Dernières modifications :
radio taiso
diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn index 12f886c3..f1b16968 100644 --- a/tags/synteny.mdwn +++ b/tags/synteny.mdwn @@ -55,7 +55,10 @@ chromosomes, but with randomized orders and orientations“ and call that phenomenon “mesosynteny”. Squid chromosomes still have synteny with scallop, but gene order is scrambled -([[Albertin and coll., 2022|biblio/35508532]]). +([[Albertin and coll., 2022|biblio/35508532]]). Sets of syntenic orthologues +present in separate chromosomes in some clades but irreversibly mixed in others +allowed [[Schultz and coll. (2023)|biblio/37198475]] to predict that cnidarians +branched at the base of the animal tree. At equal evolutionary distance, yeast microsynteny is lower than in animals, but higher than in plants ([[Li and coll., 2022|biblio/36334587]]).
Dans le train.
diff --git a/biblio/11380986.mdwn b/biblio/11380986.mdwn new file mode 100644 index 00000000..50d61b35 --- /dev/null +++ b/biblio/11380986.mdwn @@ -0,0 +1,10 @@ +[[!meta title="Evaluating genome dynamics: the constraints on rearrangements within bacterial genomes."]] +[[!tag bacteria variants review]] + +Hughes D. + +Genome Biol. 2000;1(6):REVIEWS0006. doi: 10.1186/gb-2000-1-6-reviews0006. + +Evaluating genome dynamics: the constraints on rearrangements within bacterial genomes. + +[[!pmid 11380986 desc="Review reporting that “almost all rearrangements conserve the axis of chromosome replication”."]] diff --git a/tags/variants.mdwn b/tags/variants.mdwn index 9826c13b..4cd0a25e 100644 --- a/tags/variants.mdwn +++ b/tags/variants.mdwn @@ -62,6 +62,8 @@ in dot-plots by [[Eisen and coll (2000)|biblio/11178265]] and [[Tillier and Collins (2000)|biblio/11017076]]. Both reports suggest that the patterns are generated by inversions centered on origins and termini. The prevalence of this phenomenon was confirmed by [[D'Iorio and Dewar, 2022|biblio/36261227]]. +The state of the art in bacterial genomics in 2000 was reviewed by +[[Hughes|biblio/11380986]]. ### Mechanism
Assis dans un parc
diff --git a/biblio/11017076.mdwn b/biblio/11017076.mdwn new file mode 100644 index 00000000..a0bc955f --- /dev/null +++ b/biblio/11017076.mdwn @@ -0,0 +1,15 @@ +[[!meta title="Genome rearrangement by replication-directed translocation."]] +[[!tag bacteria variants]] + +Tillier ER, Collins RA + +Nat Genet. 2000 Oct;26(2):195-7. doi:10.1038/79918 + +Genome rearrangement by replication-directed translocation. + +[[!pmid 11017076 desc="X-shaped patterns in whole-genome comparisons dot plots. +“Single-gene inversions occurred at 12 of 44 boundaries [of repositioned blocks +of genes] identified in _Chlamydia_, compared with only 13 local inversions +adjacent to any of the 643 genes not at a boundary” Proposes that +origin-centered inversions caused by replication forks can generate the +patterns."]] diff --git a/tags/variants.mdwn b/tags/variants.mdwn index 285f087a..9826c13b 100644 --- a/tags/variants.mdwn +++ b/tags/variants.mdwn @@ -58,10 +58,10 @@ inversion in _D. buzzati_ ([[Delprat and coll, 2009|biblio/19936241]]). human/mouse comparisons, median length 814. In bacteria, rearrangements have been reported to generate a X-shaped pattern -in dot-plots by [[Eisen and coll (2000)|biblio/11178265]]. The authors suggest -that the patterns are generated by inversions centered on origins and termini. -The prevalence of this phenomenon was confirmed by [[D'Iorio and Dewar, -2022|biblio/36261227]]. +in dot-plots by [[Eisen and coll (2000)|biblio/11178265]] and [[Tillier and +Collins (2000)|biblio/11017076]]. Both reports suggest that the patterns are +generated by inversions centered on origins and termini. The prevalence of +this phenomenon was confirmed by [[D'Iorio and Dewar, 2022|biblio/36261227]]. ### Mechanism
Dans le train
diff --git a/biblio/36261227.mdwn b/biblio/36261227.mdwn new file mode 100644 index 00000000..65f63bcb --- /dev/null +++ b/biblio/36261227.mdwn @@ -0,0 +1,18 @@ +[[!meta title="Replication-associated inversions are the dominant form of bacterial chromosome structural variation."]] +[[!tag bacteria variants]] + +D'Iorio M, Dewar K. + +Life Sci Alliance. 2022 Oct 19;6(1):e202201434. doi:10.26508/lsa.202201434 + +Replication-associated inversions are the dominant form of bacterial chromosome structural variation. + +[[!pmid 36261227 desc="“We assessed a total of 313 species that were +represented by 10 or more complete genome sequences” “A genoform in this work +refers to a group of collinear chromosomal sequences within a species with at +least 80% sequence similarity and without an inversion spanning more than 50 +Kb.” “In Gammaproteobacteria, the species Haemophilus influenzae, Haemophilus +parainfluenzae, and Mannheimia haemolytica all contained inversions that were +predominantly located away from the replication origin. We also observed +species that were consistently offset from symmetry in one direction such as in +B. pertussis”"]] diff --git a/tags/variants.mdwn b/tags/variants.mdwn index 015b7c21..285f087a 100644 --- a/tags/variants.mdwn +++ b/tags/variants.mdwn @@ -60,6 +60,8 @@ human/mouse comparisons, median length 814. In bacteria, rearrangements have been reported to generate a X-shaped pattern in dot-plots by [[Eisen and coll (2000)|biblio/11178265]]. The authors suggest that the patterns are generated by inversions centered on origins and termini. +The prevalence of this phenomenon was confirmed by [[D'Iorio and Dewar, +2022|biblio/36261227]]. ### Mechanism
Encore plus de café
diff --git a/biblio/11178265.mdwn b/biblio/11178265.mdwn index 17aec71b..848e9444 100644 --- a/biblio/11178265.mdwn +++ b/biblio/11178265.mdwn @@ -7,4 +7,4 @@ Genome Biol. 2000;1(6):RESEARCH0011. doi:10.1186/gb-2000-1-6-research0011 Evidence for symmetric chromosomal inversions around the replication origin in bacteria. -[[!pmid 11178265 desc="X-shaped pattern observed in line plots of pairwise comparisons between E. coli and V. cholerae, or Streptococcus or Mycobacterium species."]] +[[!pmid 11178265 desc="X-shaped pattern observed in line plots of pairwise comparisons between E. coli and V. cholerae, or Streptococcus or Mycobacterium species. The patterns might have been generated by inversions centered on origins and termini of replication."]] diff --git a/tags/variants.mdwn b/tags/variants.mdwn index a89e2583..015b7c21 100644 --- a/tags/variants.mdwn +++ b/tags/variants.mdwn @@ -58,7 +58,8 @@ inversion in _D. buzzati_ ([[Delprat and coll, 2009|biblio/19936241]]). human/mouse comparisons, median length 814. In bacteria, rearrangements have been reported to generate a X-shaped pattern -in dot-plots by [[Eisen and coll (2000)|biblio/11178265]]. +in dot-plots by [[Eisen and coll (2000)|biblio/11178265]]. The authors suggest +that the patterns are generated by inversions centered on origins and termini. ### Mechanism
Café
diff --git a/biblio/11178265.mdwn b/biblio/11178265.mdwn new file mode 100644 index 00000000..17aec71b --- /dev/null +++ b/biblio/11178265.mdwn @@ -0,0 +1,10 @@ +[[!meta title="Evidence for symmetric chromosomal inversions around the replication origin in bacteria."]] +[[!tag variants bacteria]] + +Eisen JA, Heidelberg JF, White O, Salzberg SL. + +Genome Biol. 2000;1(6):RESEARCH0011. doi:10.1186/gb-2000-1-6-research0011 + +Evidence for symmetric chromosomal inversions around the replication origin in bacteria. + +[[!pmid 11178265 desc="X-shaped pattern observed in line plots of pairwise comparisons between E. coli and V. cholerae, or Streptococcus or Mycobacterium species."]] diff --git a/tags/variants.mdwn b/tags/variants.mdwn index 222faccd..a89e2583 100644 --- a/tags/variants.mdwn +++ b/tags/variants.mdwn @@ -57,6 +57,9 @@ inversion in _D. buzzati_ ([[Delprat and coll, 2009|biblio/19936241]]). [[Kent and coll., 2003|biblio/14500911]] reported 2 inversions per Mbp in human/mouse comparisons, median length 814. +In bacteria, rearrangements have been reported to generate a X-shaped pattern +in dot-plots by [[Eisen and coll (2000)|biblio/11178265]]. + ### Mechanism _Staggered breaks_ ([[Ranz and coll., 2007|bilbio/17550304]]) caused
Café
diff --git a/biblio/37137302.mdwn b/biblio/37137302.mdwn new file mode 100644 index 00000000..5b0ccce0 --- /dev/null +++ b/biblio/37137302.mdwn @@ -0,0 +1,29 @@ +[[!meta title="Functional analysis of a random-sequence chromosome reveals a high level and the molecular nature of transcriptional noise in yeast cells"]] +[[!tag yeast synthetic]] + +Gvozdenov Z, Barcutean Z, Struhl K + +Mol Cell. 2023 Apr 24:S1097-2765(23)00254-X. 10.1016/j.molcel.2023.04.010 + +Functional analysis of a random-sequence chromosome reveals a high level and the molecular nature of transcriptional noise in yeast cells + +[[!pmid 37137302 desc="Circular chromosome of 27 kbp comprising 18 kbp of random +sequences. “the major class of nucleosomes average 147 bp (range 143–180), +i.e., the expected size” “nucleosome occupancy on [the artificial chromosome] +is 1.42-fold higher than on yeast genomic DNA” “when compared with yeast +genomic chromatin, [artificial] chro- matin is characterized by fewer +[nucleotide-depleted regions], fewer highly positioned nucleosomes, and little +nucleosome phasing, although nucleosome positioning is nonrandom.” +“Transcription from all regions of random-sequence DNA leads to similar RNA +levels that are roughly comparable to that of the majority of mRNA expressed +from yeast genomic DNA” “transcription from randomsequence DNA is more +variable than from genomic DNA” “decay rates of RNAs expressed from +randomsequence DNA are 3-fold faster” “RNAs expressed from [the artificial +chrmosome] are polyadenylated throughout the entire region of random-sequence +DNA” “the choice of poly(A) sites by the cleavage/polyadenylation machinery is +roughly similar for RNAs expressed from random-sequence and genomic DNAs.” “The +50 isoform pattern from random-sequence DNA resembles that observed from yeast +genomic regions not corresponding to 50 UTRs” “The level of newly synthesized +RNA from random-sequence DNA is in excellent accord with calculated estimates +that only 10%–20% of elongating RNA Pol II molecules generate mRNAs, such the +remaining 80%–90% represent transcriptional noise”"]] diff --git a/tags/synthetic.mdwn b/tags/synthetic.mdwn index 120fc94d..07a6d002 100644 --- a/tags/synthetic.mdwn +++ b/tags/synthetic.mdwn @@ -12,8 +12,12 @@ Example of neochromosome synthesis in yeast: [[Postma and coll., 2021|biblio/334 Artificial genome scrambling in yeast 2.0 with loxPsym sites: [[Brooks and coll, 2022|biblio/35239377]]. +Artificial 18 kbp random chromosome in yeast: [[Gvozdenov, Barcutean and Struhl, 2023|biblio/37137302]]. + ## Pathway -Increasing the copy number of the endogenous aldehyde dehydrogenase Hfd1 allowed [[Hu, Yu and Ye, 2022|biblio/35880393]] to obtain the best yield of conversion of retinol to retinoic acid.. +Increasing the copy number of the endogenous aldehyde dehydrogenase Hfd1 +allowed [[Hu, Yu and Ye, 2022|biblio/35880393]] to obtain the best yield of +conversion of retinol to retinoic acid. [[!inline pages="tagged(synthethic)" limit=0]]
Dans l'avion
diff --git a/biblio/36161960.mdwn b/biblio/36161960.mdwn new file mode 100644 index 00000000..38c577af --- /dev/null +++ b/biblio/36161960.mdwn @@ -0,0 +1,33 @@ +[[!meta title="Evolution of the ancestral mammalian karyotype and syntenic regions."]] +[[!tag synteny]] + +Damas J, Corbo M, Kim J, Turner-Maier J, Farré M, Larkin DM, Ryder OA, Steiner C, Houck ML, Hall S, Shiue L, Thomas S, Swale T, Daly M, Korlach J, Uliano-Silva M, Mazzoni CJ, Birren BW, Genereux DP, Johnson J, Lindblad-Toh K, Karlsson EK, Nweeia MT, Johnson RN; Zoonomia Consortium; Lewin HA. + +Proc Natl Acad Sci U S A. 2022 Oct 4;119(40):e2209139119. doi: 10.1073/pnas.2209139119 + +Evolution of the ancestral mammalian karyotype and syntenic regions. + +[[!pmid 36161960 desc="Analyses the number of breakpoints between nodes of the +phylogenetic tree, thanks to ancestral genome reconstruction. “2 extant +mammals (Dataset S1), representing all 19 eutherian, 3 marsupial, and the +monotreme orders, were used to reconstruct ancestral karyotypes at 16 nodes of +the mammalian phylogeny” “We used DESCHRAMBLER to generate reconstructed +ancestral chromosome fragments (RACFs) for each of 16 mammalian ancestors at +300-kbp syntenic fragment (SF) resolution” “The reconstructed mammalian +ancestor karyotype has 19 autosomes plus X, except for the cattle genome-based +reconstruction, which has two fewer chromosomes and the lowest total +reconstruction length” “The differences between the mammalian and therian (n = +17 + X) ancestors’ chromosomes resulted from 96 chromosomal rearrangements over +18 My.” “The eutherian ancestor (n = 19 + X) is the most recent common +ancestor of the three lineages represented by the reference genomes. Its +karyotype evolved from that of the therian ancestor as a result of 124 +chromosomal rearrangements over 53 My.” “We identified 323, 262, and 257 EBRs +that occurred along the lineage from the mammalian ancestor to the human, +sloth, and cattle genomes, respectively” “Inversions were most frequent, +accounting for 76 to 85% of all rearrangements identified for each lineage” +“The highest number of interchromosomal rearrangements (i.e., fissions and +fusions) was observed on the branch from the therian to the eutherian ancestor +(n = 30)” “We observed that 9 of 14 small MAMs have 1:1 orthology to chicken +chromosomes (GGA) and reconstructed chromosomes of the avian and amniote +ancestors” “EBRs were found to have a significantly higher density of +repeats”"]] diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn index d9fd0d0f..12f886c3 100644 --- a/tags/synteny.mdwn +++ b/tags/synteny.mdwn @@ -62,7 +62,9 @@ but higher than in plants ([[Li and coll., 2022|biblio/36334587]]). ### Ancestral karyotpyes - - The ancestral mammalian genome has 30 chromosomes ([[Zhou and coll., 2021|biblio/33408411]]). + - The ancestral mammalian genome has 30 chromosomes ([[Zhou and coll., + 2021|biblio/33408411]]), or 19 + X ([[Damas and coll., + 2022|biblio/36161960]]). - The ancestral chordate has 17 chromosomes according to amphioxus assemblies ([[Putnam and coll, 2008|biblio/18563158]], [[Simakov and coll., 2020|biblio/32313176]]).
Café
diff --git a/biblio/37198475.mdwn b/biblio/37198475.mdwn new file mode 100644 index 00000000..9be501f8 --- /dev/null +++ b/biblio/37198475.mdwn @@ -0,0 +1,10 @@ +[[!meta title="Ancient gene linkages support ctenophores as sister to other animals."]] +[[!tag synteny]] + +Schultz DT, Haddock SHD, Bredeson JV, Green RE, Simakov O, Rokhsar DS. + +Nature. 2023 May 17. doi:10.1038/s41586-023-05936-6 + +Ancient gene linkages support ctenophores as sister to other animals. + +[[!pmid 37198475 desc="Gene linkages found in all metazoans and single-celled outgroups are irreversibly merged (fusion followed by mixing) in Porifera, Cnidaria and Bilateria, supporting the idea that Ctenophora are sister to them."]]
CAGE
diff --git a/biblio/10.1101_2023.04.27.538568.mdwn b/biblio/10.1101_2023.04.27.538568.mdwn new file mode 100644 index 00000000..07acf6f9 --- /dev/null +++ b/biblio/10.1101_2023.04.27.538568.mdwn @@ -0,0 +1,10 @@ +[[!meta title="Abundant capped RNAs are derived from mRNA cleavage at 3’UTR G-Quadruplexes"]] +[[!tag CAGE 3′_UTR]] + +Nejc Haberman, Holly Digby, Rupert Faraway, Rebecca Cheung, Andrew M Jobbins, Callum Parr, Kayoko Yasuzawa, Takeya Kasukawa, Chi Wai Yip, Masaki Kato, Hazuki Takahashi, Piero Carninci, Santiago Vernia, Jernej Ule, Christopher R Sibley, Aida Martinez-Sanchez, Boris Lenhard + +bioRxiv 2023.04.27.538568; doi:10.1101/2023.04.27.538568 + +Abundant capped RNAs are derived from mRNA cleavage at 3’UTR G-Quadruplexes + +[[!doi 10.1101/2023.04.27.538568 desc="3′ peaks colocalising with a G-rich motif are now explained by AGO2-mediated cleavage of G-quadruplex regions and recapping. The 3′ fragments and the mRNA did not localise equally in the cell when imaged by in-situ hybridisation."]]
po
diff --git "a/Debian/debi\303\242neries/markdown2.en.po" "b/Debian/debi\303\242neries/markdown2.en.po" index 9773d7d7..da40e345 100644 --- "a/Debian/debi\303\242neries/markdown2.en.po" +++ "b/Debian/debi\303\242neries/markdown2.en.po" @@ -7,7 +7,7 @@ msgid "" msgstr "" "Project-Id-Version: \n" "POT-Creation-Date: 2023-05-11 00:02+0000\n" -"PO-Revision-Date: 2023-05-11 08:58+0900\n" +"PO-Revision-Date: 2023-05-11 09:03+0900\n" "Last-Translator: \n" "Language-Team: \n" "Language: en\n" @@ -32,8 +32,7 @@ msgid "[[!tag Debian]]\n" msgstr "[[!tag Debian]]\n" #. type: Plain text -#, fuzzy, no-wrap -#| msgid "[[!meta title=\"Plussez pour patcher Firefox pour afficher du Markdown ?\"]]\n" +#, no-wrap msgid "[[!meta title=\"Plussez pour patcher Firefox pour afficher du Markdown.\"]]\n" msgstr "[[!meta title=\"Upvote to patch Firefox to render Markdown\"]]\n"
updated PO files
diff --git "a/Debian/debi\303\242neries/markdown2.en.po" "b/Debian/debi\303\242neries/markdown2.en.po" index b85db619..9773d7d7 100644 --- "a/Debian/debi\303\242neries/markdown2.en.po" +++ "b/Debian/debi\303\242neries/markdown2.en.po" @@ -6,7 +6,7 @@ msgid "" msgstr "" "Project-Id-Version: \n" -"POT-Creation-Date: 2023-05-10 23:51+0000\n" +"POT-Creation-Date: 2023-05-11 00:02+0000\n" "PO-Revision-Date: 2023-05-11 08:58+0900\n" "Last-Translator: \n" "Language-Team: \n" @@ -32,24 +32,27 @@ msgid "[[!tag Debian]]\n" msgstr "[[!tag Debian]]\n" #. type: Plain text -#, no-wrap -msgid "[[!meta title=\"Plussez pour patcher Firefox pour afficher du Markdown ?\"]]\n" +#, fuzzy, no-wrap +#| msgid "[[!meta title=\"Plussez pour patcher Firefox pour afficher du Markdown ?\"]]\n" +msgid "[[!meta title=\"Plussez pour patcher Firefox pour afficher du Markdown.\"]]\n" msgstr "[[!meta title=\"Upvote to patch Firefox to render Markdown\"]]\n" #. type: Plain text msgid "" -"J'ai [[écrit auparavant|markdown]] que quand Firefox reçoit un fichier dont le type média est " -"_text/markdown_, il le propose au téléchargement, alors que les autres navigateurs l'affichent " -"comme un fichier texte." +"J'ai [[écrit auparavant|markdown]] que quand Firefox reçoit un fichier dont " +"le type média est _text/markdown_, il le propose au téléchargement, alors " +"que les autres navigateurs l'affichent comme un fichier texte." msgstr "" -"I [[previously wrote|markdown]] that when Firefox receives a file whose media type is _text/" -"markdown_, it prompts the user to download it, whereas other browsers display rendered results." +"I [[previously wrote|markdown]] that when Firefox receives a file whose " +"media type is _text/markdown_, it prompts the user to download it, whereas " +"other browsers display rendered results." #. type: Plain text msgid "" -"Il est maintenant possible de plusser sur [connect.mozilla.org](https://connect.mozilla.org/t5/" -"ideas/display-markdown-files/idi-p/6000) pour demander que Firefox formatte le _markdown_ par " -"défaut." +"Il est maintenant possible de plusser sur [connect.mozilla.org](https://" +"connect.mozilla.org/t5/ideas/display-markdown-files/idi-p/6000) pour " +"demander que Firefox formatte le _markdown_ par défaut." msgstr "" -"Now it is possible to upvote a proposal on [connect.mozilla.org](https://connect.mozilla.org/" -"t5/ideas/display-markdown-files/idi-p/6000) asking that Firefox renders Markdown by default." +"Now it is possible to upvote a proposal on [connect.mozilla.org](https://" +"connect.mozilla.org/t5/ideas/display-markdown-files/idi-p/6000) asking that " +"Firefox renders Markdown by default."
