@ Genes and pathways
    were found; they might have been created by retrotransposition
    ([[Martí-Solans and coll., 2021|biblio/34179025]]).
  - _Nk4_, _Hand1/2_ and _FoxF_ (heart development, [[Ferrández-Roldán and coll., 2021|biblio/34789899]]).
+ - _O. dioica_ has the miRNA machinery and some miRNAs such as _let-7a_ were detected.  36 % of
+   the miRNAs had a length of 22 nt in [[Fu, Adamski and Thompson, 2008|biblio/18339653]].
 
 ### Lost
 

Café
diff --git a/biblio/31311886.mdwn b/biblio/31311886.mdwn
new file mode 100644
index 00000000..16fd4fef
--- /dev/null
+++ b/biblio/31311886.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Causes and Effects of Loss of Classical Nonhomologous End Joining Pathway in Parasitic Eukaryotes."]]
+[[!tag review repair Oikopleura]]
+
+Nenarokova A, Záhonová K, Krasilnikova M, Gahura O, McCulloch R, Zíková A, Yurchenko V, Lukeš J.
+
+mBio. 2019 Jul 16;10(4):e01541-19. doi:10.1128/mBio.01541-19
+
+Causes and Effects of Loss of Classical Nonhomologous End Joining Pathway in Parasitic Eukaryotes.
+
+[[!pmid 31311886 desc="Reviews possible advantages of losing the C-NHEJ pathway, such as reduction of transposon movement, reduction of genome size and change of genome structure, and insertion of short new sequence in proteins.  Focus on parasites but some facts about Oikopleura are highlighted for comparison purposes."]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 3ef6ee5b..a76d2bf7 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -270,6 +270,8 @@ Genes and pathways
    conserved from yeast to mammals) is undetectable ([[Denoeud et al., 2010|biblio/21097902]]).
    An alternative or microhomology (MH)-driven end joining pathway is active
    and triggers microdeletions at the joining site ([[Deng, Henriet and Chourrout, 2018|biblio/30293719]]).
+   Loss of C-NHEJ is often associated with parasitism, which is not the case in
+   _Oikopleura_ (review in [[Nenarokova and coll., 2019|biblio/31311886]]).
  - In line with the above, “There is no H2AX homolog in O. dioica.” (H2AX is
    implicated in DNA repair).  [[Moosmann and coll., 2011|biblio/21756361]]
  - The minor spliceosome could not be found in _Oikopleura_'s genome ([[Marz

updated PO files
diff --git a/Joules.en.po b/Joules.en.po
index b75dae18..bc02163d 100644
--- a/Joules.en.po
+++ b/Joules.en.po
@@ -7,7 +7,7 @@
 msgid ""
 msgstr ""
 "Project-Id-Version: PACKAGE VERSION\n"
-"POT-Creation-Date: 2022-03-03 12:24+0000\n"
+"POT-Creation-Date: 2022-03-10 11:47+0000\n"
 "PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
 "Last-Translator: FULL NAME <EMAIL@ADDRESS>\n"
 "Language-Team: LANGUAGE <LL@li.org>\n"
@@ -37,7 +37,7 @@ msgstr ""
 
 #. type: Plain text
 msgid ""
-"Ici je vais tout convertir en [Joules](https://fr.wikipedia.org/wiki/Joule), "
+"Ici je vais tout convertir en [joules](https://fr.wikipedia.org/wiki/Joule), "
 "l'unité du Système International, pour mieux comparer.  Je vais poster "
 "chacun de mes calculs avec le tag [#Joules](https://framapiaf.org/tags/"
 "Joules) sur Framapiaf."
@@ -109,3 +109,27 @@ msgid ""
 "intercontinental (20 000 km) et quatre voyages domestiques entre Okinawa et "
 "Tôkyô (4 × 2000 km).  Donc environ 840 litres par an, donc 2 400 MJ."
 msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"Ma part dans la facture télécoms familiale, internet plus téléphonie mobile, "
+"est d'environ 5000 yens.  Je n'ai aucune idée précise de la quantité "
+"d'énergie utilisée.  Mais on peut estimer une limite supérieure: si cet "
+"argent était entièrement dépensé en électricité par les opérateurs, et "
+"qu'ils la payaient au même prix que nous cela ferait environ 160 kWh, ou "
+"environ 600 MJ.  Dans la pratique, ils ont d'autre coûts, et on se situe "
+"probablement à un dixième ou moins du maximum.  Bien entendu, ces chiffres "
+"ne tiennent pas compte du fait que côté centres de données qui nous "
+"fournissent le « contenu », la dépense énergétique est énorme."
+msgstr ""
+
+#. type: Bullet: ' - '
+msgid ""
+"Je consomme entre 6 et 7 mètres cubes d'eau par mois pour un prix d'environ "
+"1000 yens, qui include la production et le retraitement.  Un rapport de "
+"l'observatoire de l'eau de la Seine-et-Marne, de 2016, estime entre 1.6 et "
+"16 % la part énergétique de la facture d'eau.  En extrapolant avec ma "
+"facture d'électricité, 100 yens font environ 11 MJ.  L'eau est précieuse et "
+"les effets de son gaspillage sont différents de ceux du gaspillage de "
+"l'énergie."
+msgstr ""

Télécoms et eau.
diff --git a/Joules.md b/Joules.md
index 6f771d73..641b8e72 100644
--- a/Joules.md
+++ b/Joules.md
@@ -8,7 +8,7 @@ contexte: calories pour la nourriture ou kilowatt-heures pour l'électricité, e
 on n'a pas l'habitude d'estimer quelle quantité d'énergie on a retiré d'un
 litre d'essence ou d'un mètre cube de gaz…
 
-Ici je vais tout convertir en [Joules](https://fr.wikipedia.org/wiki/Joule),
+Ici je vais tout convertir en [joules](https://fr.wikipedia.org/wiki/Joule),
 l'unité du Système International, pour mieux comparer.  Je vais poster chacun
 de mes calculs avec le tag [#Joules](https://framapiaf.org/tags/Joules) sur
 Framapiaf.
@@ -61,3 +61,19 @@ Framapiaf.
    intercontinental (20 000 km) et quatre voyages domestiques entre Okinawa et
    Tôkyô (4 × 2000 km).  Donc environ 840 litres par an, donc 2 400 MJ.
 
+ - Ma part dans la facture télécoms familiale, internet plus téléphonie
+   mobile, est d'environ 5000 yens.  Je n'ai aucune idée précise de la quantité
+   d'énergie utilisée.  Mais on peut estimer une limite supérieure: si cet
+   argent était entièrement dépensé en électricité par les opérateurs, et qu'ils
+   la payaient au même prix que nous cela ferait environ
+   160 kWh, ou environ 600 MJ.  Dans la pratique, ils ont d'autre coûts, et on
+   se situe probablement à un dixième ou moins du maximum.  Bien
+   entendu, ces chiffres ne tiennent pas compte du fait que côté centres de
+   données qui nous fournissent le « contenu », la dépense énergétique est énorme.
+
+ - Je consomme entre 6 et 7 mètres cubes d'eau par mois pour un prix d'environ
+   1000 yens, qui include la production et le retraitement.  Un rapport de
+   l'observatoire de l'eau de la Seine-et-Marne, de 2016, estime entre 1.6 et 16 %
+   la part énergétique de la facture d'eau.  En extrapolant avec ma facture
+   d'électricité, 100 yens font environ 11 MJ.  L'eau est précieuse et les effets
+   de son gaspillage sont différents de ceux du gaspillage de l'énergie.