Correction du titre.
diff --git "a/Debian/debi\303\242neries/markdown2.mdwn" "b/Debian/debi\303\242neries/markdown2.mdwn" index 4191be52..cc9d9ceb 100644 --- "a/Debian/debi\303\242neries/markdown2.mdwn" +++ "b/Debian/debi\303\242neries/markdown2.mdwn" @@ -2,7 +2,7 @@ [[!meta updated="Thu, 11 May 2023 08:43:33 +0900"]] [[!tag Debian]] -[[!meta title="Plussez pour patcher Firefox pour afficher du Markdown ?"]] +[[!meta title="Plussez pour patcher Firefox pour afficher du Markdown."]] J'ai [[écrit auparavant|markdown]] que quand Firefox reçoit un fichier dont le type média est _text/markdown_, il le propose au téléchargement, alors que les
upvote !
diff --git "a/Debian/debi\303\242neries/markdown2.en.po" "b/Debian/debi\303\242neries/markdown2.en.po" index ad915ae4..b85db619 100644 --- "a/Debian/debi\303\242neries/markdown2.en.po" +++ "b/Debian/debi\303\242neries/markdown2.en.po" @@ -3,51 +3,53 @@ # This file is distributed under the same license as the PACKAGE package. # FIRST AUTHOR <EMAIL@ADDRESS>, YEAR. # -#, fuzzy msgid "" msgstr "" -"Project-Id-Version: PACKAGE VERSION\n" +"Project-Id-Version: \n" "POT-Creation-Date: 2023-05-10 23:51+0000\n" -"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n" -"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n" -"Language-Team: LANGUAGE <LL@li.org>\n" -"Language: \n" +"PO-Revision-Date: 2023-05-11 08:58+0900\n" +"Last-Translator: \n" +"Language-Team: \n" +"Language: en\n" "MIME-Version: 1.0\n" "Content-Type: text/plain; charset=UTF-8\n" "Content-Transfer-Encoding: 8bit\n" +"X-Generator: Poedit 3.2.2\n" #. type: Plain text #, no-wrap msgid "[[!meta date=\"Thu, 11 May 2023 08:43:33 +0900\"]]\n" -msgstr "" +msgstr "[[!meta date=\"Thu, 11 May 2023 08:43:33 +0900\"]]\n" #. type: Plain text #, no-wrap msgid "[[!meta updated=\"Thu, 11 May 2023 08:43:33 +0900\"]]\n" -msgstr "" +msgstr "[[!meta updated=\"Thu, 11 May 2023 08:43:33 +0900\"]]\n" #. type: Plain text #, no-wrap msgid "[[!tag Debian]]\n" -msgstr "" +msgstr "[[!tag Debian]]\n" #. type: Plain text #, no-wrap -msgid "" -"[[!meta title=\"Plussez pour patcher Firefox pour afficher du " -"Markdown ?\"]]\n" -msgstr "" +msgid "[[!meta title=\"Plussez pour patcher Firefox pour afficher du Markdown ?\"]]\n" +msgstr "[[!meta title=\"Upvote to patch Firefox to render Markdown\"]]\n" #. type: Plain text msgid "" -"J'ai [[écrit auparavant|markdown]] que quand Firefox reçoit un fichier dont " -"le type média est _text/markdown_, il le propose au téléchargement, alors " -"que les autres navigateurs l'affichent comme un fichier texte." +"J'ai [[écrit auparavant|markdown]] que quand Firefox reçoit un fichier dont le type média est " +"_text/markdown_, il le propose au téléchargement, alors que les autres navigateurs l'affichent " +"comme un fichier texte." msgstr "" +"I [[previously wrote|markdown]] that when Firefox receives a file whose media type is _text/" +"markdown_, it prompts the user to download it, whereas other browsers display rendered results." #. type: Plain text msgid "" -"Il est maintenant possible de plusser sur " -"[connect.mozilla.org](https://connect.mozilla.org/t5/ideas/display-markdown-files/idi-p/6000) " -"pour demander que Firefox formatte le _markdown_ par défaut." +"Il est maintenant possible de plusser sur [connect.mozilla.org](https://connect.mozilla.org/t5/" +"ideas/display-markdown-files/idi-p/6000) pour demander que Firefox formatte le _markdown_ par " +"défaut." msgstr "" +"Now it is possible to upvote a proposal on [connect.mozilla.org](https://connect.mozilla.org/" +"t5/ideas/display-markdown-files/idi-p/6000) asking that Firefox renders Markdown by default."
updated PO files
diff --git "a/Debian/debi\303\242neries/markdown2.en.po" "b/Debian/debi\303\242neries/markdown2.en.po" new file mode 100644 index 00000000..ad915ae4 --- /dev/null +++ "b/Debian/debi\303\242neries/markdown2.en.po" @@ -0,0 +1,53 @@ +# SOME DESCRIPTIVE TITLE +# Copyright (C) YEAR Free Software Foundation, Inc. +# This file is distributed under the same license as the PACKAGE package. +# FIRST AUTHOR <EMAIL@ADDRESS>, YEAR. +# +#, fuzzy +msgid "" +msgstr "" +"Project-Id-Version: PACKAGE VERSION\n" +"POT-Creation-Date: 2023-05-10 23:51+0000\n" +"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n" +"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n" +"Language-Team: LANGUAGE <LL@li.org>\n" +"Language: \n" +"MIME-Version: 1.0\n" +"Content-Type: text/plain; charset=UTF-8\n" +"Content-Transfer-Encoding: 8bit\n" + +#. type: Plain text +#, no-wrap +msgid "[[!meta date=\"Thu, 11 May 2023 08:43:33 +0900\"]]\n" +msgstr "" + +#. type: Plain text +#, no-wrap +msgid "[[!meta updated=\"Thu, 11 May 2023 08:43:33 +0900\"]]\n" +msgstr "" + +#. type: Plain text +#, no-wrap +msgid "[[!tag Debian]]\n" +msgstr "" + +#. type: Plain text +#, no-wrap +msgid "" +"[[!meta title=\"Plussez pour patcher Firefox pour afficher du " +"Markdown ?\"]]\n" +msgstr "" + +#. type: Plain text +msgid "" +"J'ai [[écrit auparavant|markdown]] que quand Firefox reçoit un fichier dont " +"le type média est _text/markdown_, il le propose au téléchargement, alors " +"que les autres navigateurs l'affichent comme un fichier texte." +msgstr "" + +#. type: Plain text +msgid "" +"Il est maintenant possible de plusser sur " +"[connect.mozilla.org](https://connect.mozilla.org/t5/ideas/display-markdown-files/idi-p/6000) " +"pour demander que Firefox formatte le _markdown_ par défaut." +msgstr "" diff --git a/Joules.en.po b/Joules.en.po index e0ffd0e2..51cf028b 100644 --- a/Joules.en.po +++ b/Joules.en.po @@ -7,7 +7,7 @@ msgid "" msgstr "" "Project-Id-Version: PACKAGE VERSION\n" -"POT-Creation-Date: 2023-05-09 13:37+0000\n" +"POT-Creation-Date: 2023-05-10 23:51+0000\n" "PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n" "Last-Translator: FULL NAME <EMAIL@ADDRESS>\n" "Language-Team: LANGUAGE <LL@li.org>\n" @@ -43,6 +43,39 @@ msgid "" "Joules) sur Framapiaf." msgstr "" +#. type: Title ## +#, no-wrap +msgid "En bref, par an:" +msgstr "" + +#. type: Bullet: ' - ' +msgid "Travail: 100 ~ 350 GJ." +msgstr "" + +#. type: Bullet: ' - ' +msgid "Avion: 20 ~ 40 GJ." +msgstr "" + +#. type: Bullet: ' - ' +msgid "Voiture: 10 ~ 15 GJ." +msgstr "" + +#. type: Bullet: ' - ' +msgid "Électricité: 5 GJ." +msgstr "" + +#. type: Bullet: ' - ' +msgid "Nourriture (métabolisme): 3 GJ." +msgstr "" + +#. type: Bullet: ' - ' +msgid "Gaz: 2 GJ." +msgstr "" + +#. type: Bullet: ' - ' +msgid "Télécoms: 1 ~ 5 GJ (arrondis à la louche)" +msgstr "" + #. type: Title ## #, no-wrap msgid "Les transports" @@ -62,7 +95,10 @@ msgid "" "Je roule en **voiture** 30 kilomètres par jour pour aller travailler, " "environ 20 jours par mois. Avec une voiture hybride parcourant 25 " "kilomètres par litre, ça fait 24 litres par mois, donc environ 800 MJ par " -"mois." +"mois ou environ 10 GJ par an. J'achète environ 50 litres d'essence par mois " +"et hormis mes trajets aller travailler, nous sommes souvents trois dans la " +"voiture. Donc aller au travail représente les trois quarts de ce que je " +"dépense en essence à titre individuel." msgstr "" #. type: Bullet: ' - ' @@ -89,7 +125,8 @@ msgid "" "litre (43 MJ/kg pour densité de 0.8). La différence avec la voiture, c'est " "qu'on fait beaucoup plus de kilomètres en avion. Je fais environ un voyage " "intercontinental (20 000 km) et quatre voyages domestiques entre Okinawa et " -"Tôkyô (4 × 2000 km). Donc environ 840 litres par an, donc 2 400 MJ." +"Tôkyô (4 × 3000 km). Donc environ 600 et 1200 litres par an, donc entre 20 " +"et 40 GJ par an." msgstr "" #. type: Bullet: ' - ' @@ -195,9 +232,9 @@ msgid "" "serait plus que la moyenne au Japon ou en Amérique, on voit que la " "consommation résidentielle reste négligeable dans l'équation. Entre 1000 et " "2000 personnes travaillent sur le campus. On peut donc dire que chacun " -"d'entre nous consomme de l'ordre de 360 GJ / an en moyenne, et que c'est " -"probablement un peu surestimé. En comparaison, je consomme 800 MJ * 12 ~= " -"10 GJ d'énergie en carburant pour aller travailler." +"d'entre nous consomme de l'ordre de 100 à 360 GJ / an en moyenne, et que " +"c'est probablement un peu surestimé. En comparaison, je consomme 800 MJ * " +"12 ~= 10 GJ d'énergie en carburant pour aller travailler." msgstr "" #. type: Title ## @@ -229,3 +266,35 @@ msgid "" "Le coût énergétique de la synthèse et manufacture du plastique est estimé à " "18 MJ / kg de plastique." msgstr "" + +#. type: Plain text +msgid "le vin" +msgstr "" + +#. type: Plain text +msgid "Aller au travail en vélo" +msgstr "" + +#. type: Plain text +msgid "une vie plus bourgeoise ? Une vie plus maigre ?" +msgstr "" + +#. type: Plain text +msgid "" +"Consommation annuelle de pétrole (4.2 10e20 J)/ Énergie envoyée par le " +"soleil: 6,2 × 1020 J \tl'énergie totale du Soleil qui atteint la Terre en " +"une heure. (https://fr.wikipedia.org/wiki/Ordres_de_grandeur_d" +"%27%C3%A9nergie)" +msgstr "" + +#. type: Plain text +msgid "" +"L'énergie cinétique d'un 1kg de matière à la vitesse de libération (7.9 km/" +"s) est d'un peu plus de 30 MJ. Il faut brûler un litre d'essence pour " +"dégager cette énergie. Malheureusement, comme on n'a pas encore inventé " +"mieux, il faut aussi transporter l'essence et le moteur, ce qui alourdit " +"considérablement l'ensemble, au point de doubler le poids et donc l'énergie " +"demandée, et donc le poids, et donc l'énergie demandée, etc. Note: la " +"différence d'énergie potentielle dans le champs de gravité terrestre est " +"largement inférieure à la quantité d'énergie cinétique nécessaire." +msgstr ""
Plussons!
diff --git "a/Debian/debi\303\242neries/markdown2.mdwn" "b/Debian/debi\303\242neries/markdown2.mdwn" new file mode 100644 index 00000000..4191be52 --- /dev/null +++ "b/Debian/debi\303\242neries/markdown2.mdwn" @@ -0,0 +1,13 @@ +[[!meta date="Thu, 11 May 2023 08:43:33 +0900"]] +[[!meta updated="Thu, 11 May 2023 08:43:33 +0900"]] +[[!tag Debian]] + +[[!meta title="Plussez pour patcher Firefox pour afficher du Markdown ?"]] + +J'ai [[écrit auparavant|markdown]] que quand Firefox reçoit un fichier dont le +type média est _text/markdown_, il le propose au téléchargement, alors que les +autres navigateurs l'affichent comme un fichier texte. + +Il est maintenant possible de plusser sur +[connect.mozilla.org](https://connect.mozilla.org/t5/ideas/display-markdown-files/idi-p/6000) +pour demander que Firefox formatte le _markdown_ par défaut.
En bref par an.
diff --git a/Joules.md b/Joules.md
index 9b55565f..4ff4901a 100644
--- a/Joules.md
+++ b/Joules.md
@@ -13,6 +13,16 @@ l'unité du Système International, pour mieux comparer. Je vais poster chacun
de mes calculs avec le tag [#Joules](https://framapiaf.org/tags/Joules) sur
Framapiaf.
+## En bref, par an:
+
+ - Travail: 100 ~ 350 GJ.
+ - Avion: 20 ~ 40 GJ.
+ - Voiture: 10 ~ 15 GJ.
+ - Électricité: 5 GJ.
+ - Nourriture (métabolisme): 3 GJ.
+ - Gaz: 2 GJ.
+ - Télécoms: 1 ~ 5 GJ (arrondis à la louche)
+
## Les transports
- « _L'énergie contenue dans l'essence est d'environ 33 600 000 joules par
@@ -22,7 +32,11 @@ Framapiaf.
- Je roule en **voiture** 30 kilomètres par jour pour aller travailler,
environ 20 jours par mois. Avec une voiture hybride parcourant 25
- kilomètres par litre, ça fait 24 litres par mois, donc environ 800 MJ par mois.
+ kilomètres par litre, ça fait 24 litres par mois, donc environ 800 MJ par
+ mois ou environ 10 GJ par an. J'achète environ 50 litres d'essence
+ par mois et hormis mes trajets aller travailler, nous sommes souvents
+ trois dans la voiture. Donc aller au travail représente les trois quarts
+ de ce que je dépense en essence à titre individuel.
- Pour parcourir un kilomètre en **train** je dois dépenser entre 10 et 20 yens.
Çela me côute environ autant en essence quand je pends la voiture, mais
@@ -40,7 +54,8 @@ Framapiaf.
litre (43 MJ/kg pour densité de 0.8). La différence avec la voiture, c'est
qu'on fait beaucoup plus de kilomètres en avion. Je fais environ un voyage
intercontinental (20 000 km) et quatre voyages domestiques entre Okinawa et
- Tôkyô (4 × 2000 km). Donc environ 840 litres par an, donc 2 400 MJ.
+ Tôkyô (4 × 3000 km). Donc environ 600 et 1200 litres par an, donc entre 20
+ et 40 GJ par an.
- Article intéressant comparant la dépense énergétique de chaque moyen de
transport. La dépense du corps humain est estmiée via la consommation
@@ -112,7 +127,7 @@ Framapiaf.
plus que la moyenne au Japon ou en Amérique, on voit que la consommation
résidentielle reste négligeable dans l'équation. Entre 1000 et 2000 personnes
travaillent sur le campus. On peut donc dire que chacun d'entre nous consomme
- de l'ordre de 360 GJ / an en moyenne, et que c'est probablement un peu
+ de l'ordre de 100 à 360 GJ / an en moyenne, et que c'est probablement un peu
surestimé. En comparaison, je consomme 800 MJ * 12 ~= 10 GJ d'énergie en
carburant pour aller travailler.
@@ -129,3 +144,20 @@ estimé à 1/2 ou 1/3 du coût total. (à vérifier)
Le coût énergétique de la synthèse et manufacture du plastique est
estimé à 18 MJ / kg de plastique.
+
+le vin
+
+Aller au travail en vélo
+
+une vie plus bourgeoise ? Une vie plus maigre ?
+
+Consommation annuelle de pétrole (4.2 10e20 J)/ Énergie envoyée par le soleil: 6,2 × 1020 J l'énergie totale du Soleil qui atteint la Terre en une heure. (https://fr.wikipedia.org/wiki/Ordres_de_grandeur_d%27%C3%A9nergie)
+
+L'énergie cinétique d'un 1kg de matière à la vitesse de libération (7.9 km/s)
+est d'un peu plus de 30 MJ. Il faut brûler un litre d'essence pour dégager
+cette énergie. Malheureusement, comme on n'a pas encore inventé mieux, il faut
+aussi transporter l'essence et le moteur, ce qui alourdit considérablement
+l'ensemble, au point de doubler le poids et donc l'énergie demandée, et donc le
+poids, et donc l'énergie demandée, etc. Note: la différence d'énergie
+potentielle dans le champs de gravité terrestre est largement inférieure à la
+quantité d'énergie cinétique nécessaire.
updated PO files
diff --git a/Joules.en.po b/Joules.en.po index 75b3cab6..e0ffd0e2 100644 --- a/Joules.en.po +++ b/Joules.en.po @@ -7,7 +7,7 @@ msgid "" msgstr "" "Project-Id-Version: PACKAGE VERSION\n" -"POT-Creation-Date: 2023-05-09 13:35+0000\n" +"POT-Creation-Date: 2023-05-09 13:37+0000\n" "PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n" "Last-Translator: FULL NAME <EMAIL@ADDRESS>\n" "Language-Team: LANGUAGE <LL@li.org>\n" @@ -229,35 +229,3 @@ msgid "" "Le coût énergétique de la synthèse et manufacture du plastique est estimé à " "18 MJ / kg de plastique." msgstr "" - -#. type: Plain text -msgid "le vin" -msgstr "" - -#. type: Plain text -msgid "Aller au travail en vélo" -msgstr "" - -#. type: Plain text -msgid "une vie plus bourgeoise ? Une vie plus maigre ?" -msgstr "" - -#. type: Plain text -msgid "" -"Consommation annuelle de pétrole (4.2 10e20 J)/ Énergie envoyée par le " -"soleil: 6,2 × 1020 J \tl'énergie totale du Soleil qui atteint la Terre en " -"une heure. (https://fr.wikipedia.org/wiki/Ordres_de_grandeur_d" -"%27%C3%A9nergie)" -msgstr "" - -#. type: Plain text -msgid "" -"L'énergie cinétique d'un 1kg de matière à la vitesse de libération (7.9 km/" -"s) est d'un peu plus de 30 MJ. Il faut brûler un litre d'essence pour " -"dégager cette énergie. Malheureusement, comme on n'a pas encore inventé " -"mieux, il faut aussi transporter l'essence et le moteur, ce qui alourdit " -"considérablement l'ensemble, au point de doubler le poids et donc l'énergie " -"demandée, et donc le poids, et donc l'énergie demandée, etc. Note: la " -"différence d'énergie potentielle dans le champs de gravité terrestre est " -"largement inférieure à la quantité d'énergie cinétique nécessaire." -msgstr ""
On enlève le brouillon
diff --git a/Joules.md b/Joules.md index 8194cf9e..9b55565f 100644 --- a/Joules.md +++ b/Joules.md @@ -129,20 +129,3 @@ estimé à 1/2 ou 1/3 du coût total. (à vérifier) Le coût énergétique de la synthèse et manufacture du plastique est estimé à 18 MJ / kg de plastique. - -le vin - -Aller au travail en vélo - -une vie plus bourgeoise ? Une vie plus maigre ? - -Consommation annuelle de pétrole (4.2 10e20 J)/ Énergie envoyée par le soleil: 6,2 × 1020 J l'énergie totale du Soleil qui atteint la Terre en une heure. (https://fr.wikipedia.org/wiki/Ordres_de_grandeur_d%27%C3%A9nergie) - -L'énergie cinétique d'un 1kg de matière à la vitesse de libération (7.9 km/s) -est d'un peu plus de 30 MJ. Il faut brûler un litre d'essence pour dégager -cette énergie. Malheureusement, comme on n'a pas encore inventé mieux, il faut -aussi transporter l'essence et le moteur, ce qui alourdit considérablement -l'ensemble, au point de doubler le poids et donc l'énergie demandée, et donc le -poids, et donc l'énergie demandée, etc. Note: la différence d'énergie -potentielle dans le champs de gravité terrestre est largement inférieure à la -quantité d'énergie cinétique nécessaire.
updated PO files
diff --git a/Joules.en.po b/Joules.en.po index 2183e164..75b3cab6 100644 --- a/Joules.en.po +++ b/Joules.en.po @@ -7,7 +7,7 @@ msgid "" msgstr "" "Project-Id-Version: PACKAGE VERSION\n" -"POT-Creation-Date: 2022-12-16 12:58+0000\n" +"POT-Creation-Date: 2023-05-09 13:35+0000\n" "PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n" "Last-Translator: FULL NAME <EMAIL@ADDRESS>\n" "Language-Team: LANGUAGE <LL@li.org>\n" @@ -43,6 +43,11 @@ msgid "" "Joules) sur Framapiaf." msgstr "" +#. type: Title ## +#, no-wrap +msgid "Les transports" +msgstr "" + #. type: Bullet: ' - ' msgid "" "« _L'énergie contenue dans l'essence est d'environ 33 600 000 joules par " @@ -54,42 +59,75 @@ msgstr "" #. type: Bullet: ' - ' msgid "" -"Je roule 30 kilomètres par jour pour aller travailler, environ 20 jours par " -"mois, avec une voiture parcourant 25 kilomètres par litre, ça fait 24 litres " -"par mois, donc environ 800 MJ par mois." +"Je roule en **voiture** 30 kilomètres par jour pour aller travailler, " +"environ 20 jours par mois. Avec une voiture hybride parcourant 25 " +"kilomètres par litre, ça fait 24 litres par mois, donc environ 800 MJ par " +"mois." msgstr "" #. type: Bullet: ' - ' msgid "" -"Je n'ai aucune idée précise de la quantité d'énergie que j'ingère chaque " -"jour. Mon pèse-personne, calibré pour une masse corporelle japonaise, me " -"recommande de manger 1700 kilocalories par jour. C'est gross-modo mon " -"métabolisme de base d'après les chiffres résumés par l'ANSES dans on avis " -"suivant la saisine 2012-SA-0103. Dans ce même document, les besoins d'un " -"homme de mon age « modérément actif » sont un peu au dessus de 2500 kcal par " -"jour. Une calorie vaut environ 4.2 Joules. 10 000 kJoules valent un peu " -"moins de 2400 kcal. En approximant ça à ma consommation quotidienne, j'en " -"déduis que je consomme environ 300 MJ par mois. Reste à savoir: l'énergie " -"dépensée pour me fournir cette nourriture…" +"Pour parcourir un kilomètre en **train** je dois dépenser entre 10 et 20 " +"yens. Çela me côute environ autant en essence quand je pends la voiture, " +"mais c'est sans compter la rentabilisation de la voiture et les taxes sur la " +"propriété et le contrôle technique (et pour d'autres, le prix du parking). " +"Mes trajets en voiture consomment (voir plus haut) 1/25 L par km, c'est à " +"dire environ 825 kJ par km, ou 825 J / m. C'est très proche des chiffres " +"annoncés par Die Bahn pour les transports par train régionaux en Allemagne." +msgstr "" + +#. type: Plain text +#, no-wrap +msgid " https://ibir.deutschebahn.com/ib2018/en/group-management-report/environmental/progress-in-climate-protection/energy-efficiency-increased/\n" +msgstr "" + +#. type: Bullet: ' - ' +msgid "" +"On estime la consommation des **avions** modernes entre 2 et 4 litres de " +"kérosène par 100 kilomètres et par passager. Son pouvoir calorifique n'est " +"pas très différent ce celui de l'essence de nos voitures, mettons 34 MJ par " +"litre (43 MJ/kg pour densité de 0.8). La différence avec la voiture, c'est " +"qu'on fait beaucoup plus de kilomètres en avion. Je fais environ un voyage " +"intercontinental (20 000 km) et quatre voyages domestiques entre Okinawa et " +"Tôkyô (4 × 2000 km). Donc environ 840 litres par an, donc 2 400 MJ." +msgstr "" + +#. type: Bullet: ' - ' +msgid "" +"Article intéressant comparant la dépense énergétique de chaque moyen de " +"transport. La dépense du corps humain est estmiée via la consommation " +"d'oxygène, bien étudiée. Le rendement musculaire n'est pas très haut : les " +"trois quarts de l'énergie dépensée se dissipent en chaleur, et le reste est " +"disponible pour le mouvement." +msgstr "" + +#. type: Plain text +#, no-wrap +msgid " http://www.economiematin.fr/news-consommation-transports-industrie-services-energie\n" +msgstr "" + +#. type: Title ## +#, no-wrap +msgid "Le logement" msgstr "" #. type: Bullet: ' - ' msgid "" "Pour nous chauffer et nous rafraîchir, pour utiliser nos appareils électro-" "ménagers, et nos médias à écrans, nous consommons environ 300 kWh " -"d'électricité par mois. Mettons que ça fait 100 pour moi. Une puissance de " -"1 Watt, c'est 1 Joule par seconde. Donc 100 kWh font 360 MJ. Une grande " -"partie de cette énergie provient de centrales à charbon et il faut de " -"l'énergie pour l'extraire et le transporter. Une partie de l'électricité " -"produite se dissipe en chaleur dans le réseau électrique. Ma consommation " -"réelle est donc supérieure à ce que m'annonce le compteur." +"d'**électricité** par mois. Mettons que ça fait 100 pour moi. Une " +"puissance de 1 Watt, c'est 1 Joule par seconde. Donc 100 kWh font 360 MJ. " +"Une grande partie de cette énergie provient de centrales à charbon et il " +"faut de l'énergie pour l'extraire et le transporter. Une partie de " +"l'électricité produite se dissipe en chaleur dans le réseau électrique. Ma " +"consommation réelle est donc supérieure à ce que m'annonce le compteur." msgstr "" #. type: Bullet: ' - ' msgid "" "Pour cuisiner, chauffer notre eau de lavage, et sécher nos habits, nous " -"utilisons environ 12 mètres cube de gaz par mois, donc 4 pour ma part. Il " -"existe différents types de gaz domestique, et une partie de l'énergie " +"utilisons environ 12 mètres cube de **gaz** par mois, donc 4 pour ma part. " +"Il existe différents types de gaz domestique, et une partie de l'énergie " "dégagée par la combustion se perd par l'émission de vapeur d'eau. Les " "chiffres donnés sur Wikipédia sont pour une température ambiante de zéro " "degrés, ce qui n'est pas le cas dans notre appartement. Néanmoins, une " @@ -101,19 +139,8 @@ msgstr "" #. type: Bullet: ' - ' msgid "" -"On estime la consommation des avions modernes entre 2 et 4 litres de " -"kérosène par 100 kilomètres et par passager. Son pouvoir calorifique n'est " -"pas très différent ce celui de l'essence de nos voitures, mettons 34 MJ par " -"litre (43 MJ/kg pour densité de 0.8). La différence avec la voiture, c'est " -"qu'on fait beaucoup plus de kilomètres en avion. Je fais environ un voyage " -"intercontinental (20 000 km) et quatre voyages domestiques entre Okinawa et " -"Tôkyô (4 × 2000 km). Donc environ 840 litres par an, donc 2 400 MJ." -msgstr "" - -#. type: Bullet: ' - ' -msgid "" -"Ma part dans la facture télécoms familiale, internet plus téléphonie mobile, " -"est d'environ 5000 yens. Je n'ai aucune idée précise de la quantité " +"Ma part dans la facture **télécoms** familiale, internet plus téléphonie " +"mobile, est d'environ 5000 yens. Je n'ai aucune idée précise de la quantité " "d'énergie utilisée. Mais on peut estimer une limite supérieure: si cet " "argent était entièrement dépensé en électricité par les opérateurs, et " "qu'ils la payaient au même prix que nous cela ferait environ 160 kWh, ou " @@ -125,19 +152,44 @@ msgstr "" #. type: Bullet: ' - ' msgid "" -"Je consomme entre 6 et 7 mètres cubes d'eau par mois pour un prix d'environ " -"1000 yens, qui include la production et le retraitement. Un rapport de " -"l'observatoire de l'eau de la Seine-et-Marne sur les enjeux énergétiques de " -"l'eau potable et de l'assainissement, de 2016, estime entre 1.6 et 16 % la " -"part énergétique de la facture d'eau. En extrapolant avec ma facture " -"d'électricité, 100 yens font environ 11 MJ. L'eau est précieuse et les " -"effets de son gaspillage sont différents de ceux du gaspillage de l'énergie." +"Je consomme entre 6 et 7 mètres cubes d'**eau** par mois pour un prix " +"d'environ 1000 yens, qui include la production et le retraitement. Un " +"rapport de l'observatoire de l'eau de la Seine-et-Marne sur les enjeux " +"énergétiques de l'eau potable et de l'assainissement, de 2016, estime entre " +"1.6 et 16 % la part énergétique de la facture d'eau. En extrapolant avec ma " +"facture d'électricité, 100 yens font environ 11 MJ. L'eau est précieuse et " +"les effets de son gaspillage sont différents de ceux du gaspillage de " +"l'énergie." +msgstr "" + +#. type: Title ## +#, no-wrap +msgid "La vie quotidienne" +msgstr "" + +#. type: Bullet: ' - ' +msgid "" +"Je n'ai aucune idée précise de la quantité d'énergie que j'ingère chaque " +"jour. Mon pèse-personne, calibré pour une masse corporelle japonaise, me " +"recommande de manger 1700 kilocalories par jour. C'est gross-modo mon " +"**métabolisme** de base d'après les chiffres résumés par l'ANSES dans on " +"avis suivant la saisine 2012-SA-0103. Dans ce même document, les besoins " +"d'un homme de mon age « modérément actif » sont un peu au dessus de 2500 " +"kcal par jour. Une calorie vaut environ 4.2 Joules. 10 000 kJoules valent " +"un peu moins de 2400 kcal. En approximant ça à ma consommation quotidienne, " +"j'en déduis que je consomme environ 300 MJ par mois. Reste à savoir: " +"l'énergie dépensée pour me fournir cette nourriture…" +msgstr "" + +#. type: Title ## +#, no-wrap +msgid "Le travail" msgstr "" #. type: Bullet: ' - ' msgid "" -"Je travaille sur un campus qui consomme 100 000 000 kWh / an, c'est à dire " -"360 000 000 MJ / an ou 360 TJ / an. Cela inclut la consommation des " +"Je **travaille** sur un campus qui consomme 100 000 000 kWh / an, c'est à " +"dire 360 000 000 MJ / an ou 360 TJ / an. Cela inclut la consommation des " "résidences de quelques centaines d'étudiants et de chercheurs. Imaginons " "qu'une personne consomme 10 000 kWh par an, c'est à dire 36 GJ, ce qui " "serait plus que la moyenne au Japon ou en Amérique, on voit que la " @@ -147,3 +199,65 @@ msgid "" "probablement un peu surestimé. En comparaison, je consomme 800 MJ * 12 ~= " (Diff truncated)
Réorganisation et ajouts.
diff --git a/Joules.md b/Joules.md
index 29ec81ac..8194cf9e 100644
--- a/Joules.md
+++ b/Joules.md
@@ -13,16 +13,18 @@ l'unité du Système International, pour mieux comparer. Je vais poster chacun
de mes calculs avec le tag [#Joules](https://framapiaf.org/tags/Joules) sur
Framapiaf.
+## Les transports
+
- « _L'énergie contenue dans l'essence est d'environ 33 600 000 joules par
litre, ou 46 700 000 joules par kilogramme (de pouvoir calorifique
supérieur)._ » ([Wikipedia](https://fr.wikipedia.org/wiki/Essence_(hydrocarbure)).
Reste à savoir: l'énergie consommée pour produire ce litre d'essence…
- - Je roule 30 kilomètres par jour pour aller travailler, environ 20 jours par
- mois, avec une voiture parcourant 25 kilomètres par litre, ça fait 24 litres
- par mois, donc environ 800 MJ par mois.
+ - Je roule en **voiture** 30 kilomètres par jour pour aller travailler,
+ environ 20 jours par mois. Avec une voiture hybride parcourant 25
+ kilomètres par litre, ça fait 24 litres par mois, donc environ 800 MJ par mois.
- - Pour parcourir un kilomètre en train je dois dépenser entre 10 et 20 yens.
+ - Pour parcourir un kilomètre en **train** je dois dépenser entre 10 et 20 yens.
Çela me côute environ autant en essence quand je pends la voiture, mais
c'est sans compter la rentabilisation de la voiture et les taxes sur la
propriété et le contrôle technique (et pour d'autres, le prix du parking).
@@ -30,22 +32,29 @@ Framapiaf.
dire environ 825 kJ par km, ou 825 J / m. C'est très proche des chiffres
annoncés par Die Bahn pour les transports par train régionaux en Allemagne.
-https://ibir.deutschebahn.com/ib2018/en/group-management-report/environmental/progress-in-climate-protection/energy-efficiency-increased/
+ https://ibir.deutschebahn.com/ib2018/en/group-management-report/environmental/progress-in-climate-protection/energy-efficiency-increased/
- - Je n'ai aucune idée précise de la quantité d'énergie que j'ingère chaque jour.
- Mon pèse-personne, calibré pour une masse corporelle japonaise, me recommande de
- manger 1700 kilocalories par jour. C'est gross-modo mon métabolisme de base
- d'après les chiffres résumés par l'ANSES dans on avis suivant la saisine
- 2012-SA-0103. Dans ce même document, les besoins d'un homme de mon age
- « modérément actif » sont un peu au dessus de 2500 kcal par jour. Une calorie
- vaut environ 4.2 Joules. 10 000 kJoules valent un peu moins de 2400 kcal.
- En approximant ça à ma consommation quotidienne, j'en déduis que je consomme
- environ 300 MJ par mois. Reste à savoir: l'énergie dépensée pour me fournir
- cette nourriture…
+ - On estime la consommation des **avions** modernes entre 2 et 4 litres de
+ kérosène par 100 kilomètres et par passager. Son pouvoir calorifique n'est
+ pas très différent ce celui de l'essence de nos voitures, mettons 34 MJ par
+ litre (43 MJ/kg pour densité de 0.8). La différence avec la voiture, c'est
+ qu'on fait beaucoup plus de kilomètres en avion. Je fais environ un voyage
+ intercontinental (20 000 km) et quatre voyages domestiques entre Okinawa et
+ Tôkyô (4 × 2000 km). Donc environ 840 litres par an, donc 2 400 MJ.
+
+ - Article intéressant comparant la dépense énergétique de chaque moyen de
+ transport. La dépense du corps humain est estmiée via la consommation
+ d'oxygène, bien étudiée. Le rendement musculaire n'est pas très haut : les
+ trois quarts de l'énergie dépensée se dissipent en chaleur, et le reste est
+ disponible pour le mouvement.
+
+ http://www.economiematin.fr/news-consommation-transports-industrie-services-energie
+
+## Le logement
- Pour nous chauffer et nous rafraîchir, pour utiliser nos appareils
électro-ménagers, et nos médias à écrans, nous consommons environ 300 kWh
- d'électricité par mois. Mettons que ça fait 100 pour moi. Une puissance de
+ d'**électricité** par mois. Mettons que ça fait 100 pour moi. Une puissance de
1 Watt, c'est 1 Joule par seconde. Donc 100 kWh font 360 MJ. Une grande
partie de cette énergie provient de centrales à charbon et il faut de l'énergie
pour l'extraire et le transporter. Une partie de l'électricité produite se
@@ -53,7 +62,7 @@ https://ibir.deutschebahn.com/ib2018/en/group-management-report/environmental/pr
supérieure à ce que m'annonce le compteur.
- Pour cuisiner, chauffer notre eau de lavage, et sécher nos habits, nous
- utilisons environ 12 mètres cube de gaz par mois, donc 4 pour ma part.
+ utilisons environ 12 mètres cube de **gaz** par mois, donc 4 pour ma part.
Il existe différents types de gaz domestique, et une partie de l'énergie
dégagée par la combustion se perd par l'émission de vapeur d'eau. Les chiffres
donnés sur Wikipédia sont pour une température ambiante de zéro degrés, ce
@@ -63,15 +72,7 @@ https://ibir.deutschebahn.com/ib2018/en/group-management-report/environmental/pr
sais pas combien d'énergie supplémentaire il faut dépenser pour me fournir
ce gaz.
- - On estime la consommation des avions modernes entre 2 et 4 litres de
- kérosène par 100 kilomètres et par passager. Son pouvoir calorifique n'est
- pas très différent ce celui de l'essence de nos voitures, mettons 34 MJ par
- litre (43 MJ/kg pour densité de 0.8). La différence avec la voiture, c'est
- qu'on fait beaucoup plus de kilomètres en avion. Je fais environ un voyage
- intercontinental (20 000 km) et quatre voyages domestiques entre Okinawa et
- Tôkyô (4 × 2000 km). Donc environ 840 litres par an, donc 2 400 MJ.
-
- - Ma part dans la facture télécoms familiale, internet plus téléphonie
+ - Ma part dans la facture **télécoms** familiale, internet plus téléphonie
mobile, est d'environ 5000 yens. Je n'ai aucune idée précise de la quantité
d'énergie utilisée. Mais on peut estimer une limite supérieure: si cet
argent était entièrement dépensé en électricité par les opérateurs, et qu'ils
@@ -81,7 +82,7 @@ https://ibir.deutschebahn.com/ib2018/en/group-management-report/environmental/pr
entendu, ces chiffres ne tiennent pas compte du fait que côté centres de
données qui nous fournissent le « contenu », la dépense énergétique est énorme.
- - Je consomme entre 6 et 7 mètres cubes d'eau par mois pour un prix d'environ
+ - Je consomme entre 6 et 7 mètres cubes d'**eau** par mois pour un prix d'environ
1000 yens, qui include la production et le retraitement. Un rapport de
l'observatoire de l'eau de la Seine-et-Marne sur les enjeux énergétiques
de l'eau potable et de l'assainissement, de 2016, estime entre 1.6 et 16 %
@@ -89,7 +90,22 @@ https://ibir.deutschebahn.com/ib2018/en/group-management-report/environmental/pr
d'électricité, 100 yens font environ 11 MJ. L'eau est précieuse et les effets
de son gaspillage sont différents de ceux du gaspillage de l'énergie.
- - Je travaille sur un campus qui consomme 100 000 000 kWh / an, c'est à dire
+## La vie quotidienne
+
+ - Je n'ai aucune idée précise de la quantité d'énergie que j'ingère chaque jour.
+ Mon pèse-personne, calibré pour une masse corporelle japonaise, me recommande de
+ manger 1700 kilocalories par jour. C'est gross-modo mon **métabolisme** de base
+ d'après les chiffres résumés par l'ANSES dans on avis suivant la saisine
+ 2012-SA-0103. Dans ce même document, les besoins d'un homme de mon age
+ « modérément actif » sont un peu au dessus de 2500 kcal par jour. Une calorie
+ vaut environ 4.2 Joules. 10 000 kJoules valent un peu moins de 2400 kcal.
+ En approximant ça à ma consommation quotidienne, j'en déduis que je consomme
+ environ 300 MJ par mois. Reste à savoir: l'énergie dépensée pour me fournir
+ cette nourriture…
+
+## Le travail
+
+ - Je **travaille** sur un campus qui consomme 100 000 000 kWh / an, c'est à dire
360 000 000 MJ / an ou 360 TJ / an. Cela inclut la consommation des
résidences de quelques centaines d'étudiants et de chercheurs. Imaginons
qu'une personne consomme 10 000 kWh par an, c'est à dire 36 GJ, ce qui serait
@@ -100,3 +116,33 @@ https://ibir.deutschebahn.com/ib2018/en/group-management-report/environmental/pr
surestimé. En comparaison, je consomme 800 MJ * 12 ~= 10 GJ d'énergie en
carburant pour aller travailler.
+## Le plastique
+
+ - Le **plastique** en général: http://large.stanford.edu/courses/2010/ph240/hamman1/
+
+La plupart du plastique est produit à partir de pétrole ou de gaz. L'énergie
+de combusion du polyéthylène est d'environ 45 MJ / kg. En 2008, le monde a
+produit environ 80 Tg de plastique.
+
+Le coût énergétique de la synthèse et manufacture du plastique est
+estimé à 1/2 ou 1/3 du coût total. (à vérifier)
+
+Le coût énergétique de la synthèse et manufacture du plastique est
+estimé à 18 MJ / kg de plastique.
+
+le vin
+
+Aller au travail en vélo
+
+une vie plus bourgeoise ? Une vie plus maigre ?
+
+Consommation annuelle de pétrole (4.2 10e20 J)/ Énergie envoyée par le soleil: 6,2 × 1020 J l'énergie totale du Soleil qui atteint la Terre en une heure. (https://fr.wikipedia.org/wiki/Ordres_de_grandeur_d%27%C3%A9nergie)
+
+L'énergie cinétique d'un 1kg de matière à la vitesse de libération (7.9 km/s)
+est d'un peu plus de 30 MJ. Il faut brûler un litre d'essence pour dégager
+cette énergie. Malheureusement, comme on n'a pas encore inventé mieux, il faut
+aussi transporter l'essence et le moteur, ce qui alourdit considérablement
+l'ensemble, au point de doubler le poids et donc l'énergie demandée, et donc le
+poids, et donc l'énergie demandée, etc. Note: la différence d'énergie
+potentielle dans le champs de gravité terrestre est largement inférieure à la
+quantité d'énergie cinétique nécessaire.
Train
diff --git a/Joules.md b/Joules.md
index cecfb116..29ec81ac 100644
--- a/Joules.md
+++ b/Joules.md
@@ -22,6 +22,16 @@ Framapiaf.
mois, avec une voiture parcourant 25 kilomètres par litre, ça fait 24 litres
par mois, donc environ 800 MJ par mois.
+ - Pour parcourir un kilomètre en train je dois dépenser entre 10 et 20 yens.
+ Çela me côute environ autant en essence quand je pends la voiture, mais
+ c'est sans compter la rentabilisation de la voiture et les taxes sur la
+ propriété et le contrôle technique (et pour d'autres, le prix du parking).
+ Mes trajets en voiture consomment (voir plus haut) 1/25 L par km, c'est à
+ dire environ 825 kJ par km, ou 825 J / m. C'est très proche des chiffres
+ annoncés par Die Bahn pour les transports par train régionaux en Allemagne.
+
+https://ibir.deutschebahn.com/ib2018/en/group-management-report/environmental/progress-in-climate-protection/energy-efficiency-increased/
+
- Je n'ai aucune idée précise de la quantité d'énergie que j'ingère chaque jour.
Mon pèse-personne, calibré pour une masse corporelle japonaise, me recommande de
manger 1700 kilocalories par jour. C'est gross-modo mon métabolisme de base
APEX2 / APE2
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 475eb22c..3791499b 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -276,6 +276,8 @@ Genes and pathways
([[Niimura, 2009|biblio/20333175]]).
- Most members of retinoic acid pathway gene network (biosynthesis, signalling
and degradation) are lost in _O. dioica_ ([[Martí-Solans et al., 2016|biblio/27406791]]).
+ - APEX2 (encoding for the APE2 protein involved in base excision repair and microhomology
+ mediated end-joining (MMEJ) was not found, but APEX1 was found ([[Denoeud et al., 2010|biblio/21097902]]).
- The entire machinery required for performing classical NHEJ repair of DSB (which is
conserved from yeast to mammals) is undetectable ([[Denoeud et al., 2010|biblio/21097902]]).
An alternative or microhomology (MH)-driven end joining pathway is active
larvacea
diff --git a/biblio/biostor-236874.mdwn b/biblio/biostor-236874.mdwn new file mode 100644 index 00000000..a001e3bb --- /dev/null +++ b/biblio/biostor-236874.mdwn @@ -0,0 +1,21 @@ +[[!meta title="A revised classification of the Tunicata, with definitions of the orders, sub-orders, families, sub-families and genera, and analytical keys to the species"]] +[[!tag Oikopleura]] + +William Abbott Herdman + +Journal of The Linnean Society of London, Zoology, vol 23, 558-652, Feb 5th 1891. ark:/13960/t5q898f4x, biostor-236874. + +A revised classification of the Tunicata, with definitions of the orders, sub-orders, families, sub-families and genera, and analytical keys to the species + +Defines: + + - Order Larvacea, Herdman, 1882 + - Family Appendiculariidae, Bronn, 1862 + - Genus Appendicularia (Chamisso 1821), Fol, 1874 + - Genus Oikopoleura (Mertens 1831), Fol, 1872 + synonym: Vexillaria, J. Müller + - Genus Stegosoma, Chun 1888 + - Genus Fritillaria (Q. & G. 1833), Fol, 1872 + synonym: Eurycercus, Busch + - Genus Kowalvskia, Fol, 1872 + Herdman speculates that it may be a Family.
outliers
diff --git a/biblio/22925495.mdwn b/biblio/22925495.mdwn new file mode 100644 index 00000000..6669e60c --- /dev/null +++ b/biblio/22925495.mdwn @@ -0,0 +1,10 @@ +[[!meta title="Gene functionalities and genome structure in Bathycoccus prasinos reflect cellular specializations at the base of the green lineage."]] +[[!tag genome chromosome repeats]] + +Moreau H, Verhelst B, Couloux A, Derelle E, Rombauts S, Grimsley N, Van Bel M, Poulain J, Katinka M, Hohmann-Marriott MF, Piganeau G, Rouzé P, Da Silva C, Wincker P, Van de Peer Y, Vandepoele K. + +Genome Biol. 2012 Aug 24;13(8):R74. doi:10.1186/gb-2012-13-8-r74 + +Gene functionalities and genome structure in Bathycoccus prasinos reflect cellular specializations at the base of the green lineage. + +[[!pmid 22925495 desc="7,847 genes, no transposons. Two “outlier” chromosomes are found with lower GC content, like in _Ostreococcus_ and _Micromonas_. Genes in the big outlier chromosomes have a high number of small AT-rich introns with no apparent conserved motifs."]] diff --git a/tags/chromosome.mdwn b/tags/chromosome.mdwn index 288710cd..ac6a4887 100644 --- a/tags/chromosome.mdwn +++ b/tags/chromosome.mdwn @@ -6,7 +6,9 @@ _in progressss_ Two (out of 20) chromosomes in the genome of the unicellular green alga _Ostreococcus tauri_ have a markedly different GC and transposable element -content compared to the others. [[Derelle et al., 2003|biblio/16868079]]. +content compared to the others. [[Derelle and coll., 2003|biblio/16868079]]. +The same phenomeon has then been reported in _Bathycoccus prasinos_ ([[Moreau +and coll., 2012|biblio/22925495]]) and other species. Chr4 in _Polypedilum vanderplanki_ has lower GC content than the others ([[Yoshida et al., 2022|biblio/35387384]]), and it has been speculated that it
creating tag page tags/mangrove
diff --git a/tags/mangrove.mdwn b/tags/mangrove.mdwn new file mode 100644 index 00000000..e47229d1 --- /dev/null +++ b/tags/mangrove.mdwn @@ -0,0 +1,4 @@ +[[!meta title="pages tagged mangrove"]] + +[[!inline pages="tagged(mangrove)" actions="no" archive="yes" +feedshow=10]]
WGD
diff --git a/biblio/31258950.mdwn b/biblio/31258950.mdwn new file mode 100644 index 00000000..ce8c747b --- /dev/null +++ b/biblio/31258950.mdwn @@ -0,0 +1,13 @@ +[[!meta title="The origin, diversification and adaptation of a major mangrove clade (Rhizophoreae) revealed by whole-genome sequencing."]] +[[!tag mangrove genome]] + +Xu, S., He, Z., Zhang, Z., Guo, Z., Guo, W., Lyu, H., Li, J., Yang, M., Du, Z., Huang, Y., Zhou, R., Zhong, C., Boufford, D. E., Lerdau, M., Wu, C. I., Duke, N. C., International Mangrove Consortium, & Shi, S. + +National science review, 4(5), 721–734, 2017. doi:10.1093/nsr/nwx065 + +The origin, diversification and adaptation of a major mangrove clade (Rhizophoreae) revealed by whole-genome sequencing + +[[!pmid 31258950 desc="Analysis of the genome sequence of _Rhizophora +apiculata_ suggests a whole-genome duplication. dN/dS analysis of the +paralogues and comparisons to outgroups suggest that the duplication took place +in the ancestors of _Rhizophoreae_."]]
PBS
diff --git a/biblio/25828383.mdwn b/biblio/25828383.mdwn new file mode 100644 index 00000000..bbffdb84 --- /dev/null +++ b/biblio/25828383.mdwn @@ -0,0 +1,13 @@ +[[!meta title="Printing 2-dimentional droplet array for single-cell reverse transcription quantitative PCR assay with a microfluidic robot"]] +[[!tag PCR]] + +Zhu Y, Zhang YX, Liu WW, Ma Y, Fang Q, Yao B. + +Sci Rep. 2015 Apr 1;5:9551. doi:10.1038/srep09551 + +Printing 2-dimentional droplet array for single-cell reverse transcription quantitative PCR assay with a microfluidic robot + +[[!pmid 25828383 desc="For the amplification of a miRNA, the authors reported a +98.03% efficiency in standard conditions. It dropped to 90.94% with 0.5 mM +49.99% PBS, 86.96% with 2 mM, 80.47% with 10 mM (1×), and 49.99% with 50 mM. +The PCR was done in TaqMan universal PCR master mix."]]
Fungi
diff --git a/tags/yeast.mdwn b/tags/yeast.mdwn index da1870c0..2e16ab37 100644 --- a/tags/yeast.mdwn +++ b/tags/yeast.mdwn @@ -1,4 +1,6 @@ [[!meta title="pages tagged yeast"]] +# Yeast and other unicellular fungi + [[!inline pages="tagged(yeast)" actions="no" archive="yes" feedshow=10]]
Café hier
diff --git a/biblio/30618839.mdwn b/biblio/30618839.mdwn new file mode 100644 index 00000000..bec42c55 --- /dev/null +++ b/biblio/30618839.mdwn @@ -0,0 +1,17 @@ +[[!meta title="A Phylogenomic Framework and Divergence History of Cephalochordata Amphioxus."]] +[[!tag phylogeny]] + +Front Physiol. 2018 Dec 18;9:1833. doi:10.3389/fphys.2018.01833 + +Zhang QL, Zhang GL, Yuan ML, Dong ZX, Li HW, Guo J, Wang F, Deng XY, Chen JY, Lin LB. + +A Phylogenomic Framework and Divergence History of Cephalochordata Amphioxus. + +[[!pmid 30618839 desc="Supports “a phylogeny of [(B. belcheri + B. japonicum) + +(B. lanceolatum + B. floridae) + Asymmetron lucayanum] in amphioxus”. +Estimates that “the most recent common ancestor of the living amphioxus species +(the divergence time between _Asymmetron_ and _Branchiostoma_) was estimated to +be ∼104 Mya [23.74—211.63]; the early splits within each main clade occurred at +∼87 Mya [41.02—162.19]; _B. lanceolatum_ diverged from _B. floridae_ at ∼72 Mya +[31.93—149.68], and the divergence time between _B. belcheri_ and _B. +japonicum_ was ∼61 Mya [10.21—136.41]”."]]
Fritillaria
diff --git a/biblio/36307829.mdwn b/biblio/36307829.mdwn index 4598663c..18eb634f 100644 --- a/biblio/36307829.mdwn +++ b/biblio/36307829.mdwn @@ -8,9 +8,10 @@ Front Zool. 2022 Oct 28;19(1):26. doi:10.1186/s12983-022-00471-y Laboratory study of Fritillaria lifecycle reveals key morphogenetic events leading to genus-specific anatomy. [[!pmid 36307829 desc="Possibly parasited by a Syndiniale from the genus -_Sphaeripara_ and _Oodinium_. Fed with _Micromonas_, _Phaeocystis_ and -_Synechococcus_ in culture. 4 chromosomes are visible in oocytes by DAPI -staining. Self-fertilization was never observed. In vitro fertilized oocytes -frequently aborted development when left in vessels without water flow. -Embryos hatch between 4 and 6 h at 15 °C. Cellulose-producing cells identified -by staining with a carbohydrate-binding-module (CBM)."]] +_Sphaeripara_ and _Oodinium_. Fed with _Micromonas pusilla_ or _Synechococcus +sp_ in culture at a density between 2 and 8 × 10<sup>7</sup> depending on the +developmental stage. 4 chromosomes are visible in oocytes by DAPI staining. +Self-fertilization was never observed. In vitro fertilized oocytes frequently +aborted development when left in vessels without water flow. Embryos hatch +between 4 and 6 h at 15 °C. Cellulose-producing cells identified by staining +with a carbohydrate-binding-module (CBM)."]] diff --git a/tags/Fritillaria.mdwn b/tags/Fritillaria.mdwn index ed9d0dc3..84d424a9 100644 --- a/tags/Fritillaria.mdwn +++ b/tags/Fritillaria.mdwn @@ -4,6 +4,12 @@ _in progress_ - _Fritillaria borealis_ can swim with its house deflated ([[Flood, 2003|biblio/10.1007_s00227-003-1075-y]]). + - Fed in culture with _Micromonas pusilla_ or _Synechococcus sp_ in culture at + a density between 2 and 8 × 10<sup>7</sup> depending on the developmental + stage ([[Henriet, Asajord and Chourrout, 2022|biblio/36307829]]). + + - Karyotype of 4 chromosomes ([[Henriet, Asajord and Chourrout, 2022|biblio/36307829]]). + # Found in: ## Antarctica
creating tag page tags/clock
diff --git a/tags/clock.mdwn b/tags/clock.mdwn new file mode 100644 index 00000000..50f3f75d --- /dev/null +++ b/tags/clock.mdwn @@ -0,0 +1,4 @@ +[[!meta title="pages tagged clock"]] + +[[!inline pages="tagged(clock)" actions="no" archive="yes" +feedshow=10]]
Details on the molecular clock analysis.
diff --git a/biblio/36867684.mdwn b/biblio/36867684.mdwn index 76e76691..3a99120f 100644 --- a/biblio/36867684.mdwn +++ b/biblio/36867684.mdwn @@ -1,5 +1,5 @@ [[!meta title="Three amphioxus reference genomes reveal gene and chromosome evolution of chordates. "]] -[[!tag genome]] +[[!tag genome clock]] Huang Z, Xu L, Cai C, Zhou Y, Liu J, Xu Z, Zhu Z, Kang W, Cen W, Pei S, Chen D, Shi C, Wu X, Huang Y, Xu C, Yan Y, Yang Y, Xue T, He W, Hu X, Zhang Y, Chen Y, Bi C, He C, Xue L, Xiao S, Yue Z, Jiang Y, Yu JK, Jarvis ED, Li G, Lin G, Zhang Q, Zhou Q. @@ -7,4 +7,28 @@ Proc Natl Acad Sci U S A. 2023 Mar 7;120(10):e2201504120. doi:10.1073/pnas.22015 Three amphioxus reference genomes reveal gene and chromosome evolution of chordates. -[[!pmid 36867684 desc="Chromosomal assembly of _Branchiostoma floridae_ (Bf), _Branchiostoma belcheri_ (Bb) and _Branchiostoma japonicum_ (Bj). ”we devised an interspecific trio sequencing strategy [...] for the F1 hybrids derived from Bf-Bb or Bf-Bj crosses. [...] the hybrids contain two haploid parental genomes that have become too diverged in sequences to form cross-species chimeric assembly” “The three amphioxus genomes show a highly conserved chromosomal synteny to each other, with most chromosomes showing a one-to-one homologous relationship except for a few chromosome fusions.” ”genome-wide heterozygosity [estimated to] range from 3.2 to 4.2%” ”Based on 3,653 single-copy orthologous genes, we estimated that different chordate lineages diverged about 592.5 Mya, and three amphioxus species diverged about 99.9 Mya”. “Using whole-genome resequencing data of between 10 and 48 individuals per sex per species, we identified the sexually differentiated regions (SDR) that harbor [...] excessive female heterozygotes, and are not shared between the three amphioxus species. In particular, the SDR of Bf is located on Chr16 and harbors 194 genes; and those of Bj and Bb are located at two different genomic loci of Chr3, harboring 35 genes and one gene with unknown function respectively. Bf Chr16 is not homologous with Chr3 of Bj or Bb.”"]] +[[!pmid 36867684 desc="Chromosomal assembly of _Branchiostoma floridae_ (Bf), +_Branchiostoma belcheri_ (Bb) and _Branchiostoma japonicum_ (Bj). ”we devised +an interspecific trio sequencing strategy [...] for the F1 hybrids derived from +Bf-Bb or Bf-Bj crosses. [...] the hybrids contain two haploid parental genomes +that have become too diverged in sequences to form cross-species chimeric +assembly” “The three amphioxus genomes show a highly conserved chromosomal +synteny to each other, with most chromosomes showing a one-to-one homologous +relationship except for a few chromosome fusions.” ”genome-wide heterozygosity +[estimated to] range from 3.2 to 4.2%” ”Based on 3,653 single-copy orthologous +genes, we estimated that different chordate lineages diverged about 592.5 Mya, +and three amphioxus species diverged about 99.9 Mya”. “Using whole-genome +resequencing data of between 10 and 48 individuals per sex per species, we +identified the sexually differentiated regions (SDR) that harbor [...] +excessive female heterozygotes, and are not shared between the three amphioxus +species. In particular, the SDR of Bf is located on Chr16 and harbors 194 +genes; and those of Bj and Bb are located at two different genomic loci of +Chr3, harboring 35 genes and one gene with unknown function respectively. Bf +Chr16 is not homologous with Chr3 of Bj or Bb.”"]] + +Mean and confidence interval for divergence times given in Table S2: + + - _B. belcheri_ and _B. japonicum_: 59.3 [12.2, 132.0]. + - all _Branchiostoma_: 99.9 [22.1, 211.7]. + - all chordates: 592.5 [530.8, 640.3]. Prior: [514, 636.1]. + - Euarchontoglires: 116.1 [72.1, 163.1]. Prior: [65.6, 164.6].
Résolu
diff --git a/dh.txt b/dh.txt deleted file mode 100644 index e02faf22..00000000 --- a/dh.txt +++ /dev/null @@ -1,21 +0,0 @@ ------BEGIN PGP SIGNED MESSAGE----- -Hash: SHA512 - -Hello DreahHost Customer Service I am Charles Plessy and we are discussing in the email thread 226139527 - ------BEGIN PGP SIGNATURE----- - -iQIzBAEBCgAdFiEEc0cUmcxg7Z7ugFlGxb1sjyKV1QIFAmPwFvMACgkQxb1sjyKV -1QImoRAAob7ZPH9T3/AG6p96RSulnOXfCxEcq7rDc3pFZdgIgsI9e0od0CFIlUtT -Dnbwycgd+RFOwk+VeEbj0eWAFb4PBEZO1G3X4YEiQDLVv5aNsLEdenNC9+H0x6XT -NigFIHTILvHwpcdtUfOHnUZe+1vwo8DsZHNrc3FQ3uOrygcDvzzXdmQY1blRpq37 -uCtuhyBHBV5mJL+QQ9109xCaa+m8edZKAxIk2egXndJo+dVX/iSAJ7IOshFQwE+4 -9+8l5gDAHxmk0pB9/Wu5J5IAlX+fZ2bjqSRZK+GvfxNjnoEZyUtWVZ1YF5iKKiq0 -0862YnDBrR9ajRtCVskiZ3ML6ySujbo8gnMYBe36JqyhtZNbEM2DvQtdCzac47Ep -CSmFR7mYO3vidH8ETqKiMPAErq27lAaYzdq7MWwWaLVxqu/w0b6D7+Npc9d1lx52 -j4Qv693SVLU9GvYxHZZ0HJWSmYIPMR13ldXOR8t/88M7ANQ2tGDYG1cVIqMwl7OH -88WUrJ8aBnZPwi2lq5Up956wFg7JQqtb/O8S7SS9LumXZJAXC4qOfN2AsDkoxEr/ -aVqtKLNJBPky7kn1o21dbUpilz70jjoU46KFZIe//njwsnebqq+bB/Y4HDlXxBKz -cX9jlPji2MCqg7LfH/5rJAeCKhtCBXyF4EdyxJsU87TlE+uKikw= -=WBtm ------END PGP SIGNATURE-----
Café
diff --git a/biblio/36867684.mdwn b/biblio/36867684.mdwn new file mode 100644 index 00000000..76e76691 --- /dev/null +++ b/biblio/36867684.mdwn @@ -0,0 +1,10 @@ +[[!meta title="Three amphioxus reference genomes reveal gene and chromosome evolution of chordates. "]] +[[!tag genome]] + +Huang Z, Xu L, Cai C, Zhou Y, Liu J, Xu Z, Zhu Z, Kang W, Cen W, Pei S, Chen D, Shi C, Wu X, Huang Y, Xu C, Yan Y, Yang Y, Xue T, He W, Hu X, Zhang Y, Chen Y, Bi C, He C, Xue L, Xiao S, Yue Z, Jiang Y, Yu JK, Jarvis ED, Li G, Lin G, Zhang Q, Zhou Q. + +Proc Natl Acad Sci U S A. 2023 Mar 7;120(10):e2201504120. doi:10.1073/pnas.2201504120 + +Three amphioxus reference genomes reveal gene and chromosome evolution of chordates. + +[[!pmid 36867684 desc="Chromosomal assembly of _Branchiostoma floridae_ (Bf), _Branchiostoma belcheri_ (Bb) and _Branchiostoma japonicum_ (Bj). ”we devised an interspecific trio sequencing strategy [...] for the F1 hybrids derived from Bf-Bb or Bf-Bj crosses. [...] the hybrids contain two haploid parental genomes that have become too diverged in sequences to form cross-species chimeric assembly” “The three amphioxus genomes show a highly conserved chromosomal synteny to each other, with most chromosomes showing a one-to-one homologous relationship except for a few chromosome fusions.” ”genome-wide heterozygosity [estimated to] range from 3.2 to 4.2%” ”Based on 3,653 single-copy orthologous genes, we estimated that different chordate lineages diverged about 592.5 Mya, and three amphioxus species diverged about 99.9 Mya”. “Using whole-genome resequencing data of between 10 and 48 individuals per sex per species, we identified the sexually differentiated regions (SDR) that harbor [...] excessive female heterozygotes, and are not shared between the three amphioxus species. In particular, the SDR of Bf is located on Chr16 and harbors 194 genes; and those of Bj and Bb are located at two different genomic loci of Chr3, harboring 35 genes and one gene with unknown function respectively. Bf Chr16 is not homologous with Chr3 of Bj or Bb.”"]]
updated PO files
diff --git "a/Debian/debi\303\242neries/dreamhost.en.po" "b/Debian/debi\303\242neries/dreamhost.en.po" index 414ac52e..101ff943 100644 --- "a/Debian/debi\303\242neries/dreamhost.en.po" +++ "b/Debian/debi\303\242neries/dreamhost.en.po" @@ -7,7 +7,7 @@ msgid "" msgstr "" "Project-Id-Version: PACKAGE VERSION\n" -"POT-Creation-Date: 2023-03-09 13:38+0000\n" +"POT-Creation-Date: 2023-03-10 03:07+0000\n" "PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n" "Last-Translator: FULL NAME <EMAIL@ADDRESS>\n" "Language-Team: LANGUAGE <LL@li.org>\n" @@ -36,6 +36,15 @@ msgstr "" msgid "[[!meta title=\"If you work at Dreamhost, can you help us?\"]]\n" msgstr "" +#. type: Plain text +#, no-wrap +msgid "" +"***Update: thanks to the very kind involvment of the widow of our wemaster, we\n" +"could provide enough private information to Dreamhost, who finally accepted to\n" +"reset the password and the MFA. We have recovered evrything! Many thanks to\n" +"everybody who helped us!***\n" +msgstr "" + #. type: Plain text msgid "" "Due to tragic circumstances, one association that I am part of, "
Bonne nouvelle.
diff --git "a/Debian/debi\303\242neries/dreamhost.mdwn" "b/Debian/debi\303\242neries/dreamhost.mdwn" index f4e52e6d..bddf20cc 100644 --- "a/Debian/debi\303\242neries/dreamhost.mdwn" +++ "b/Debian/debi\303\242neries/dreamhost.mdwn" @@ -4,6 +4,11 @@ [[!meta title="If you work at Dreamhost, can you help us?"]] +***Update: thanks to the very kind involvment of the widow of our wemaster, we +could provide enough private information to Dreamhost, who finally accepted to +reset the password and the MFA. We have recovered evrything! Many thanks to +everybody who helped us!*** + Due to tragic circumstances, one association that I am part of, [Sciencescope](https://www.sciencescope.org) got locked out of its account at Dreamhost. Locked out, we can not pay the annual bill. Dreamhost contacted us
updated PO files
diff --git "a/Debian/debi\303\242neries/dreamhost.en.po" "b/Debian/debi\303\242neries/dreamhost.en.po" new file mode 100644 index 00000000..414ac52e --- /dev/null +++ "b/Debian/debi\303\242neries/dreamhost.en.po" @@ -0,0 +1,68 @@ +# SOME DESCRIPTIVE TITLE +# Copyright (C) YEAR Free Software Foundation, Inc. +# This file is distributed under the same license as the PACKAGE package. +# FIRST AUTHOR <EMAIL@ADDRESS>, YEAR. +# +#, fuzzy +msgid "" +msgstr "" +"Project-Id-Version: PACKAGE VERSION\n" +"POT-Creation-Date: 2023-03-09 13:38+0000\n" +"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n" +"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n" +"Language-Team: LANGUAGE <LL@li.org>\n" +"Language: \n" +"MIME-Version: 1.0\n" +"Content-Type: text/plain; charset=UTF-8\n" +"Content-Transfer-Encoding: 8bit\n" + +#. type: Plain text +#, no-wrap +msgid "[[!meta date=\"Thu, 09 Mar 2023 22:35:00 +0900\"]]\n" +msgstr "" + +#. type: Plain text +#, no-wrap +msgid "[[!meta updated=\"Thu, 09 Mar 2023 22:35:00 +0900\"]]\n" +msgstr "" + +#. type: Plain text +#, no-wrap +msgid "[[!tag Debian]]\n" +msgstr "" + +#. type: Plain text +#, no-wrap +msgid "[[!meta title=\"If you work at Dreamhost, can you help us?\"]]\n" +msgstr "" + +#. type: Plain text +msgid "" +"Due to tragic circumstances, one association that I am part of, " +"[Sciencescope](https://www.sciencescope.org) got locked out of its account " +"at Dreamhost. Locked out, we can not pay the annual bill. Dreamhost " +"contacted us about the payment, but will not let us recover the access to " +"our account in order to pay. So they will soon close the account. Our " +"website, mailing lists and archives, will be erased. We provided plenty of " +"evidence that we are not scammers and that we are the legitimate owners of " +"the account, but reviewing it is above the pay grade of the custommer " +"support (I don't blame them) and I could not convince them to let somebody " +"higher have a look at our case." +msgstr "" + +#. type: Plain text +msgid "" +"If you work at Dreamhost and want to keep us as custommers instead of " +"kicking us like that, please ask the support service in charge of ticket " +"225948648 to send the recovery URL to the _secondary_ email adddresses (the " +"ones you used to contact us about the bill!) in addition to the _primary_ " +"one (which nobody will read anymore). You can encrypt it for my Debian " +"Developer key 73471499CC60ED9EEE805946C5BD6C8F2295D502 if you worry it gets " +"in wrong hands. If you still have doubts I am available for calls any time." +msgstr "" + +#. type: Plain text +msgid "" +"If you know somebody working at Dreamhost can you pass them the message? " +"This would be a big, big, relief for our non-profit association." +msgstr ""
help
diff --git "a/Debian/debi\303\242neries/dreamhost.mdwn" "b/Debian/debi\303\242neries/dreamhost.mdwn" new file mode 100644 index 00000000..f4e52e6d --- /dev/null +++ "b/Debian/debi\303\242neries/dreamhost.mdwn" @@ -0,0 +1,26 @@ +[[!meta date="Thu, 09 Mar 2023 22:35:00 +0900"]] +[[!meta updated="Thu, 09 Mar 2023 22:35:00 +0900"]] +[[!tag Debian]] + +[[!meta title="If you work at Dreamhost, can you help us?"]] + +Due to tragic circumstances, one association that I am part of, +[Sciencescope](https://www.sciencescope.org) got locked out of its account at +Dreamhost. Locked out, we can not pay the annual bill. Dreamhost contacted us +about the payment, but will not let us recover the access to our account in +order to pay. So they will soon close the account. Our website, mailing lists +and archives, will be erased. We provided plenty of evidence that we are not +scammers and that we are the legitimate owners of the account, but reviewing it +is above the pay grade of the custommer support (I don't blame them) and I +could not convince them to let somebody higher have a look at our case. + +If you work at Dreamhost and want to keep us as custommers instead of kicking +us like that, please ask the support service in charge of ticket 225948648 to +send the recovery URL to the _secondary_ email adddresses (the ones you used to +contact us about the bill!) in addition to the _primary_ one (which nobody will +read anymore). You can encrypt it for my Debian Developer key +73471499CC60ED9EEE805946C5BD6C8F2295D502 if you worry it gets in wrong hands. +If you still have doubts I am available for calls any time. + +If you know somebody working at Dreamhost can you pass them the message? +This would be a big, big, relief for our non-profit association.
Hello DreamHost
diff --git a/dh.txt b/dh.txt new file mode 100644 index 00000000..e02faf22 --- /dev/null +++ b/dh.txt @@ -0,0 +1,21 @@ +-----BEGIN PGP SIGNED MESSAGE----- +Hash: SHA512 + +Hello DreahHost Customer Service I am Charles Plessy and we are discussing in the email thread 226139527 + +-----BEGIN PGP SIGNATURE----- + +iQIzBAEBCgAdFiEEc0cUmcxg7Z7ugFlGxb1sjyKV1QIFAmPwFvMACgkQxb1sjyKV +1QImoRAAob7ZPH9T3/AG6p96RSulnOXfCxEcq7rDc3pFZdgIgsI9e0od0CFIlUtT +Dnbwycgd+RFOwk+VeEbj0eWAFb4PBEZO1G3X4YEiQDLVv5aNsLEdenNC9+H0x6XT +NigFIHTILvHwpcdtUfOHnUZe+1vwo8DsZHNrc3FQ3uOrygcDvzzXdmQY1blRpq37 +uCtuhyBHBV5mJL+QQ9109xCaa+m8edZKAxIk2egXndJo+dVX/iSAJ7IOshFQwE+4 +9+8l5gDAHxmk0pB9/Wu5J5IAlX+fZ2bjqSRZK+GvfxNjnoEZyUtWVZ1YF5iKKiq0 +0862YnDBrR9ajRtCVskiZ3ML6ySujbo8gnMYBe36JqyhtZNbEM2DvQtdCzac47Ep +CSmFR7mYO3vidH8ETqKiMPAErq27lAaYzdq7MWwWaLVxqu/w0b6D7+Npc9d1lx52 +j4Qv693SVLU9GvYxHZZ0HJWSmYIPMR13ldXOR8t/88M7ANQ2tGDYG1cVIqMwl7OH +88WUrJ8aBnZPwi2lq5Up956wFg7JQqtb/O8S7SS9LumXZJAXC4qOfN2AsDkoxEr/ +aVqtKLNJBPky7kn1o21dbUpilz70jjoU46KFZIe//njwsnebqq+bB/Y4HDlXxBKz +cX9jlPji2MCqg7LfH/5rJAeCKhtCBXyF4EdyxJsU87TlE+uKikw= +=WBtm +-----END PGP SIGNATURE-----
Café
diff --git a/biblio/21685081.mdwn b/biblio/21685081.mdwn
new file mode 100644
index 00000000..3a9ffeb7
--- /dev/null
+++ b/biblio/21685081.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="PhyloCSF: a comparative genomics method to distinguish protein coding and non-coding regions."]]
+[[!tag genome alignment]]
+
+Lin MF, Jungreis I, Kellis M.
+
+Bioinformatics. 2011 Jul 1;27(13):i275-82. doi: 10.1093/bioinformatics/btr209
+
+PhyloCSF: a comparative genomics method to distinguish protein coding and non-coding regions.
+
+[[!pmid 21685081 desc="Classifies coding and non-coding regions using multiple genome sequence alignments and the fit with separate codon score matrices for coding an non-coding."]]
diff --git a/tags/alignment.mdwn b/tags/alignment.mdwn
index 89b1ef03..b98b01be 100644
--- a/tags/alignment.mdwn
+++ b/tags/alignment.mdwn
@@ -21,4 +21,8 @@ see [[LAST]] for a detailed bibliography.
an iterative approach where ancestral genomes are reconstituted using 2-5 pairs
of in- and out-group comparisons, and then progressively aligned to each other.
+## Consumers of multiple genome sequence alignments
+
+ - PhyloCSF ([[Lin, Jungreis and Kellis (2011)|biblio/21685081]]).
+
[[!inline pages="tagged(alignment)" limit=0]]
Café
diff --git a/biblio/34853330.mdwn b/biblio/34853330.mdwn
new file mode 100644
index 00000000..f7aec4dd
--- /dev/null
+++ b/biblio/34853330.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Metabarcoding analysis of trophic sources and linkages in the plankton community of the Kuroshio and neighboring waters."]]
+[[!tag eDNA]]
+
+Kobari T, Tokumo Y, Sato I, Kume G, Hirai J.
+
+Sci Rep. 2021 Dec 1;11(1):23265 doi:10.1038/s41598-021-02083-8
+
+Metabarcoding analysis of trophic sources and linkages in the plankton community of the Kuroshio and neighboring waters.
+
+[[!pmid 34853330 desc="eDNA analysis of “the diets of 22 higher taxonomic groups, 13 copepod families and 35 species, that dominate in the Kuroshio food web”. Larvacean DNA was more frequent in predator gut contents than in water samples. “The 18S rRNA V9 region was amplified using eukaryotic universal primers 1389F and 1510R.”"]]
diff --git a/tags/eDNA.mdwn b/tags/eDNA.mdwn
index 3aa11f94..f284280c 100644
--- a/tags/eDNA.mdwn
+++ b/tags/eDNA.mdwn
@@ -16,6 +16,9 @@
- Edgar ([[2018|biblio/29506021]] proposes to raise the threshold to 99% or to
just use sequence variants (also called ZOTUS, Zero-radius OTUs.
+ - Larvacean DNA found more frequently in predator gut than in water samples
+ ([[Kobari and coll., 2021|biblio/34853330]]). Uses the V9 region 18S primers.
+
### Published primers
```
Details on mechanism.
diff --git a/tags/variants.mdwn b/tags/variants.mdwn index 65fbf91b..222faccd 100644 --- a/tags/variants.mdwn +++ b/tags/variants.mdwn @@ -51,6 +51,9 @@ Flanking an inversion in _D. buzzati_ between two _Galileo_ elements, the exchange of Target-Site Duplication sequences was observed by Cáceres and coll., [[(1999|biblio/10411506]]). +Ectopic recombination of a Galileo element may have caused a recent large-scale +inversion in _D. buzzati_ ([[Delprat and coll, 2009|biblio/19936241]]). + [[Kent and coll., 2003|biblio/14500911]] reported 2 inversions per Mbp in human/mouse comparisons, median length 814. @@ -60,8 +63,11 @@ _Staggered breaks_ ([[Ranz and coll., 2007|bilbio/17550304]]) caused by inverted duplications. The duplicated sequnces may be coding genes or pseudogenes, not just transposable elements. -Ectopic recombination of a Galileo element may have caused a recent large-scale -inversion in _D. buzzati_ ([[Delprat and coll, 2009|biblio/19936241]]). +([[Delprat and coll, 2009|biblio/19936241]]) proposed that “Chromosomal +inversions may be generated by transposons when two ends that are not part of +the same transposon participate in an aberrant transposition event to a new +site”. They give an example where the two transposons are identical copies +on sister chromatids in G2 phase. ## Software
Reorganise avec du café
diff --git a/tags/variants.mdwn b/tags/variants.mdwn
index dc41893b..65fbf91b 100644
--- a/tags/variants.mdwn
+++ b/tags/variants.mdwn
@@ -5,7 +5,9 @@ _in progress_
Long read sequencing data from 3,622 Icelanders identified a median of 22,636
SVs per individual (insertios: 13,353; deletions: 9,474) [[Beyter and coll, 2021|biblio/33972781]].
-### Inversions
+## Inversions
+
+### Within-population
SNP analysis in >1400 seaweed flies identified known and candidate genomic inversions
([[Mérot and coll, 2021|biblio/33963409]]).
@@ -14,6 +16,15 @@ SV analysis of 31 diploid assemblies of _Theobroma cacao_ showed relaxed
selection and increased genetic load in inversions and other types of variants
[[Hämälä and coll., 2021|biblio/34408075]].
+[[Stefansson and coll, 2005||biblio/15654335]] found an inversion in the human
+genome and calculated that it appeared ~3 million years ago, before the
+speciation of _Homo sapiens_. Low-copy repeated sequences were found in the
+vicinity. [[Donelly and coll., 2010|biblio/20116045]] gave a radically lower
+time estimate of 13,600 to 108,400 years, but an ancient origin was again
+supported by [[Steinberg and coll in 2012|biblio/22751100]].
+
+### Between-species
+
~1100 small-scale inversions are estimated to have happened between _S.
cerevisiae_ and _C. albicans_ ([[Seoighe and coll., 2000|biblio/11087826]]). The authors propose that
“successive multigene inversions” have “distrupted” the “precise arrangement”
@@ -36,16 +47,6 @@ isochromatid or chromatid, and that this, rather than ectopic exchange between
inverted repetitive sequences, is the prevalent mechanism for the generation of
inversions in the melanogaster species group”.
-[[Stefansson and coll, 2005||biblio/15654335]] found an inversion in the human
-genome and calculated that it appeared ~3 million years ago, before the
-speciation of _Homo sapiens_. Low-copy repeated sequences were found in the
-vicinity. [[Donelly and coll., 2010|biblio/20116045]] gave a radically lower
-time estimate of 13,600 to 108,400 years, but an ancient origin was again
-supported by [[Steinberg and coll in 2012|biblio/22751100]].
-
-Ectopic recombination of a Galileo element may have caused a recent large-scale
-inversion in _D. buzzati_ ([[Delprat and coll, 2009|biblio/19936241]]).
-
Flanking an inversion in _D. buzzati_ between two _Galileo_ elements, the
exchange of Target-Site Duplication sequences was observed by Cáceres and
coll., [[(1999|biblio/10411506]]).
@@ -53,7 +54,16 @@ coll., [[(1999|biblio/10411506]]).
[[Kent and coll., 2003|biblio/14500911]] reported 2 inversions per Mbp in
human/mouse comparisons, median length 814.
-### Software
+### Mechanism
+
+_Staggered breaks_ ([[Ranz and coll., 2007|bilbio/17550304]]) caused
+by inverted duplications. The duplicated sequnces may be coding genes or
+pseudogenes, not just transposable elements.
+
+Ectopic recombination of a Galileo element may have caused a recent large-scale
+inversion in _D. buzzati_ ([[Delprat and coll, 2009|biblio/19936241]]).
+
+## Software
- _NanoSV_ ([[Cretu Stancu and coll., 2017|biblio/29109544]]) uses nanopore long
reads aligned to a reference genome with last-split
Café
diff --git a/biblio/17550304.mdwn b/biblio/17550304.mdwn new file mode 100644 index 00000000..c208753a --- /dev/null +++ b/biblio/17550304.mdwn @@ -0,0 +1,10 @@ +[[!meta title="Principles of genome evolution in the Drosophila melanogaster species group."]] +[[!tag variants Drosophila]] + +Ranz JM, Maurin D, Chan YS, von Grotthuss M, Hillier LW, Roote J, Ashburner M, Bergman CM. + +PLoS Biol. 2007 Jun;5(6):e152. doi:10.1371/journal.pbio.0050152 + +Principles of genome evolution in the Drosophila melanogaster species group. + +[[!pmid 17550304 desc="“the breakpoint regions of 59% of the inversions (17/29) are associated with inverted duplications of genes or other nonrepetitive sequences” “We propose that the presence of inverted duplications associated with inversion breakpoint regions is the result of staggered breaks, either isochromatid or chromatid, and that this, rather than ectopic exchange between inverted repetitive sequences, is the prevalent mechanism for the generation of inversions in the melanogaster species group” “The overall rate of breakage in the _D. melanogaster_ / _D. yakuba_ lineage is 0.0183/Mb/Myr.”"]] diff --git a/tags/variants.mdwn b/tags/variants.mdwn index 5bdf6ae5..dc41893b 100644 --- a/tags/variants.mdwn +++ b/tags/variants.mdwn @@ -28,6 +28,14 @@ In the _Drosophila pseudoobscura / persimilis_ species complex, chromosomal inve suppress crossovers not only inside the inversion but also close to it (within 1–2 Mb)” ([[Machado, Haselkorn and Noor (2007)|biblio/17179068])]. +The overall rate of breakage in the _D. melanogaster_ / _D. yakuba_ lineage +calculated by ([[Ranz and coll., 2007|bilbio/17550304]]) is 0.0183/Mb/Myr. The +authors “propose that the presence of inverted duplications associated with +inversion breakpoint regions is the result of staggered breaks, either +isochromatid or chromatid, and that this, rather than ectopic exchange between +inverted repetitive sequences, is the prevalent mechanism for the generation of +inversions in the melanogaster species group”. + [[Stefansson and coll, 2005||biblio/15654335]] found an inversion in the human genome and calculated that it appeared ~3 million years ago, before the speciation of _Homo sapiens_. Low-copy repeated sequences were found in the
DNA methylation genes
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 29e4869a..475eb22c 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -268,6 +268,8 @@ Genes and pathways
[[Albalat, Martí-Solans and Cañestro, 2012|biblio/22389042]]).
It has Dnmt2, but this is a tRNA methyltransferase and it was later renamed Trdmt1 accordingly.
[[Jurkowski and Jeltsch (2011)|bilbio/22140515]] did not find Dnmt2 in O. dioica.
+ - _O. dioica_ lost CDCA7, HELLS, UHRF1 and other genes related to DNA methylation
+ ([[Funabiki and coll., 2023|biblio/10.1101_2023.01.30.526367v1]]).
- CYP1 family genes and their regulator AhR are not detectable
([[Yadetie et al, 2012|biblio/22300585]]).
- No olfactory receptors have been found in _Oikopleura_ nor in _Ciona_
good morning
diff --git a/biblio/10.1101_2023.01.30.526367v1.mdwn b/biblio/10.1101_2023.01.30.526367v1.mdwn new file mode 100644 index 00000000..7931c3f3 --- /dev/null +++ b/biblio/10.1101_2023.01.30.526367v1.mdwn @@ -0,0 +1,10 @@ +[[!meta title="Coevolution of the CDCA7-HELLS ICF-related nucleosome remodeling complex and DNA methyltransferases"]] +[[!tag Oikopleura]] + +Hironori Funabiki, Isabel E. Wassing, Qingyuan Jia, Ji-Dung Luo, Thomas Carroll + +bioRxiv 2023.01.30.526367 doi:10.1101/2023.01.30.526367 + +Coevolution of the CDCA7-HELLS ICF-related nucleosome remodeling complex and DNA methyltransferases + +[[!doi 10.1101/2023.01.30.526367v1 desc="In addition to DNA methyltransferases, _Oikopleura dioica_ has also lost “SNF2 family ATPase HELLS” and “its activator subunit CDCA7”, as well as the DNMT1 activator UHRF1."]]
Café
diff --git a/biblio/10411506.mdwn b/biblio/10411506.mdwn new file mode 100644 index 00000000..01e4b47a --- /dev/null +++ b/biblio/10411506.mdwn @@ -0,0 +1,10 @@ +[[!meta title="Generation of a widespread Drosophila inversion by a transposable element."]] +[[!tag variants]] + +Cáceres M, Ranz JM, Barbadilla A, Long M, Ruiz A. + +Science. 1999 Jul 16;285(5426):415-8. doi:10.1126/science.285.5426.415 + +Generation of a widespread Drosophila inversion by a transposable element. + +[[!pmid 10411506 desc="Target Site Duplication (TSD) sites were exchanged through the recombination of two transposons inserted in opposite directions."]] diff --git a/tags/variants.mdwn b/tags/variants.mdwn index 5562a25e..5bdf6ae5 100644 --- a/tags/variants.mdwn +++ b/tags/variants.mdwn @@ -38,6 +38,10 @@ supported by [[Steinberg and coll in 2012|biblio/22751100]]. Ectopic recombination of a Galileo element may have caused a recent large-scale inversion in _D. buzzati_ ([[Delprat and coll, 2009|biblio/19936241]]). +Flanking an inversion in _D. buzzati_ between two _Galileo_ elements, the +exchange of Target-Site Duplication sequences was observed by Cáceres and +coll., [[(1999|biblio/10411506]]). + [[Kent and coll., 2003|biblio/14500911]] reported 2 inversions per Mbp in human/mouse comparisons, median length 814.
Mention AXTCHAIN
diff --git a/tags/alignment.mdwn b/tags/alignment.mdwn index 6e7a6619..89b1ef03 100644 --- a/tags/alignment.mdwn +++ b/tags/alignment.mdwn @@ -2,6 +2,11 @@ _Work in progress_ +## Chains and nets + +Kent and coll. ([[2003|biblio/14500911]]) computed _chained alignments_ with +the AXTCHAIN program. + ## LAST see [[LAST]] for a detailed bibliography.
progressive cactus
diff --git a/biblio/33177663.mdwn b/biblio/33177663.mdwn
new file mode 100644
index 00000000..a709cf61
--- /dev/null
+++ b/biblio/33177663.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Progressive Cactus is a multiple-genome aligner for the thousand-genome era."]]
+[[!tag genome alignment]]
+
+Armstrong J, Hickey G, Diekhans M, Fiddes IT, Novak AM, Deran A, Fang Q, Xie D, Feng S, Stiller J, Genereux D, Johnson J, Marinescu VD, Alföldi J, Harris RS, Lindblad-Toh K, Haussler D, Karlsson E, Jarvis ED, Zhang G, Paten B.
+
+Nature. 2020 Nov;587(7833):246-251. doi: 10.1038/s41586-020-2871-y
+
+Progressive Cactus is a multiple-genome aligner for the thousand-genome era
+
+[[!pmid 33177663 desc="Aligns with cactus 2~5 genomes, in- and out-group, and reconstitutes an ancestral genome. Recurses the phylogenetic tree progressively. A ‘best-hit-filtering’ step is added to catch duplications that are not seen in the outgroups. Also runs a step ‘removing recoverable chains’ to allow for corrections and mitigate error propagation. Aligning 600 amniotes took ~2 months."]]
diff --git a/tags/alignment.mdwn b/tags/alignment.mdwn
index 2bbe4c8b..6e7a6619 100644
--- a/tags/alignment.mdwn
+++ b/tags/alignment.mdwn
@@ -8,8 +8,12 @@ see [[LAST]] for a detailed bibliography.
## Cactus
- - Paten and coll, ([[March 2011|biblio/21385048]]) describe _cactus_ graphs
+ - Paten and coll., ([[March 2011|biblio/21385048]]) describe _cactus_ graphs
where nodes are sets of adjascencies and edges are aligned blocks of
sequences. A genome can be represented as path in these graphs.
+ - Armstrong and coll. ([[2020|biblio/33177663]]) describe _progressive cactus_,
+ an iterative approach where ancestral genomes are reconstituted using 2-5 pairs
+ of in- and out-group comparisons, and then progressively aligned to each other.
+
[[!inline pages="tagged(alignment)" limit=0]]
Re-fix
diff --git a/biblio/34934012.mdwn b/biblio/34934012.mdwn index 31d7f286..08757e06 100644 --- a/biblio/34934012.mdwn +++ b/biblio/34934012.mdwn @@ -7,4 +7,4 @@ Proc Natl Acad Sci U S A. 2022 Jan 4;119(1):e2113075119. doi:10.1073/pnas.211307 AnchorWave: Sensitive alignment of genomes with high sequence diversity, extensive structural polymorphism, and whole-genome duplication. -[[!pmid 34934012 desc="Maps a transcriptome to its reference genome. 2) Extracts "anchor" coding sequences. 3) Searches for homologous sequences in the query genome. 4) Realigns the sequences between homologous anchors. The so-called comparison to LAST is actually a comparison with LAST + AxtChain, that is: it does not use last-split."]] +[[!pmid 34934012 desc="Maps a transcriptome to its reference genome. 2) Extracts “anchor” coding sequences. 3) Searches for homologous sequences in the query genome. 4) Realigns the sequences between homologous anchors. The so-called comparison to LAST is actually a comparison with LAST + AxtChain, that is: it does not use last-split."]]
Fix
diff --git a/biblio/34934012.mdwn b/biblio/34934012.mdwn index cdbb799c..31d7f286 100644 --- a/biblio/34934012.mdwn +++ b/biblio/34934012.mdwn @@ -7,4 +7,4 @@ Proc Natl Acad Sci U S A. 2022 Jan 4;119(1):e2113075119. doi:10.1073/pnas.211307 AnchorWave: Sensitive alignment of genomes with high sequence diversity, extensive structural polymorphism, and whole-genome duplication. -[[!pmid desc=""1) Maps a transcriptome to its reference genome. 2) Extracts "anchor" coding sequences. 3) Searches for homologous sequences in the query genome. 4) Realigns the sequences between homologous anchors. The so-called comparison to LAST is actually a comparison with LAST + AxtChain, that is: it does not use last-split.]] +[[!pmid 34934012 desc="Maps a transcriptome to its reference genome. 2) Extracts "anchor" coding sequences. 3) Searches for homologous sequences in the query genome. 4) Realigns the sequences between homologous anchors. The so-called comparison to LAST is actually a comparison with LAST + AxtChain, that is: it does not use last-split."]]
Cactus
diff --git a/biblio/21385048.mdwn b/biblio/21385048.mdwn new file mode 100644 index 00000000..77e98664 --- /dev/null +++ b/biblio/21385048.mdwn @@ -0,0 +1,13 @@ +[[!meta title="Cactus graphs for genome comparisons."]] +[[!tag genome alignment]] + +Paten B, Diekhans M, Earl D, John JS, Ma J, Suh B, Haussler D. + +J Comput Biol. 2011 Mar;18(3):469-81. doi: 10.1089/cmb.2010.0252 + +Cactus graphs for genome comparisons. + +[[!pmid 21385048 desc="Alignments are transformed in sequence graphs where +nodes are connected by either alignment blocks or adjascencies between blocks, +and this graph is progressively transformed in a cactus graph where the nodes +are sets of adjascencies connected together without crossing a block."]] diff --git a/tags/alignment.mdwn b/tags/alignment.mdwn index 795e5919..2bbe4c8b 100644 --- a/tags/alignment.mdwn +++ b/tags/alignment.mdwn @@ -1,4 +1,15 @@ [[!meta title="pages tagged alignment"]] -[[!inline pages="tagged(alignment)" actions="no" archive="yes" -feedshow=10]] +_Work in progress_ + +## LAST + +see [[LAST]] for a detailed bibliography. + +## Cactus + + - Paten and coll, ([[March 2011|biblio/21385048]]) describe _cactus_ graphs + where nodes are sets of adjascencies and edges are aligned blocks of + sequences. A genome can be represented as path in these graphs. + +[[!inline pages="tagged(alignment)" limit=0]]
Merge branch 'master' of ssh://charles-plessy-org.branchable.com
Work In Progress from last year.
diff --git a/biblio/20331767.mdwn b/biblio/20331767.mdwn new file mode 100644 index 00000000..6782ce0a --- /dev/null +++ b/biblio/20331767.mdwn @@ -0,0 +1,10 @@ +[[!meta title="Multiple marker parallel tag environmental DNA sequencing reveals a highly complex eukaryotic community in marine anoxic water."]] +[[!tag eDNA]] + +Stoeck T, Bass D, Nebel M, Christen R, Jones MD, Breiner HW, Richards TA + +Mol Ecol. 2010 Mar;19 Suppl 1:21-31. doi:10.1111/j.1365-294X.2009.04480.x + +Multiple marker parallel tag environmental DNA sequencing reveals a highly complex eukaryotic community in marine anoxic water. + +[[!pmid 20331767 desc="The TAReuk454FWD1–TAReukREV3 pair (V4) detected more unique tags than the 1391F–EukB pair (V9)."]] diff --git a/tags/eDNA.mdwn b/tags/eDNA.mdwn index f15996b4..5b46ea4f 100644 --- a/tags/eDNA.mdwn +++ b/tags/eDNA.mdwn @@ -11,6 +11,8 @@ - A Nextflow pipeline: eDNAFlow [[Mousavi‐Derazmahalleh and coll., 2021|biblio/10.1111_1755-0998.13356]]. + - Universal or eukaryote-biased 18S primers targetting the V9 hypervariable region: [[Amaral-Zettler|biblio/19633714]] + ### Published primers ``` @@ -22,11 +24,25 @@ GGAGCTGGAATTACCGC CCCTGCCHTTTGTACACAC >18S_1389F universal 10.1371/journal.pone.0006372 TTGTACACACCGCCC +>18S_1391F 10.1111/j.1365-294X.2009.04480.x (Lane 1991), S. cerevisiae NCBI GenBank nucleotide database accession # U53879 position 1629-1644) +GTACACACCGCCCGTC +>EukB 10.1111/j.1365-294X.2009.04480.x (Medlin et al. 1988), S. cerevisiae position 1774-1797). +TGATCCTTCTGCAGGTTCACCTAC >18S_1510R eukaryotic 10.1371/journal.pone.0006372 CCTTCYGCAGGTTCACCTAC ``` https://doi.org/10.1371/journal.pone.0073935 + +V4 +``` +>TAReuk454FWD1 (S. cerevisiae position 565-584) +CCAGCA(G/C)C(C/T)GCGGTAATTCC +>TAReukREV3 (S. cerevisiae position 964-981) +ACTTTCGTTCTTGATYRA +``` + + ``` >UroCox1-244 F 10.2108/zsj.26.564 CATTTWTTTTGATTWTTTRGWCATCCNGA
mdwn
diff --git "a/Debian/debi\303\242neries/markdown.en.po" "b/Debian/debi\303\242neries/markdown.en.po" index 4e96336f..40808c68 100644 --- "a/Debian/debi\303\242neries/markdown.en.po" +++ "b/Debian/debi\303\242neries/markdown.en.po" @@ -3,40 +3,38 @@ # This file is distributed under the same license as the PACKAGE package. # FIRST AUTHOR <EMAIL@ADDRESS>, YEAR. # -#, fuzzy msgid "" msgstr "" -"Project-Id-Version: PACKAGE VERSION\n" +"Project-Id-Version: \n" "POT-Creation-Date: 2023-01-08 00:53+0000\n" -"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n" -"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n" -"Language-Team: LANGUAGE <LL@li.org>\n" -"Language: \n" +"PO-Revision-Date: 2023-01-08 09:59+0900\n" +"Language: en\n" "MIME-Version: 1.0\n" "Content-Type: text/plain; charset=UTF-8\n" "Content-Transfer-Encoding: 8bit\n" +"Last-Translator: \n" +"Language-Team: \n" +"X-Generator: Poedit 2.4.2\n" #. type: Plain text #, no-wrap msgid "[[!meta date=\"Sun, 08 Jan 2023 09:18:53 +0900\"]]\n" -msgstr "" +msgstr "[[!meta date=\"Sun, 08 Jan 2023 09:18:53 +0900\"]]\n" #. type: Plain text #, no-wrap msgid "[[!meta updated=\"Sun, 08 Jan 2023 09:18:53 +0900\"]]\n" -msgstr "" +msgstr "[[!meta updated=\"Sun, 08 Jan 2023 09:18:53 +0900\"]]\n" #. type: Plain text #, no-wrap msgid "[[!tag Debian]]\n" -msgstr "" +msgstr "[[!tag Debian]]\n" #. type: Plain text #, no-wrap -msgid "" -"[[!meta title=\"Quelqu'un pourrait-il patcher Firefox pour afficher du " -"Markdown ?\"]]\n" -msgstr "" +msgid "[[!meta title=\"Quelqu'un pourrait-il patcher Firefox pour afficher du Markdown ?\"]]\n" +msgstr "[[!meta title=\"Could somebody patch Firefox to display Markdown files?\"]]\n" #. type: Plain text msgid "" @@ -45,7 +43,11 @@ msgid "" "comme un fichier texte. Dans le ticket [1319262](), il est proposé " "d'afficher les fichiers Markdown par défaut. Mais il faudrait un patch…" msgstr "" +"When Firefox receives a file with media type _text/markdown_, it prompts " +"the user to download it, while other browsers display it as plain text. " +"In the ticket [1319262](), it is proposed to display Markdown files by " +"default, but there needs a patch…" #. type: Plain text msgid "[1319262]: https://bugzilla.mozilla.org/show_bug.cgi?id=1319262" -msgstr "" +msgstr "[1319262]: https://bugzilla.mozilla.org/show_bug.cgi?id=1319262"
updated PO files
diff --git "a/Debian/debi\303\242neries/markdown.en.po" "b/Debian/debi\303\242neries/markdown.en.po" new file mode 100644 index 00000000..4e96336f --- /dev/null +++ "b/Debian/debi\303\242neries/markdown.en.po" @@ -0,0 +1,51 @@ +# SOME DESCRIPTIVE TITLE +# Copyright (C) YEAR Free Software Foundation, Inc. +# This file is distributed under the same license as the PACKAGE package. +# FIRST AUTHOR <EMAIL@ADDRESS>, YEAR. +# +#, fuzzy +msgid "" +msgstr "" +"Project-Id-Version: PACKAGE VERSION\n" +"POT-Creation-Date: 2023-01-08 00:53+0000\n" +"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n" +"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n" +"Language-Team: LANGUAGE <LL@li.org>\n" +"Language: \n" +"MIME-Version: 1.0\n" +"Content-Type: text/plain; charset=UTF-8\n" +"Content-Transfer-Encoding: 8bit\n" + +#. type: Plain text +#, no-wrap +msgid "[[!meta date=\"Sun, 08 Jan 2023 09:18:53 +0900\"]]\n" +msgstr "" + +#. type: Plain text +#, no-wrap +msgid "[[!meta updated=\"Sun, 08 Jan 2023 09:18:53 +0900\"]]\n" +msgstr "" + +#. type: Plain text +#, no-wrap +msgid "[[!tag Debian]]\n" +msgstr "" + +#. type: Plain text +#, no-wrap +msgid "" +"[[!meta title=\"Quelqu'un pourrait-il patcher Firefox pour afficher du " +"Markdown ?\"]]\n" +msgstr "" + +#. type: Plain text +msgid "" +"Quand Firefox reçoit un fichier dont le type média est _text/markdown_, il " +"le propose au téléchargement, alors que les autres navigateurs l'affichent " +"comme un fichier texte. Dans le ticket [1319262](), il est proposé " +"d'afficher les fichiers Markdown par défaut. Mais il faudrait un patch…" +msgstr "" + +#. type: Plain text +msgid "[1319262]: https://bugzilla.mozilla.org/show_bug.cgi?id=1319262" +msgstr ""
Mdwn
diff --git "a/Debian/debi\303\242neries/markdown.mdwn" "b/Debian/debi\303\242neries/markdown.mdwn" new file mode 100644 index 00000000..7bd4cc65 --- /dev/null +++ "b/Debian/debi\303\242neries/markdown.mdwn" @@ -0,0 +1,12 @@ +[[!meta date="Sun, 08 Jan 2023 09:18:53 +0900"]] +[[!meta updated="Sun, 08 Jan 2023 09:18:53 +0900"]] +[[!tag Debian]] + +[[!meta title="Quelqu'un pourrait-il patcher Firefox pour afficher du Markdown ?"]] + +Quand Firefox reçoit un fichier dont le type média est _text/markdown_, il le +propose au téléchargement, alors que les autres navigateurs l'affichent comme +un fichier texte. Dans le ticket [1319262](), il est proposé d'afficher les +fichiers Markdown par défaut. Mais il faudrait un patch… + +[1319262]: https://bugzilla.mozilla.org/show_bug.cgi?id=1319262
Café
diff --git a/biblio/5456129.mdwn b/biblio/5456129.mdwn index 104086ee..f5899b0a 100644 --- a/biblio/5456129.mdwn +++ b/biblio/5456129.mdwn @@ -1,5 +1,5 @@ [[!meta title="The diagram, a method for comparing sequences. Its use with amino acid and nucleotide sequences."]] -[[!tag software method alignment]] +[[!tag Oxford_plot]] Gibbs AJ, McIntyre GA. diff --git a/tags/Oxford_plot.mdwn b/tags/Oxford_plot.mdwn index 39072e90..10e755e8 100644 --- a/tags/Oxford_plot.mdwn +++ b/tags/Oxford_plot.mdwn @@ -1,4 +1,19 @@ [[!meta title="pages tagged Oxford plot"]] -[[!inline pages="tagged(Oxford_plot)" actions="no" archive="yes" -feedshow=10]] +## Why are the dot-plots of sequence comparisons also called “Oxford” plots? + +*work in progress* + +Wikipedia credits [[Gibbs and McIntyre (1970)|biblio/5456129]] for the +invention of dot-plot graphs to compare two biological sequences. Gibbs and +McIntyre are from the University of Canberra, but the dot-plots are sometimes +called “Oxford” plots or grids. Is Wikipedia missing a reference? I screened +the papers citing Gibbs and McIntyre, and found that [[Maize and Lenk +(1981)]|biblio/6801656]], from the NIH, also cite other papers: 1) [[Tinoco, +Uhlenbeck and Levine (1971)|biblio/4927725]] from the University of Berkeley, +that shows a base pairing matrix, 2) Fitch (1969) (PMID 5364927) from the +University of Winsconsin, with no dot plot, and McLachlan (1970) (PMID 5167087) +from the University of Cambridge, with a sequence comparison matrix for +two proteins. + +[[!inline pages="tagged(Oxford_plot)" limit=0]]
creating tag page tags/Oxford_plot
diff --git a/tags/Oxford_plot.mdwn b/tags/Oxford_plot.mdwn new file mode 100644 index 00000000..39072e90 --- /dev/null +++ b/tags/Oxford_plot.mdwn @@ -0,0 +1,4 @@ +[[!meta title="pages tagged Oxford plot"]] + +[[!inline pages="tagged(Oxford_plot)" actions="no" archive="yes" +feedshow=10]]
Café
diff --git a/biblio/4927725.mdwn b/biblio/4927725.mdwn new file mode 100644 index 00000000..c2ab013f --- /dev/null +++ b/biblio/4927725.mdwn @@ -0,0 +1,10 @@ +[[!meta title="Estimation of secondary structure in ribonucleic acids."]] +[[!tag Oxford_plot]] + +Tinoco I Jr, Uhlenbeck OC, Levine MD. + +Nature. 1971 Apr 9;230(5293):362-7. doi:10.1038/230362a0 + +Estimation of secondary structure in ribonucleic acids. + +[[!pmid 4927725 desc="The base pairing matrix in figure 2 looks like an ”Oxford” plot."]]
Café
diff --git a/biblio/5456129.mdwn b/biblio/5456129.mdwn new file mode 100644 index 00000000..104086ee --- /dev/null +++ b/biblio/5456129.mdwn @@ -0,0 +1,10 @@ +[[!meta title="The diagram, a method for comparing sequences. Its use with amino acid and nucleotide sequences."]] +[[!tag software method alignment]] + +Gibbs AJ, McIntyre GA. + +Eur J Biochem. 1970 Sep;16(1):1-11. doi:10.1111/j.1432-1033.1970.tb01046.x + +The diagram, a method for comparing sequences. Its use with amino acid and nucleotide sequences. + +[[!pmid 5456129 desc="First description of the “Oxford” plot?"]]
en attendant
diff --git a/biblio/29506021.mdwn b/biblio/29506021.mdwn new file mode 100644 index 00000000..e3cb72ad --- /dev/null +++ b/biblio/29506021.mdwn @@ -0,0 +1,10 @@ +[[!meta title="Updating the 97% identity threshold for 16S ribosomal RNA OTUs."]] +[[!tag eDNA]] + +Edgar RC. + +Bioinformatics. 2018 Jul 15;34(14):2371-2375. doi:10.1093/bioinformatics/bty113 + +Updating the 97% identity threshold for 16S ribosomal RNA OTUs. + +[[!pmid 29506021 desc="Following a benchmark on V4 regions of the 16S rRNA, proposes to raise the threshold to 99% or to just use sequence variants (also called ZOTUS, Zero-radius OTUs."]] diff --git a/tags/eDNA.mdwn b/tags/eDNA.mdwn index f15996b4..10df54d7 100644 --- a/tags/eDNA.mdwn +++ b/tags/eDNA.mdwn @@ -11,6 +11,9 @@ - A Nextflow pipeline: eDNAFlow [[Mousavi‐Derazmahalleh and coll., 2021|biblio/10.1111_1755-0998.13356]]. + - Edgar ([[2018|biblio/29506021]] proposes to raise the threshold to 99% or to + just use sequence variants (also called ZOTUS, Zero-radius OTUs. + ### Published primers ```
Café
diff --git a/biblio/31112549.mdwn b/biblio/31112549.mdwn new file mode 100644 index 00000000..7f8e38b9 --- /dev/null +++ b/biblio/31112549.mdwn @@ -0,0 +1,10 @@ +[[!meta title="Extensive loss of cell-cycle and DNA repair genes in an ancient lineage of bipolar budding yeasts."]] +[[!tag yeast repair]] + +Steenwyk JL, Opulente DA, Kominek J, Shen XX, Zhou X, Labella AL, Bradley NP, Eichman BF, Čadež N, Libkind D, DeVirgilio J, Hulfachor AB, Kurtzman CP, Hittinger CT, Rokas A. + +PLoS Biol. 2019 May 21;17(5):e3000255. doi:10.1371/journal.pbio.3000255 + +Extensive loss of cell-cycle and DNA repair genes in an ancient lineage of bipolar budding yeasts. + +[[!pmid 31112549 desc="“Compared to other budding yeasts in the subphylum _Saccharomycotina_, we noticed that a lineage in the genus _Hanseniaspora_ exhibited very high evolutionary rates, low Guanine–Cytosine (GC) content, small genome sizes, and lower gene numbers. [...] Our phylogenomic analyses identify two Hanseniaspora lineages, a faster-evolving lineage (FEL), which began diversifying approximately 87 million years ago (mya), and a slower-evolving lineage (SEL), which began diversifying approximately 54 mya.”"]]
yeast
diff --git a/biblio/36334587.mdwn b/biblio/36334587.mdwn new file mode 100644 index 00000000..58d71954 --- /dev/null +++ b/biblio/36334587.mdwn @@ -0,0 +1,10 @@ +[[!meta title="Contrasting modes of macro and microsynteny evolution in a eukaryotic subphylum."]] +[[!tag yeast synteny]] + +Li Y, Liu H, Steenwyk JL, LaBella AL, Harrison MC, Groenewald M, Zhou X, Shen XX, Zhao T, Hittinger CT, Rokas A. + +Curr Biol. 2022 Dec 19;32(24):5335-5343.e4. doi:10.1016/j.cub.2022.10.025 + +Contrasting modes of macro and microsynteny evolution in a eukaryotic subphylum. + +[[!pmid 36334587 desc="“conservation index is calculated by counting the number of one-to-one orthologous gene pairs whose genes are in homologous chromosomes/scaffolds and dividing it by the number of one-to-one orthologs whose genes reside in non-homologous chromosomes/scaffolds” “we found a faster decay of macrosynteny conservation compared with filamentous fungi and animals, which is corroborated by findings of rapid chromosome structure evolution in budding yeasts” “at the small-scale gene-level of organization, we identified both deeply conserved and lineage-specific instances of conservation of microsynteny across budding yeast genomes.”"]] diff --git a/tags/synteny.mdwn b/tags/synteny.mdwn index bfe0bfdb..d9fd0d0f 100644 --- a/tags/synteny.mdwn +++ b/tags/synteny.mdwn @@ -57,6 +57,9 @@ phenomenon “mesosynteny”. Squid chromosomes still have synteny with scallop, but gene order is scrambled ([[Albertin and coll., 2022|biblio/35508532]]). +At equal evolutionary distance, yeast microsynteny is lower than in animals, +but higher than in plants ([[Li and coll., 2022|biblio/36334587]]). + ### Ancestral karyotpyes - The ancestral mammalian genome has 30 chromosomes ([[Zhou and coll., 2021|biblio/33408411]]).
Café
diff --git a/biblio/35348662.mdwn b/biblio/35348662.mdwn
new file mode 100644
index 00000000..5ad15c7b
--- /dev/null
+++ b/biblio/35348662.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Chromosome-Level Reference Genomes for Two Strains of Caenorhabditis briggsae: An Improved Platform for Comparative Genomics."]]
+[[!tag nematode genome assembly]]
+
+Stevens L, Moya ND, Tanny RE, Gibson SB, Tracey A, Na H, Chitrakar R, Dekker J, Walhout AJM, Baugh LR, Andersen EC.
+
+Genome Biol Evol. 2022 Apr 10;14(4):evac042. doi:10.1093/gbe/evac042
+
+Chromosome-Level Reference Genomes for Two Strains of Caenorhabditis briggsae: An Improved Platform for Comparative Genomics.
+
+[[!pmid 35348662 desc="“the genomes of _C. elegans_ and _C. briggsae_ are more highly rearranged than their outcrossing sister species, _C. inopinata_ and _C. nigoni_ (17.1% of neighboring genes are rearranged in the selfers compared with 15.0% in the outcrossers)”"]]
diff --git a/tags/nematode.mdwn b/tags/nematode.mdwn
index 1d494f1b..001fd69c 100644
--- a/tags/nematode.mdwn
+++ b/tags/nematode.mdwn
@@ -53,4 +53,9 @@
133 kb that are present in germ line but absent in somatic cells ([[de la
Rosa and coll., 2021|biblio/33561231]]).
+ - “the genomes of _C. elegans_ and _C. briggsae_ are more highly rearranged
+ than their outcrossing sister species, _C. inopinata_ and _C. nigoni_ (17.1%
+ of neighboring genes are rearranged in the selfers compared with 15.0% in the
+ outcrossers)” ([[Stevens and coll., 2022|biblio/35348662]]).
+
[[!inline pages="tagged(nematode)" limit=0]]
Café
diff --git a/biblio/33168940.mdwn b/biblio/33168940.mdwn new file mode 100644 index 00000000..9a136950 --- /dev/null +++ b/biblio/33168940.mdwn @@ -0,0 +1,10 @@ +[[!meta title="Genomic and transcriptomic variation defines the chromosome-scale assembly of Haemonchus contortus, a model gastrointestinal worm."]] +[[!tag nematode]] + +Doyle SR, Tracey A, Laing R, Holroyd N, Bartley D, Bazant W, Beasley H, Beech R, Britton C, Brooks K, Chaudhry U, Maitland K, Martinelli A, Noonan JD, Paulini M, Quail MA, Redman E, Rodgers FH, Sallé G, Shabbir MZ, Sankaranarayanan G, Wit J, Howe KL, Sargison N, Devaney E, Berriman M, Gilleard JS, Cotton JA. + +Commun Biol. 2020 Nov 9;3(1):656. doi:10.1038/s42003-020-01377-3 + +Genomic and transcriptomic variation defines the chromosome-scale assembly of _Haemonchus contortus_, a model gastrointestinal worm. + +[[!pmid 33168940 desc="“80% of 7,361 one-to-one orthologous genes are shared on syntenic chromosomes between [_H. contortus_ and _C. elegans_]” “The distance between ortholog pairs [...] is correlated up to ~100 kbp [...], but is largely lost above 100 kbp ”"]]
café
diff --git a/biblio/33561231.mdwn b/biblio/33561231.mdwn
new file mode 100644
index 00000000..df05d6ec
--- /dev/null
+++ b/biblio/33561231.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="A telomere-to-telomere assembly of Oscheius tipulae and the evolution of rhabditid nematode chromosomes."]]
+[[!tag nematode genome]]
+
+Gonzalez de la Rosa PM, Thomson M, Trivedi U, Tracey A, Tandonnet S, Blaxter M.
+
+G3 (Bethesda). 2021 Jan 18;11(1):jkaa020. doi:10.1093/g3journal/jkaa020
+
+A telomere-to-telomere assembly of Oscheius tipulae and the evolution of rhabditid nematode chromosomes.
+
+[[!pmid 33561231 desc="“subtelomeric extensions rang[ing] from 4 to 133 kb” present in germ line but absent in somatic cells."]]
diff --git a/tags/nematode.mdwn b/tags/nematode.mdwn
index 8d95f5bb..1d494f1b 100644
--- a/tags/nematode.mdwn
+++ b/tags/nematode.mdwn
@@ -49,4 +49,8 @@
The Hi-C contact map shows strong interaction between the centre of all chromosomes
([[Sun and coll., 2020|biblio/33093047]]).
+ - In _Oscheius tipulae_, there are subtelomeric extensions ranging from 4 to
+ 133 kb that are present in germ line but absent in somatic cells ([[de la
+ Rosa and coll., 2021|biblio/33561231]]).
+
[[!inline pages="tagged(nematode)" limit=0]]
Merci PoEdit !
diff --git "a/Debian/debi\303\242neries/grosmot.en.po" "b/Debian/debi\303\242neries/grosmot.en.po" index b0ab8398..66f89022 100644 --- "a/Debian/debi\303\242neries/grosmot.en.po" +++ "b/Debian/debi\303\242neries/grosmot.en.po" @@ -7,7 +7,7 @@ msgid "" msgstr "" "Project-Id-Version: \n" "POT-Creation-Date: 2022-12-16 13:24+0000\n" -"PO-Revision-Date: 2022-12-16 22:31+0900\n" +"PO-Revision-Date: 2022-12-16 22:35+0900\n" "Language: en\n" "MIME-Version: 1.0\n" "Content-Type: text/plain; charset=UTF-8\n" @@ -55,7 +55,7 @@ msgstr "I found it in:" #. type: Bullet: ' - ' msgid "le code source de XEmacs ;" -msgstr "The source code of XEmacs;" +msgstr "the source code of XEmacs;" #. type: Bullet: ' - ' msgid "une liste de gros mots pour policer les conversations dans BZFlag ;" @@ -67,17 +67,17 @@ msgstr "the random sentence generator PolyGen;" #. type: Bullet: ' - ' msgid "le code source du jeu de plateau Tagua ;" -msgstr "The source code of the board game Tagua;" +msgstr "the source code of the board game Tagua;" #. type: Bullet: ' - ' msgid "" "une base de données d'épigrammes vulguaires pour la plateforme éducative " "WIMS ;" -msgstr "A database of offensive fortunes for the educative platform WIMS;" +msgstr "a database of offensive fortunes for the educative platform WIMS;" #. type: Bullet: ' - ' msgid "le jeu de mots croisés parololottero ;" -msgstr "The crossword game parolottero;" +msgstr "the crossword game parolottero;" #. type: Bullet: ' - ' msgid "" @@ -98,7 +98,7 @@ msgstr "a source code comment aimed at somebody called Wolf;" #. type: Bullet: ' - ' msgid "a collection of rude gestures in the xwrists package." -msgstr "a collection of rude gestures in the xwrists package;" +msgstr "a collection of rude gestures in the xwrists package." #. type: Plain text msgid ""
vafa
diff --git "a/Debian/debi\303\242neries/grosmot.en.po" "b/Debian/debi\303\242neries/grosmot.en.po" index 2aac30ca..b0ab8398 100644 --- "a/Debian/debi\303\242neries/grosmot.en.po" +++ "b/Debian/debi\303\242neries/grosmot.en.po" @@ -3,38 +3,38 @@ # This file is distributed under the same license as the PACKAGE package. # FIRST AUTHOR <EMAIL@ADDRESS>, YEAR. # -#, fuzzy msgid "" msgstr "" -"Project-Id-Version: PACKAGE VERSION\n" +"Project-Id-Version: \n" "POT-Creation-Date: 2022-12-16 13:24+0000\n" -"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n" -"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n" -"Language-Team: LANGUAGE <LL@li.org>\n" -"Language: \n" +"PO-Revision-Date: 2022-12-16 22:31+0900\n" +"Language: en\n" "MIME-Version: 1.0\n" "Content-Type: text/plain; charset=UTF-8\n" "Content-Transfer-Encoding: 8bit\n" +"Last-Translator: \n" +"Language-Team: \n" +"X-Generator: Poedit 2.4.2\n" #. type: Plain text #, no-wrap msgid "[[!meta date=\"Fri, 16 Dec 2022 22:00:03 +0900\"]]\n" -msgstr "" +msgstr "[[!meta date=\"Fri, 16 Dec 2022 22:00:03 +0900\"]]\n" #. type: Plain text #, no-wrap msgid "[[!meta updated=\"Fri, 16 Dec 2022 22:00:03 +0900\"]]\n" -msgstr "" +msgstr "[[!meta updated=\"Fri, 16 Dec 2022 22:00:03 +0900\"]]\n" #. type: Plain text #, no-wrap msgid "[[!tag Debian]]\n" -msgstr "" +msgstr "[[!tag Debian]]\n" #. type: Plain text #, no-wrap msgid "[[!meta title=\"Les grots mots dans Debian.\"]]\n" -msgstr "" +msgstr "[[!meta title=\"Bad words in Debian.\"]]\n" #. type: Plain text msgid "" @@ -44,59 +44,66 @@ msgid "" "ensuite utilisé <http://codesearch.debian.net> pour étudier plus en détail " "son emploi." msgstr "" +"A discussion on the _debian-project_ mailing list caught my attention to an " +"Italian word meaning something like “would you be so kind to please go " +"somewhere else?”, but in a more direct and vulgar manner. I then used " +"<http://codesearch.debian.net> to study its usage more in detail." #. type: Plain text msgid "Je l'ai trouvé dans :" -msgstr "" +msgstr "I found it in:" #. type: Bullet: ' - ' msgid "le code source de XEmacs ;" -msgstr "" +msgstr "The source code of XEmacs;" #. type: Bullet: ' - ' msgid "une liste de gros mots pour policer les conversations dans BZFlag ;" -msgstr "" +msgstr "a list of bad words to filter conversations in BZflag;" #. type: Bullet: ' - ' msgid "le générateur aléatoire de phrases PolyGen ;" -msgstr "" +msgstr "the random sentence generator PolyGen;" #. type: Bullet: ' - ' msgid "le code source du jeu de plateau Tagua ;" -msgstr "" +msgstr "The source code of the board game Tagua;" #. type: Bullet: ' - ' msgid "" "une base de données d'épigrammes vulguaires pour la plateforme éducative " "WIMS ;" -msgstr "" +msgstr "A database of offensive fortunes for the educative platform WIMS;" #. type: Bullet: ' - ' msgid "le jeu de mots croisés parololottero ;" -msgstr "" +msgstr "The crossword game parolottero;" #. type: Bullet: ' - ' msgid "" "une base de données d'épigrammes vulguaires pour messages de bienvenue ou " "signatures de courriels ;" msgstr "" +"a database of offensive fortunes for login screens and email signatures;" #. type: Bullet: ' - ' msgid "des listes de mots de passes trop fréquents ;" -msgstr "" +msgstr "a list of (too) frequent passwords;" #. type: Bullet: ' - ' msgid "" "un commentaire destiné à un déonmmé Wolf dans le code source d'un autre " "programme ;" -msgstr "" +msgstr "a source code comment aimed at somebody called Wolf;" #. type: Bullet: ' - ' msgid "a collection of rude gestures in the xwrists package." -msgstr "" +msgstr "a collection of rude gestures in the xwrists package;" #. type: Plain text msgid "" "Ce fut une promenade rafraîchissante et récréactive dans l'univers des " "paquets Debian." msgstr "" +"That was a refreshing and pleasant recreation in the Debian package " +"universe."
updated PO files
diff --git "a/Debian/debi\303\242neries/grosmot.en.po" "b/Debian/debi\303\242neries/grosmot.en.po" new file mode 100644 index 00000000..2aac30ca --- /dev/null +++ "b/Debian/debi\303\242neries/grosmot.en.po" @@ -0,0 +1,102 @@ +# SOME DESCRIPTIVE TITLE +# Copyright (C) YEAR Free Software Foundation, Inc. +# This file is distributed under the same license as the PACKAGE package. +# FIRST AUTHOR <EMAIL@ADDRESS>, YEAR. +# +#, fuzzy +msgid "" +msgstr "" +"Project-Id-Version: PACKAGE VERSION\n" +"POT-Creation-Date: 2022-12-16 13:24+0000\n" +"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n" +"Last-Translator: FULL NAME <EMAIL@ADDRESS>\n" +"Language-Team: LANGUAGE <LL@li.org>\n" +"Language: \n" +"MIME-Version: 1.0\n" +"Content-Type: text/plain; charset=UTF-8\n" +"Content-Transfer-Encoding: 8bit\n" + +#. type: Plain text +#, no-wrap +msgid "[[!meta date=\"Fri, 16 Dec 2022 22:00:03 +0900\"]]\n" +msgstr "" + +#. type: Plain text +#, no-wrap +msgid "[[!meta updated=\"Fri, 16 Dec 2022 22:00:03 +0900\"]]\n" +msgstr "" + +#. type: Plain text +#, no-wrap +msgid "[[!tag Debian]]\n" +msgstr "" + +#. type: Plain text +#, no-wrap +msgid "[[!meta title=\"Les grots mots dans Debian.\"]]\n" +msgstr "" + +#. type: Plain text +msgid "" +"Une conversation sur la list _debian-project_ a attiré mon attention sur un " +"mot italien signifiant quelque chose comme « auriez-vous la gentillesse " +"d'aller voir ailleurs ? », mais en version plus directe et vulgaire. J'ai " +"ensuite utilisé <http://codesearch.debian.net> pour étudier plus en détail " +"son emploi." +msgstr "" + +#. type: Plain text +msgid "Je l'ai trouvé dans :" +msgstr "" + +#. type: Bullet: ' - ' +msgid "le code source de XEmacs ;" +msgstr "" + +#. type: Bullet: ' - ' +msgid "une liste de gros mots pour policer les conversations dans BZFlag ;" +msgstr "" + +#. type: Bullet: ' - ' +msgid "le générateur aléatoire de phrases PolyGen ;" +msgstr "" + +#. type: Bullet: ' - ' +msgid "le code source du jeu de plateau Tagua ;" +msgstr "" + +#. type: Bullet: ' - ' +msgid "" +"une base de données d'épigrammes vulguaires pour la plateforme éducative " +"WIMS ;" +msgstr "" + +#. type: Bullet: ' - ' +msgid "le jeu de mots croisés parololottero ;" +msgstr "" + +#. type: Bullet: ' - ' +msgid "" +"une base de données d'épigrammes vulguaires pour messages de bienvenue ou " +"signatures de courriels ;" +msgstr "" + +#. type: Bullet: ' - ' +msgid "des listes de mots de passes trop fréquents ;" +msgstr "" + +#. type: Bullet: ' - ' +msgid "" +"un commentaire destiné à un déonmmé Wolf dans le code source d'un autre " +"programme ;" +msgstr "" + +#. type: Bullet: ' - ' +msgid "a collection of rude gestures in the xwrists package." +msgstr "" + +#. type: Plain text +msgid "" +"Ce fut une promenade rafraîchissante et récréactive dans l'univers des " +"paquets Debian." +msgstr ""
vafa
diff --git "a/Debian/debi\303\242neries/grosmot.mdwn" "b/Debian/debi\303\242neries/grosmot.mdwn" new file mode 100644 index 00000000..1aee2db4 --- /dev/null +++ "b/Debian/debi\303\242neries/grosmot.mdwn" @@ -0,0 +1,26 @@ +[[!meta date="Fri, 16 Dec 2022 22:00:03 +0900"]] +[[!meta updated="Fri, 16 Dec 2022 22:00:03 +0900"]] +[[!tag Debian]] + +[[!meta title="Les grots mots dans Debian."]] + +Une conversation sur la list _debian-project_ a attiré mon attention sur un mot +italien signifiant quelque chose comme « auriez-vous la gentillesse d'aller +voir ailleurs ? », mais en version plus directe et vulgaire. J'ai ensuite +utilisé <http://codesearch.debian.net> pour étudier plus en détail son emploi. + +Je l'ai trouvé dans : + + - le code source de XEmacs ; + - une liste de gros mots pour policer les conversations dans BZFlag ; + - le générateur aléatoire de phrases PolyGen ; + - le code source du jeu de plateau Tagua ; + - une base de données d'épigrammes vulguaires pour la plateforme éducative WIMS ; + - le jeu de mots croisés parololottero ; + - une base de données d'épigrammes vulguaires pour messages de bienvenue ou signatures de courriels ; + - des listes de mots de passes trop fréquents ; + - un commentaire destiné à un déonmmé Wolf dans le code source d'un autre programme ; + - a collection of rude gestures in the xwrists package. + +Ce fut une promenade rafraîchissante et récréactive dans l'univers des paquets +Debian.
updated PO files
diff --git a/Joules.en.po b/Joules.en.po index bc02163d..2183e164 100644 --- a/Joules.en.po +++ b/Joules.en.po @@ -7,7 +7,7 @@ msgid "" msgstr "" "Project-Id-Version: PACKAGE VERSION\n" -"POT-Creation-Date: 2022-03-10 11:47+0000\n" +"POT-Creation-Date: 2022-12-16 12:58+0000\n" "PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n" "Last-Translator: FULL NAME <EMAIL@ADDRESS>\n" "Language-Team: LANGUAGE <LL@li.org>\n" @@ -127,9 +127,23 @@ msgstr "" msgid "" "Je consomme entre 6 et 7 mètres cubes d'eau par mois pour un prix d'environ " "1000 yens, qui include la production et le retraitement. Un rapport de " -"l'observatoire de l'eau de la Seine-et-Marne, de 2016, estime entre 1.6 et " -"16 % la part énergétique de la facture d'eau. En extrapolant avec ma " -"facture d'électricité, 100 yens font environ 11 MJ. L'eau est précieuse et " -"les effets de son gaspillage sont différents de ceux du gaspillage de " -"l'énergie." +"l'observatoire de l'eau de la Seine-et-Marne sur les enjeux énergétiques de " +"l'eau potable et de l'assainissement, de 2016, estime entre 1.6 et 16 % la " +"part énergétique de la facture d'eau. En extrapolant avec ma facture " +"d'électricité, 100 yens font environ 11 MJ. L'eau est précieuse et les " +"effets de son gaspillage sont différents de ceux du gaspillage de l'énergie." +msgstr "" + +#. type: Bullet: ' - ' +msgid "" +"Je travaille sur un campus qui consomme 100 000 000 kWh / an, c'est à dire " +"360 000 000 MJ / an ou 360 TJ / an. Cela inclut la consommation des " +"résidences de quelques centaines d'étudiants et de chercheurs. Imaginons " +"qu'une personne consomme 10 000 kWh par an, c'est à dire 36 GJ, ce qui " +"serait plus que la moyenne au Japon ou en Amérique, on voit que la " +"consommation résidentielle reste négligeable dans l'équation. Entre 1000 et " +"2000 personnes travaillent sur le campus. On peut donc dire que chacun " +"d'entre nous consomme de l'ordre de 360 GJ / an en moyenne, et que c'est " +"probablement un peu surestimé. En comparaison, je consomme 800 MJ * 12 ~= " +"10 GJ d'énergie en carburant pour aller travailler." msgstr ""
18S primers
diff --git a/biblio/19633714.mdwn b/biblio/19633714.mdwn new file mode 100644 index 00000000..38e42bad --- /dev/null +++ b/biblio/19633714.mdwn @@ -0,0 +1,17 @@ +[[!meta title="A method for studying protistan diversity using massively parallel sequencing of V9 hypervariable regions of small-subunit ribosomal RNA genes."]] +[[!tag eDNA]] + +Amaral-Zettler LA, McCliment EA, Ducklow HW, Huse SM. + +PLoS One. 2009 Jul 27;4(7):e6372. doi:10.1371/journal.pone.0006372 + +A method for studying protistan diversity using massively parallel sequencing of V9 hypervariable regions of small-subunit ribosomal RNA genes. + +[[!pmid 19633714 desc="Primers contain degenerate sequences and are either universal or eukaryote-based. Samples from Mount Hope Bay, Massachusetts and Palmer Station, Antarctica."]] + + >18S_1380F eukaryotic 10.1371/journal.pone.0006372 + CCCTGCCHTTTGTACACAC + >18S_1389F universal 10.1371/journal.pone.0006372 + TTGTACACACCGCCC + >18S_1510R eukaryotic 10.1371/journal.pone.0006372 + CCTTCYGCAGGTTCACCTAC diff --git a/tags/eDNA.mdwn b/tags/eDNA.mdwn index 48987409..f15996b4 100644 --- a/tags/eDNA.mdwn +++ b/tags/eDNA.mdwn @@ -18,6 +18,12 @@ GCCAGTAGTCATATGCTTGTCT >18S_701R 10.1371/journal.pone.0073935 GGAGCTGGAATTACCGC +>18S_1380F eukaryotic 10.1371/journal.pone.0006372 +CCCTGCCHTTTGTACACAC +>18S_1389F universal 10.1371/journal.pone.0006372 +TTGTACACACCGCCC +>18S_1510R eukaryotic 10.1371/journal.pone.0006372 +CCTTCYGCAGGTTCACCTAC ``` https://doi.org/10.1371/journal.pone.0073935
OIST
diff --git a/biblio/35877175.mdwn b/biblio/35877175.mdwn new file mode 100644 index 00000000..1293e127 --- /dev/null +++ b/biblio/35877175.mdwn @@ -0,0 +1,10 @@ +[[!meta title="Speed variations of bacterial replisomes."]] +[[!tag OIST]] + +Bhat D, Hauf S, Plessy C, Yokobayashi Y, Pigolotti S. + +Elife. 2022 Jul 25;11:e75884. doi:10.7554/eLife.75884 + +Speed variations of bacterial replisomes. + +[[!pmid 35877175 desc="Collaboration with two other units at OIST."]]
Huxley
diff --git a/biblio/108414.mdwn b/biblio/108414.mdwn
new file mode 100644
index 00000000..40bf75e9
--- /dev/null
+++ b/biblio/108414.mdwn
@@ -0,0 +1,12 @@
+[[!meta title="Remarks upon Appendicularia and Doliolum, Two Genera of the Tunicata"]]
+[[!tag Oikopleura]]
+
+Huxley, Thomas Henry.
+
+Philosophical Transactions of the Royal Society of London, vol. 141, 1851, pp. 595–605.
+
+Remarks upon Appendicularia and Doliolum, Two Genera of the Tunicata
+
+<https://www.jstor.org/stable/108414>
+
+Observed appendicularians in New Guinea and in the South Pacific. Found testis but no ovary. Sampled animals did not have their house. Recognised that Appendicularians are Tunicates.
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 5d015f69..29e4869a 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -673,6 +673,8 @@ Ecology
near Californian and middle American coasts ([[Barham, 1979|biblio/17735049]],
[[Galt, 1979|bilbio/Fishery_Bulletin_77_2_514]]).
- Northern Chile: [[Aravena and Palma, 2002|biblio/10.4067_S0716-078X2002000200005]].
+ - Might have been observed by Huxley ([[1851|biblio/108414]]) in New Guinea and the
+ South Pacific.
### Elsewhere in the World
Changed pages:
biblio/10.1111 j.1439-0426.2005.00657.x
Changed by: charles.plessy
Commit type: git
Date:
Formatting
diff --git a/biblio/10.1111_j.1439-0426.2005.00657.x.mdwn b/biblio/10.1111_j.1439-0426.2005.00657.x.mdwn index c202aec5..245baa5f 100644 --- a/biblio/10.1111_j.1439-0426.2005.00657.x.mdwn +++ b/biblio/10.1111_j.1439-0426.2005.00657.x.mdwn @@ -1,10 +1,10 @@ -[[!meta title="Appendicularians: an important food supply for the Argentine anchovy _Engraulis anchoita_ in coastal waters"]] +[[!meta title="Appendicularians: an important food supply for the Argentine anchovy Engraulis anchoita in coastal waters"]] [[!tag Oikopleura Fritillaria]] F. L. Capitanio, M. Pájaro, G. B. Esnal Journal of Applied Ichthyology Volume 21, Issue 5 p. 414-419. 10 October 2005 doi:10.1111/j.1439-0426.2005.00657.x -Appendicularians: an important food supply for the Argentine anchovy Engraulis anchoita in coastal waters +Appendicularians: an important food supply for the Argentine anchovy _Engraulis anchoita_ in coastal waters [[!doi 10.1111/j.1439-0426.2005.00657.x desc="_Oikopleura dioica_ and _O. fusiformis_ found in the stomach of anchovies. The two _Oikopleura_ and _Fritillaria borealis_ were also found in plankton samples."]]
Appendicularia sicula
diff --git a/biblio/354924.mdwn b/biblio/354924.mdwn new file mode 100644 index 00000000..1bdbcbe4 --- /dev/null +++ b/biblio/354924.mdwn @@ -0,0 +1,17 @@ +[[!meta title="Note sur un nouveau genre d'Appendiculaires."]] +[[!tag Oikopleura Fritillaria]] + +Hermann Fol + +Archives de zoologie expérimentale et générale (Notes et revue) 3: XLIX-LIII + +Note sur un nouveau genre d'Appendiculaires. + +First description of _Appendicularia sicula_. Not assigned to one of the 3 +tribes defined in 1872 because it shares features with all of them. + +Includes corrections to the 1872 paper: Kowalewskaia → Kowalewskia, aplostoma → haplostoma, ectothélium → ectoderme, endothélium → endoderme. + +SourceID 354924 + +Bibliographic reference and link to biodiversity library: https://marinespecies.org/aphia.php?p=sourcedetails&id=354924
Changed pages:
biblio/10.5962 p.318224
tags/Oikopleura
Changed by: charles.plessy
Commit type: git
Date:
Hermann Fol
diff --git a/biblio/10.5962_p.318224.mdwn b/biblio/10.5962_p.318224.mdwn new file mode 100644 index 00000000..d0b0e529 --- /dev/null +++ b/biblio/10.5962_p.318224.mdwn @@ -0,0 +1,10 @@ +[[!meta title="Hermann Fol, sa vie et ses travaux, avec un portrait"]] +[[!tag Oikopleura]] + +Maurice Bedot + +Revue suisse de zoologie, 2, 1894, pp 1–21 + +Hermann Fol, sa vie et ses travaux, avec un portrait + +[[!doi https://doi.org/10.5962/p.318224 desc="Éloge et bibliographie d'Hermann Fol après sa disparition."]] diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn index 7acc2bac..5d015f69 100644 --- a/tags/Oikopleura.mdwn +++ b/tags/Oikopleura.mdwn @@ -4,8 +4,9 @@ Oikopleura ========== _Oikopleura dioica_ ([NCBI:txid34765](http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=34765)) -is a tunicate larvacean (synonym: urochordate appendicularian) plankton. Thus, -it belongs to the same "chordate" phylum as us. As the name indicates, it is +is a tunicate larvacean (synonym: urochordate appendicularian) plankton +discovered by [[Hermann Fol|biblio/10.5962_p.318224]]). +It belongs to the same "chordate" phylum as us. As the name indicates, it is the only _dioecious_ species of _Oikopleura_ (that is: male and female organisms are distinct). Its reproduction is _semelparous_: the animals die afer releasing its gametes. Each animal secretes a mucus "house" that is used
Changed pages:
biblio/10.1101 2020.09.08.286724
biblio/33159152
tags/cell culture
Changed by: charles.plessy
Commit type: git
Date:
tu tudu tu tudu
diff --git a/biblio/10.1101_2020.09.08.286724.mdwn b/biblio/10.1101_2020.09.08.286724.mdwn
deleted file mode 100644
index 9cea5b64..00000000
--- a/biblio/10.1101_2020.09.08.286724.mdwn
+++ /dev/null
@@ -1,10 +0,0 @@
-[[!meta title="Cell culture-based shark karyotyping as a resource for chromosome-scale genome analysis"]]
-[[!tag bioRxiv cell_culture karyotype]]
-
-Yoshinobu Uno, Ryo Nozu, Itsuki Kiyatake, Nobuyuki Higashiguchi, Shuji Sodeyama, Kiyomi Murakumo, Keiichi Sato, Shigehiro Kuraku
-
-bioRxiv 2020.09.08.286724; doi: https://doi.org/10.1101/2020.09.08.286724
-
-Cell culture-based shark karyotyping as a resource for chromosome-scale genome analysis
-
-[[!doi 10.1101/2020.09.08.286724 desc="Primary cell culture of fibroblasts and lymphocytes. Mitogens were used to stimulate lymphocyte growth. “2n = 102 for the whale shark (Rhincodon typus) and zebra shark (Stegostoma fasciatum), and 2n = 106 for the brownbanded bamboo shark (Chiloscyllium punctatum) and whitespotted bamboo shark (C. plagiosum)”. In comparison with teleost cell culture medium, shark cells needed a higher osmolarity and the medium was supplemented with 333 mM urea, 188 mM NaCl and 54 mM trimethylamine N-oxide."]]
diff --git a/biblio/33159152.mdwn b/biblio/33159152.mdwn
new file mode 100644
index 00000000..bbb40060
--- /dev/null
+++ b/biblio/33159152.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Cell culture-based karyotyping of orectolobiform sharks for chromosome-scale genome analysis."]]
+[[!tag cell_culture karyotype]]
+
+Yoshinobu Uno, Ryo Nozu, Itsuki Kiyatake, Nobuyuki Higashiguchi, Shuji Sodeyama, Kiyomi Murakumo, Keiichi Sato, Shigehiro Kuraku
+
+Commun Biol. 2020 Nov 6;3(1):652. doi:10.1038/s42003-020-01373-7
+
+Cell culture-based karyotyping of orectolobiform sharks for chromosome-scale genome analysis.
+
+[[!pmid 33159152 desc="Primary cell culture of fibroblasts and lymphocytes. Mitogens were used to stimulate lymphocyte growth. “2n = 102 for the whale shark (Rhincodon typus) and zebra shark (Stegostoma fasciatum), and 2n = 106 for the brownbanded bamboo shark (Chiloscyllium punctatum) and whitespotted bamboo shark (C. plagiosum)”. In comparison with teleost cell culture medium, shark cells needed a higher osmolarity and the medium was supplemented with 333 mM urea, 188 mM NaCl and 54 mM trimethylamine N-oxide."]]
diff --git a/tags/cell_culture.mdwn b/tags/cell_culture.mdwn
index b387b0ce..f4a0970c 100644
--- a/tags/cell_culture.mdwn
+++ b/tags/cell_culture.mdwn
@@ -8,5 +8,6 @@ A few notes that just scratch the surface of a vast field…
- [[Marteijn and coll. (2003)|biblio/12474249]] optimised a culture medium using a genetic algorithm. This methdod
has been used at least once in invertebrates ([[Munroe and coll. (2019)|biblio/30747414]]).
- [[Kawamura and coll. (2021)|biblio/33899125]] reported the use of plasmin to establish coral cell lines.
+ - Shark cells need high osmolarity and a supplement of 333 mM urea, 188 mM NaCl and 54 mM trimethylamine N-oxide ([[Uno and coll., 2020|biblio/33159152]]).
[[!inline pages="tagged(cell_culture)" limit=0]]
Changed pages:
biblio/10.1101 2022.05.30.494079
tags/LAST
Changed by: charles.plessy
Commit type: git
Date:
dnarrange tutorial
diff --git a/biblio/10.1101_2022.05.30.494079.mdwn b/biblio/10.1101_2022.05.30.494079.mdwn new file mode 100644 index 00000000..85b47e27 --- /dev/null +++ b/biblio/10.1101_2022.05.30.494079.mdwn @@ -0,0 +1,10 @@ +[[!meta title="Finding rearrangements in nanopore DNA reads with last and dnarrange"]] +[[!tag bioRxiv LAST]] + +Martin C. Frith, Satomi Mitsuhashi + +Posted August 15, 2022. doi:10.1101/2022.05.30.494079 + +Finding rearrangements in nanopore DNA reads with last and dnarrange + +[[!doi 10.1101/2022.05.30.494079 desc="Tutorial on how to use `dnarrange`. Examples of gene conversion, repeat insertion in the reference, pseudogene insertion in the query, etc."]] diff --git a/tags/LAST.mdwn b/tags/LAST.mdwn index 8a7d8a81..5a360e45 100644 --- a/tags/LAST.mdwn +++ b/tags/LAST.mdwn @@ -37,4 +37,7 @@ _bibliography in progress..._ - JRA (Joint Read Alignment) uses LAST [[Shrestha and coll., 2018|biblio/29182778]]. + - A tutorial for the use of `dnarrange` is published in [[Frith and + Mitsuhashi, 2022|biblio/10.1101_2022.05.30.494079]]. + [[!inline pages="tagged(LAST)" actions="no" limit=0]]
Correction
diff --git a/biblio/10.1007_s00227-003-1075-y.mdwn b/biblio/10.1007_s00227-003-1075-y.mdwn index a457c0f8..df72e1c5 100644 --- a/biblio/10.1007_s00227-003-1075-y.mdwn +++ b/biblio/10.1007_s00227-003-1075-y.mdwn @@ -1,4 +1,4 @@ -[[!meta title="House formation and feeding behaviour of _Fritillaria borealis_ (Appendicularia: Tunicata)"]] +[[!meta title="House formation and feeding behaviour of_Fritillaria borealis (Appendicularia: Tunicata)"]] [[!tag Fritillaria]] Flood, P.R. @@ -7,4 +7,4 @@ Marine Biology 143, 467–475 (2003). doi:10.1007/s00227-003-1075-y House formation and feeding behaviour of _Fritillaria borealis_ (Appendicularia: Tunicata) -[[!doi 10.1007/s00227-003-1075-y desc="“Suspended particles, between ~0.2 and 30 μm in diameter, are retained” “most of the Fritillaria borealis organism was located within an acellular, mucous-like feeding structure, about 2 mm wide [...]. Only the posterior (gonadal) part of the animal trunk and the anterior "shoulders" of the tail were exposed to the outside” “The difference in volume between the inflated and deflated states of this filter section was about eightfold.” “a water processing capacity of ~10 to 12 ml h−1 or ~250 ml day−1 therefore seems reasonable for an adult.” “ the sophisticated sleeve-like extension of the tail chamber, enabling F. borealis to swim with its deflated house in position for later reinflation, needs verification in other species.”"]] +[[!doi 10.1007/s00227-003-1075-y desc="“Suspended particles, between ~0.2 and 30 μm in diameter, are retained” “most of the Fritillaria borealis organism was located within an acellular, mucous-like feeding structure, about 2 mm wide [...]. Only the posterior (gonadal) part of the animal trunk and the anterior “shoulders” of the tail were exposed to the outside” “The difference in volume between the inflated and deflated states of this filter section was about eightfold.” “a water processing capacity of ~10 to 12 ml h−1 or ~250 ml day−1 therefore seems reasonable for an adult.” “ the sophisticated sleeve-like extension of the tail chamber, enabling F. borealis to swim with its deflated house in position for later reinflation, needs verification in other species.”"]]
Changed pages:
biblio/10.1111 j.1439-0426.2005.00657.x
tags/Fritillaria
tags/Oikopleura
Changed by: charles.plessy
Commit type: git
Date:
anchovies
diff --git a/biblio/10.1111_j.1439-0426.2005.00657.x.mdwn b/biblio/10.1111_j.1439-0426.2005.00657.x.mdwn
new file mode 100644
index 00000000..c202aec5
--- /dev/null
+++ b/biblio/10.1111_j.1439-0426.2005.00657.x.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Appendicularians: an important food supply for the Argentine anchovy _Engraulis anchoita_ in coastal waters"]]
+[[!tag Oikopleura Fritillaria]]
+
+F. L. Capitanio, M. Pájaro, G. B. Esnal
+
+Journal of Applied Ichthyology Volume 21, Issue 5 p. 414-419. 10 October 2005 doi:10.1111/j.1439-0426.2005.00657.x
+
+Appendicularians: an important food supply for the Argentine anchovy Engraulis anchoita in coastal waters
+
+[[!doi 10.1111/j.1439-0426.2005.00657.x desc="_Oikopleura dioica_ and _O. fusiformis_ found in the stomach of anchovies. The two _Oikopleura_ and _Fritillaria borealis_ were also found in plankton samples."]]
diff --git a/tags/Fritillaria.mdwn b/tags/Fritillaria.mdwn
index 511cd92a..ed9d0dc3 100644
--- a/tags/Fritillaria.mdwn
+++ b/tags/Fritillaria.mdwn
@@ -11,4 +11,8 @@ _in progress_
- Admirality bay, King George island, Antarctica, where the two most abundant appendicularians
were _F. borealis_ and _O. gaussica_ ([[Panasiuk and Kalarus, 2021|biblio/10.3390_d13120675]).
+## South Atlantic
+
+ - _Fritillaria borealis_ (and _O. dioica_ and _O. fusiformis_) was found near Argentina by Capitanio, Pájaro and Esnal [[(2005)|10.1111_j.1439-0426.2005.00657.x]].
+
[[!inline pages="tagged(Fritillaria)" limit=0]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 990895ba..7acc2bac 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -610,6 +610,8 @@ Ecology
whether the viruses are digested.
- Houses and fecal pellets of _Oikopleura_ species are consumed by eel larvae
([[Mochioka and Iwamizu, 1996|biblio/10.1007_BF00353257]]).
+ - _O. dioica_ and _O. fusiformis_ are eaten by anchovies ([[Capitanio, Pájaro and Esnal,
+ 2005|biblio/10.1111_j.1439-0426.2005.00657.x]]).
- In the Black Sea, invasion of _O. dioica's predator_ _Mnemiopsis leidyi_ (a
ctenophore) decimated its population, which was restored to higher levels by the
subsequent invasion of the predator's predator _Beroe ovata_. [[Shiganova,
@@ -683,6 +685,7 @@ Ecology
most abundant in summer ([[Viñas and coll.,
2013|biblio/10.1080_17451000.2012.745003]]), Caravelas river estuary and
adjascent costal areas ([[Carvalho and Bonecker, 2010|biblio/10.1590_S1516-89132010000100020]]).
+ - Found near Argentina ([[Capitanio, Pájaro and Esnal, 2005|biblio/10.1111_j.1439-0426.2005.00657.x]]).
- Southen sea of Cortez (Mexico), near Isla El Paradito (water temperature =
30 °C; night dives), _O. dioica_ was found but not as abundant as other
larvaceans ([[Galt, Grober and Sykes, 1985|biblio/10.2307_1541178]]).
Changed pages:
biblio/10.1007 s00227-003-1075-y
tags/Fritillaria
Changed by: charles.plessy
Commit type: git
Date:
Fritillaria
diff --git a/biblio/10.1007_s00227-003-1075-y.mdwn b/biblio/10.1007_s00227-003-1075-y.mdwn new file mode 100644 index 00000000..a457c0f8 --- /dev/null +++ b/biblio/10.1007_s00227-003-1075-y.mdwn @@ -0,0 +1,10 @@ +[[!meta title="House formation and feeding behaviour of _Fritillaria borealis_ (Appendicularia: Tunicata)"]] +[[!tag Fritillaria]] + +Flood, P.R. + +Marine Biology 143, 467–475 (2003). doi:10.1007/s00227-003-1075-y + +House formation and feeding behaviour of _Fritillaria borealis_ (Appendicularia: Tunicata) + +[[!doi 10.1007/s00227-003-1075-y desc="“Suspended particles, between ~0.2 and 30 μm in diameter, are retained” “most of the Fritillaria borealis organism was located within an acellular, mucous-like feeding structure, about 2 mm wide [...]. Only the posterior (gonadal) part of the animal trunk and the anterior "shoulders" of the tail were exposed to the outside” “The difference in volume between the inflated and deflated states of this filter section was about eightfold.” “a water processing capacity of ~10 to 12 ml h−1 or ~250 ml day−1 therefore seems reasonable for an adult.” “ the sophisticated sleeve-like extension of the tail chamber, enabling F. borealis to swim with its deflated house in position for later reinflation, needs verification in other species.”"]] diff --git a/tags/Fritillaria.mdwn b/tags/Fritillaria.mdwn index 25be5e48..511cd92a 100644 --- a/tags/Fritillaria.mdwn +++ b/tags/Fritillaria.mdwn @@ -2,6 +2,8 @@ _in progress_ + - _Fritillaria borealis_ can swim with its house deflated ([[Flood, 2003|biblio/10.1007_s00227-003-1075-y]]). + # Found in: ## Antarctica
Changed pages:
biblio/10.3390 d13120675
tags/Fritillaria
tags/Oikopleura
Changed by: charles.plessy
Commit type: git
Date:
Antarctica
diff --git a/biblio/10.3390_d13120675.mdwn b/biblio/10.3390_d13120675.mdwn
new file mode 100644
index 00000000..e62a315f
--- /dev/null
+++ b/biblio/10.3390_d13120675.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Appendicularia (Tunicata) in an Antarctic Glacial Fjord–Chaotic Fjordic Structure Community or Good Indicators of Oceanic Water Masses?"]]
+[[!tag Oikopleura Fritillaria]]
+
+Anna Panasiuk and Marcin Kalarus
+
+Diversity 2021, 13(12), 675. doi:10.3390/d13120675
+
+Appendicularia (Tunicata) in an Antarctic Glacial Fjord–Chaotic Fjordic Structure Community or Good Indicators of Oceanic Water Masses?
+
+[[!doi 10.3390/d13120675 desc="_Fritillaria borealis_ was the most abundant and found mainly in summer, _Oikopleura gaussica_ was the second most abundant and found mainly in winter. _F. antartica_, _F. aberrans_, _O. fusiformis_ and _O. parva_ were also found."]]
diff --git a/tags/Fritillaria.mdwn b/tags/Fritillaria.mdwn
index 42550b12..25be5e48 100644
--- a/tags/Fritillaria.mdwn
+++ b/tags/Fritillaria.mdwn
@@ -1,4 +1,12 @@
[[!meta title="pages tagged Fritillaria"]]
-[[!inline pages="tagged(Fritillaria)" actions="no" archive="yes"
-feedshow=10]]
+_in progress_
+
+# Found in:
+
+## Antarctica
+
+ - Admirality bay, King George island, Antarctica, where the two most abundant appendicularians
+ were _F. borealis_ and _O. gaussica_ ([[Panasiuk and Kalarus, 2021|biblio/10.3390_d13120675]).
+
+[[!inline pages="tagged(Fritillaria)" limit=0]]
diff --git a/tags/Oikopleura.mdwn b/tags/Oikopleura.mdwn
index 7e2cd656..990895ba 100644
--- a/tags/Oikopleura.mdwn
+++ b/tags/Oikopleura.mdwn
@@ -705,6 +705,11 @@ Ecology
- Fossils in China: [[Zhang Aiyun, 1987|biblio/10.1360_yb1987-30-8-888]].
Body rich in vanadium but not the house.
+### Not found in:
+
+ - Admirality bay, King George island, Antarctica, where the two most abundant appendicularians
+ were _F. borealis_ and _O. gaussica_ ([[Panasiuk and Kalarus, 2021|biblio/10.3390_d13120675]).
+
Laboratory culture
------------------
Add PMID
diff --git a/biblio/31937756.mdwn b/biblio/31937756.mdwn index 6fe6ecc4..af798cf4 100644 --- a/biblio/31937756.mdwn +++ b/biblio/31937756.mdwn @@ -9,4 +9,4 @@ Nat Commun. 2020 Jan 14;11(1):254. doi: 10.1038/s41467-019-14105-1. Environmental DNA reveals seasonal shifts and potential interactions in a marine community. -[[!pmid desc="Found Oikopleura 18S sequences in MiSeq run SRR8473276."]] +[[!pmid 31937756 desc="Found Oikopleura 18S sequences in MiSeq run SRR8473276."]]
Café
diff --git a/biblio/36324505.mdwn b/biblio/36324505.mdwn new file mode 100644 index 00000000..748975e9 --- /dev/null +++ b/biblio/36324505.mdwn @@ -0,0 +1,37 @@ +[[!meta title="Improved Nanopore full-length cDNA sequencing by PCR-suppression."]] +[[!tag Nanopore amplification PCR]] + +Bayega A, Oikonomopoulos S, Wang YC, Ragoussis J. + +Front Genet. 2022 Oct 17;13:1031355. doi:10.3389/fgene.2022.1031355. + +Improved Nanopore full-length cDNA sequencing by PCR-suppression. + +[[!pmid 36324505 desc="“We observed [a range of 2.2 to 8.3-fold increase in yield] of amplicons from the Panhandle method compared to the ONT method.” “Further, the cDNA profile of samples from Panhandle protocol showed a significantly reduced amount of molecules below 600 bp compared to ONT protocol.” “Reads generated with the ONT protocol showed a marked 3′ bias with only about 40–50% of reads showing full-length coverage of the genes”"]] + + +for each sample total RNA was added together with + +RNA + +1 μL of 10 μm oligo (dT) primer + +1 μL of 10 mm dNTPs + +Final volume: 11.6 μL pre-RT reaction. + +the reaction was incubated at 72°C 3 min. 4°C 10 min, 25°C 1 min, then held at 4°C. + +A 10.4μL reverse transcription (RT) reaction containing +1 X Maxima H Buffer, +1 μL RNaseOut (NEB), +2 μL of 100 μm TSO, +2 μL of 5M Betaine (Sigma-Aldrich), +and 1 μL of Maxima H reverse transcriptase was added to the pre-RT reaction and the reaction incubated as shown in Supplementary Protocol. + +Following reverse transcription, + +5 μL of cDNA was used +in a 50 μL PCR reaction containing +1 μL of 10 μm PCR primer and +25 μL of 2x LongAmp Taq Master mix (NEB). + +PCR was performed as shown in Supplementary Protocol. 20 PCR cycles were used. Following PCR, 1 μL of exonuclease (NEB) was added to each reaction and incubated for 15 min at 37°C followed by 15 min at 80°C and the samples were purified using 1x AMPure XP beads (Beckman Coulter). + diff --git a/tags/amplification.mdwn b/tags/amplification.mdwn index 7c8520fe..c2b6bb67 100644 --- a/tags/amplification.mdwn +++ b/tags/amplification.mdwn @@ -18,6 +18,11 @@ concentration and annealing temperature) were investigated by [[Dai and coll., complex sample, relatively long ITR (compared to primer length), high [annealing temperature], and high concentration of primer should be used.”. +Suppression PCR was used to prepare transcriptome library for Oxford Nanopore +Technologies sequencers ([[Bayega and coll., 2022|biblo/36324505]]). +Transcript coverage and amplicon length were improved. Surprisingly, yield was +also higher. + ## Other methods - Primary Template-directed Amplification (PTA), a kind of MDA with terminators
Fièvre
diff --git a/biblio/36379955.mdwn b/biblio/36379955.mdwn new file mode 100644 index 00000000..796db0f7 --- /dev/null +++ b/biblio/36379955.mdwn @@ -0,0 +1,10 @@ +[[!meta title="Muscle5: High-accuracy alignment ensembles enable unbiased assessments of sequence homology and phylogeny."]] +[[!tag alignment software]] + +Nat Commun. 2022 Nov 15;13(1):6968. doi:10.1038/s41467-022-34630-w + +Edgar RC. + +Muscle5: High-accuracy alignment ensembles enable unbiased assessments of sequence homology and phylogeny. + +[[!pmid 36379955 desc="Random variations of HMM parameters and guide trees in different replicates to explore systematic biases and remove them by averaging the replicates. “Unlike typical conservation-based metrics, a column with many gaps or with biochemically dissimilar amino acids will be assigned high [confidence] if it is consistently reproduced.”"]]